The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	216393	245676	3188530	tail,portal,transposase,head,terminase,capsid	Paracoccus_phage(26.67%)	31	NA	NA
WP_080588209.1|216393_216618_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023003513.1|217914_219378_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_160384112.1|219410_220208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160384111.1|220166_221243_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	34.7	9.2e-42
WP_011336892.1|221246_221891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336893.1|222104_222587_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	47.0	7.1e-10
WP_011336894.1|222599_223409_-	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	50.2	3.8e-64
WP_011336895.1|223462_224269_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	56.6	9.8e-81
WP_011336896.1|224670_225669_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011336897.1|225681_226071_+	response regulator	NA	NA	NA	NA	NA
WP_011336898.1|226141_226459_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	58.9	2.1e-23
WP_011336899.1|226592_226931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336900.1|226934_227252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061350815.1|227258_228743_-	hypothetical protein	NA	A0A0S3UG21	Pseudomonas_phage	30.2	3.6e-12
WP_011336902.1|228759_229650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061350816.1|229649_234656_-	hypothetical protein	NA	A0A0U4JEA4	Pseudomonas_phage	53.0	9.5e-49
WP_017140045.1|234718_234964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140046.1|235038_235419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336906.1|235415_235856_-	hypothetical protein	NA	A0A2P1N076	Streptomyces_phage	34.4	2.5e-06
WP_011336907.1|235865_236246_-	DUF3168 domain-containing protein	NA	A0A0U2BX31	Paracoccus_phage	55.6	2.0e-28
WP_011336908.1|236249_236417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336909.1|236413_236887_-	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	51.9	1.1e-26
WP_011336910.1|236883_237216_-|head,tail	head-tail adaptor protein	head,tail	A0A0U2BXJ0	Paracoccus_phage	44.5	2.0e-16
WP_011336911.1|237212_237719_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011336912.1|237723_238014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336913.1|238146_239481_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	37.4	7.1e-52
WP_011336914.1|239734_240478_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011336915.1|240488_241448_-	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	36.2	3.0e-20
WP_017140047.1|241444_242680_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	25.8	6.4e-23
WP_011336917.1|242826_243699_-	EamA family transporter	NA	NA	NA	NA	NA
WP_011336918.1|244017_245676_-|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	32.3	1.7e-79
>prophage 2
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	376989	386036	3188530	tRNA	uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_011336989.1|376989_379212_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.9	8.3e-114
WP_011336990.1|379335_379857_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	77.6	4.6e-47
WP_011336991.1|380070_380685_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	45.3	3.8e-24
WP_009563716.1|380797_382090_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	2.5e-94
WP_011336992.1|382196_382754_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_002722646.1|383045_383372_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	54.4	4.3e-19
WP_002722648.1|383387_385052_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002722650.1|385061_386036_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.3	1.0e-52
>prophage 3
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	630642	667532	3188530	tail,portal,head,terminase,protease,capsid	Paracoccus_phage(20.0%)	37	NA	NA
WP_011337174.1|630642_631377_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011337175.1|631392_631689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023003546.1|631695_632373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337177.1|632514_632712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140100.1|632806_633460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337179.1|633928_634381_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011337180.1|634619_635372_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017140102.1|636141_636585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160384101.1|637561_639058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162791924.1|639911_641051_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_011337187.1|641169_642381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337188.1|642377_644183_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_160384100.1|644250_644694_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_011337190.1|644848_645346_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	47.0	5.6e-10
WP_011337191.1|645358_646168_-	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	50.0	4.9e-64
WP_011337192.1|646222_647029_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	57.8	1.6e-83
WP_011337193.1|647332_648238_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011336898.1|648308_648626_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	58.9	2.1e-23
WP_017140105.1|648762_649101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337195.1|649104_649422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337196.1|649428_650913_-	hypothetical protein	NA	G8DH61	Emiliania_huxleyi_virus	32.5	1.6e-12
WP_017140106.1|651819_656826_-	hypothetical protein	NA	A0A0U4JEA4	Pseudomonas_phage	52.5	3.1e-47
WP_023003549.1|656964_657210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337200.1|657284_657671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337201.1|657667_658111_-	hypothetical protein	NA	A0A2P1N076	Streptomyces_phage	33.3	1.8e-07
WP_011337202.1|658120_658501_-	DUF3168 domain-containing protein	NA	A0A0U2BX31	Paracoccus_phage	53.2	3.8e-27
WP_011337203.1|658504_659062_-	hypothetical protein	NA	A0A0U2C0P4	Paracoccus_phage	37.3	2.9e-15
WP_011337204.1|659061_659394_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_011337205.1|659390_659732_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011337206.1|659728_660163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337207.1|660233_661535_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	43.1	1.3e-79
WP_011337208.1|661547_662387_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	58.1	1.4e-69
WP_011337209.1|662383_663634_-|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.3	5.8e-80
WP_011337210.1|663633_665343_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	41.9	6.2e-133
WP_017140107.1|665344_665707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337212.1|665863_666763_-	AAA family ATPase	NA	I3ULZ4	Rhodobacter_phage	56.1	3.9e-30
WP_011337213.1|666869_667532_-	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	40.6	4.2e-37
>prophage 4
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	978156	987245	3188530	tail,portal,head,terminase,capsid	Azospirillum_phage(40.0%)	12	NA	NA
WP_017140144.1|978156_979767_-|terminase	terminase large subunit	terminase	B0VK29	Azospirillum_phage	27.0	2.1e-37
WP_011337420.1|979766_980162_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_011337421.1|980158_980473_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_011337422.1|980475_980892_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017140145.1|980884_981277_-	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	40.5	6.3e-09
WP_023003570.1|981290_981602_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011337424.1|981796_983269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337425.1|983253_983604_-	HNH endonuclease	NA	Q38456	Bacillus_phage	48.9	5.5e-20
WP_011337426.1|983606_984203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140147.1|984202_985738_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	36.0	5.0e-41
WP_011337428.1|985734_986055_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_011337429.1|986051_987245_-|portal	phage portal protein	portal	M1PLL1	Streptococcus_phage	31.5	1.5e-40
>prophage 5
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	1049751	1120317	3188530	tail,portal,head,protease,capsid	Paracoccus_phage(23.53%)	61	NA	NA
WP_002719573.1|1049751_1050477_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_011337476.1|1050466_1051420_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002719575.1|1051416_1051701_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017140153.1|1051809_1052349_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114071680.1|1052358_1055226_+	helicase	NA	A0A248SJQ0	Salicola_phage	28.6	2.9e-26
WP_011337479.1|1055231_1055528_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002719579.1|1055582_1055921_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_002719580.1|1056200_1056710_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_017140155.1|1056897_1057647_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011337481.1|1057728_1058745_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002719583.1|1058800_1060669_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011337483.1|1060843_1063720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002719585.1|1063883_1064576_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_002719586.1|1064621_1065914_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011337485.1|1066156_1066504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002719588.1|1066500_1066887_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.1	2.6e-07
WP_011337486.1|1066864_1067782_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_011337487.1|1067778_1068237_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011337488.1|1068238_1070299_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011337489.1|1070306_1070675_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	35.3	9.8e-12
WP_011337490.1|1070665_1070950_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_160384159.1|1070946_1071369_-	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_011337493.1|1074087_1075875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337494.1|1075978_1077661_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.4	3.9e-07
WP_002719598.1|1077749_1078118_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	38.5	1.5e-12
WP_011337495.1|1078114_1078444_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_050988678.1|1078776_1080729_+	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_011337497.1|1080725_1084034_+	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011337498.1|1084030_1086217_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011337499.1|1086213_1088280_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011337500.1|1088276_1090055_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011337501.1|1090051_1091869_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011337502.1|1091865_1094481_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011337503.1|1094539_1095205_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002719608.1|1095324_1096788_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.0	1.2e-47
WP_002719609.1|1096872_1097487_-	CvpA family protein	NA	NA	NA	NA	NA
WP_002719610.1|1097505_1098864_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_002719611.1|1098996_1099422_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_002719612.1|1099422_1100169_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	8.7e-07
WP_049763397.1|1100165_1100900_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011337504.1|1100944_1101994_-	alanine racemase	NA	NA	NA	NA	NA
WP_002719615.1|1102222_1102960_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_002719616.1|1103138_1103372_+	acyl carrier protein	NA	I1TR04	Pseudomonas_phage	43.9	7.3e-05
WP_011337505.1|1103869_1105132_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017140158.1|1105131_1106310_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011840819.1|1106380_1106824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023003587.1|1106816_1108115_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.7	1.3e-71
WP_011337509.1|1108187_1109363_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.3	1.5e-58
WP_002719622.1|1109364_1109598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043764141.1|1109608_1110166_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	49.3	1.4e-30
WP_011337511.1|1110231_1111428_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	42.2	3.6e-63
WP_011337512.1|1111522_1112122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337513.1|1112121_1112457_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011337514.1|1112453_1112852_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_002719628.1|1112889_1113303_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_017140161.1|1113620_1113821_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_017140162.1|1113813_1114464_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	28.1	3.3e-10
WP_011337517.1|1114473_1115106_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	51.9	6.1e-62
WP_011337518.1|1115105_1115990_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	43.6	7.2e-61
WP_009564474.1|1115986_1116427_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	1.5e-27
WP_011337519.1|1116426_1120317_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	37.6	2.3e-220
>prophage 6
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	1655985	1694645	3188530	tail,tRNA,portal,head,protease,capsid	Paracoccus_phage(36.36%)	33	NA	NA
WP_011337883.1|1655985_1657026_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011337884.1|1657111_1660396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002720132.1|1660486_1660948_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011337885.1|1661358_1662702_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.7	1.5e-20
WP_011337886.1|1662691_1663210_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_011337887.1|1663405_1664182_-	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_002720136.1|1664551_1665679_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_011337888.1|1665787_1668337_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011337889.1|1668428_1669664_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	37.9	4.8e-10
WP_011337890.1|1669712_1670864_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011337891.1|1671031_1671775_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011337892.1|1672110_1673244_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_017140227.1|1673374_1674589_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011337894.1|1674699_1675923_-	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	3.6e-34
WP_011337895.1|1676057_1676627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140228.1|1676856_1678230_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011337897.1|1678226_1678670_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023003635.1|1680085_1680418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162791925.1|1680450_1683912_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	37.4	3.9e-102
WP_023003639.1|1684067_1684493_-	hypothetical protein	NA	S4TR39	Salmonella_phage	31.4	1.3e-10
WP_023003640.1|1684542_1685217_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	32.6	7.1e-16
WP_011337903.1|1685225_1685870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023003642.1|1685873_1688195_-	hypothetical protein	NA	A0A2H4PI09	Pseudomonas_phage	29.6	8.6e-21
WP_023003646.1|1688599_1688932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337905.1|1689058_1689544_-	HNH endonuclease	NA	Q6XQ94	Escherichia_phage	39.5	4.2e-18
WP_023003648.1|1689709_1690129_-|tail	phage major tail protein 2	tail	NA	NA	NA	NA
WP_023003649.1|1690192_1690561_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_023003651.1|1690566_1691031_-	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	34.0	4.1e-15
WP_162129770.1|1691031_1691313_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_011337909.1|1691350_1691692_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011337910.1|1691715_1692825_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_011337911.1|1692897_1693422_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.6	3.0e-30
WP_011337912.1|1693418_1694645_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	30.8	7.5e-32
>prophage 7
NZ_CP030271	Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence	3188530	1909217	1926862	3188530	tRNA,portal,head,terminase,protease,capsid	Bacillus_phage(50.0%)	21	NA	NA
WP_011338055.1|1909217_1909862_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002720338.1|1909810_1910182_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_002720339.1|1910178_1910649_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002720340.1|1910648_1911023_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_061350849.1|1911147_1912413_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	2.0e-133
WP_002720342.1|1912537_1913170_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	61.0	5.2e-61
WP_011338057.1|1913336_1913945_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011338058.1|1914059_1915265_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011338059.1|1915261_1916950_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011338060.1|1916946_1917591_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_002720349.1|1917723_1918194_+	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	34.4	4.3e-12
WP_011338061.1|1918270_1919590_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_011338062.1|1919630_1920542_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017140245.1|1920846_1921125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011338064.1|1921137_1921644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011338065.1|1921679_1922186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011338066.1|1922187_1923249_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_011338067.1|1923250_1923805_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_017140247.1|1923804_1925067_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_011338069.1|1925051_1925393_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	32.5	3.7e-05
WP_017140248.1|1925383_1926862_-|terminase	terminase	terminase	NA	NA	NA	NA
>prophage 1
NZ_CP030272	Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence	942894	371624	428770	942894	transposase,protease,integrase,tail	Vibrio_phage(17.65%)	55	371771:371789	398503:398521
WP_011339201.1|371624_373001_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
371771:371789	attL	CGAGGACGGCGCGGCGGCA	NA	NA	NA	NA
WP_011339202.1|373517_374810_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011339203.1|374806_375508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140353.1|375504_375720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140354.1|375716_375926_-	DUF4031 domain-containing protein	NA	A0A0A8IK97	Aurantimonas_phage	59.1	7.7e-14
WP_017140355.1|376082_376352_-	hypothetical protein	NA	A0A1X9HWB1	Ruegeria_phage	36.7	6.9e-07
WP_017140356.1|376348_376576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140357.1|376670_377108_+	hypothetical protein	NA	Q8W6P3	Burkholderia_virus	36.6	1.6e-13
WP_011339204.1|377104_377611_+	hypothetical protein	NA	M4SPS7	Rhodobacter_phage	39.2	3.3e-10
WP_002723970.1|377932_378577_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011339205.1|378601_381721_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011339206.1|381737_382901_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011339207.1|382997_384833_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011339208.1|385068_386871_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002723978.1|387395_388223_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011339210.1|388405_389911_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011339211.1|389924_390398_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011339212.1|390541_391201_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011339213.1|391348_392260_-	porin	NA	NA	NA	NA	NA
WP_002723983.1|392500_392674_-	YdcH family protein	NA	NA	NA	NA	NA
WP_030002931.1|393204_393888_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_011339215.1|394395_396174_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011339216.1|396307_396772_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011339217.1|396830_397547_-	LrgB family protein	NA	NA	NA	NA	NA
WP_011339218.1|397539_397893_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_017140360.1|398001_398658_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
398503:398521	attR	TGCCGCCGCGCCGTCCTCG	NA	NA	NA	NA
WP_011339220.1|398658_399495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009561538.1|399496_400360_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011339221.1|400592_401858_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011339222.1|401883_402861_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	2.8e-21
WP_011339223.1|403072_403786_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011339224.1|403933_404371_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011339225.1|404367_405267_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_009561543.1|405761_406259_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011339226.1|406938_408045_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011339227.1|408051_409524_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	3.7e-09
WP_023004202.1|409921_411085_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011339229.1|411094_413821_-	methionine synthase	NA	NA	NA	NA	NA
WP_160384144.1|413817_414843_-	homocysteine S-methyltransferase family protein	NA	A0A140XBC7	Dickeya_phage	54.0	1.2e-14
WP_011339231.1|415172_416051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140362.1|416047_417091_+	lipocalin	NA	NA	NA	NA	NA
WP_002724021.1|417443_417677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339233.1|418096_418291_+	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	58.2	8.8e-12
WP_011339235.1|418571_419069_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	37.7	6.8e-24
WP_011339236.1|419083_419380_+|tail	phage tail assembly protein	tail	E5E3Q0	Burkholderia_phage	51.2	8.4e-14
WP_017140364.1|419406_419535_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011339237.1|419544_421872_+	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	37.9	7.0e-55
WP_017140365.1|421864_422275_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	50.4	8.6e-33
WP_011339239.1|422271_422484_+|tail	tail protein X	tail	R9TR63	Vibrio_phage	47.8	9.9e-09
WP_011339240.1|422480_423455_+|tail	phage tail protein	tail	D4HTW7	Vibrio_phage	38.6	1.0e-44
WP_017140366.1|423598_424426_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	62.3	3.9e-93
WP_017140367.1|424763_425822_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	38.8	3.3e-60
WP_160384142.1|425989_426985_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017140369.1|427417_427921_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_114071698.1|427948_428770_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.2	8.9e-21
>prophage 2
NZ_CP030272	Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence	942894	739306	746477	942894		Rhizobium_phage(16.67%)	11	NA	NA
WP_011339479.1|739306_740653_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	47.0	6.7e-58
WP_011339480.1|740661_740973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339481.1|740969_741389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140410.1|742422_742740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339484.1|742743_743070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339485.1|743203_743521_+	hypothetical protein	NA	I3UM16	Rhodobacter_phage	57.9	2.8e-23
WP_011339486.1|743573_743795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140411.1|743787_744060_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	48.2	2.4e-15
WP_114071701.1|744287_745094_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	58.6	5.6e-84
WP_011339489.1|745148_745958_+	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	49.1	7.1e-63
WP_011339490.1|745970_746477_+	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	48.2	3.9e-11
>prophage 3
NZ_CP030272	Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence	942894	885676	923677	942894	head,integrase,capsid,portal,terminase	Rhodobacter_phage(25.93%)	48	873233:873278	923740:923785
873233:873278	attL	ATGGTGGGTGGTGAGGGGCTCGAACCCCCGACATCCTCGGTGTAAA	NA	NA	NA	NA
WP_011339591.1|885676_887008_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	36.2	6.4e-53
WP_011339592.1|887059_887488_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	50.4	8.7e-36
WP_011339593.1|887740_888223_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	51.8	1.2e-12
WP_011339594.1|888235_889045_-	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	49.4	9.2e-63
WP_011339595.1|889099_889906_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	57.0	3.4e-81
WP_011339596.1|890274_890637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339597.1|890888_891206_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	57.9	3.7e-23
WP_011339598.1|891424_891751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339599.1|891754_892072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339600.1|892078_893563_-	hypothetical protein	NA	A0A1S5R1J5	Pseudomonas_phage	30.8	1.7e-14
WP_011339601.1|893578_894469_-	hypothetical protein	NA	A0A2H4J8C7	uncultured_Caudovirales_phage	31.0	8.1e-28
WP_061350892.1|894468_899643_-	hypothetical protein	NA	F1C5E9	Cronobacter_phage	28.5	2.4e-07
WP_017140287.1|899745_900243_+	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	42.6	4.2e-26
WP_017140288.1|900205_900568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140289.1|900630_901071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339606.1|901174_901645_-	hypothetical protein	NA	M4QQ74	Salicola_phage	38.9	1.2e-17
WP_011339607.1|901756_902179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339608.1|902175_902502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339609.1|902512_903535_-|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	56.3	1.1e-105
WP_011339610.1|903616_904006_-|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	45.7	3.6e-20
WP_011339611.1|904141_905488_-	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	48.2	8.7e-58
WP_011339612.1|905484_906975_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	67.4	1.9e-178
WP_002723266.1|906974_907184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339613.1|907180_909343_-|terminase	phage terminase large subunit family protein	terminase	A0A291AUS9	Sinorhizobium_phage	35.4	1.9e-102
WP_017140290.1|909342_909999_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_011339615.1|910127_910844_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	30.5	4.0e-17
WP_017140292.1|910956_911793_-	hypothetical protein	NA	I3ULZ3	Rhodobacter_phage	47.1	9.4e-18
WP_011339617.1|911789_912374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002723274.1|912593_913247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339618.1|913243_913531_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011339619.1|913527_913995_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011339620.1|913991_914513_-	DUF1937 family protein	NA	I3UM60	Rhodobacter_phage	42.3	2.7e-23
WP_011339621.1|914649_914910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002723285.1|914906_915167_-	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	50.7	1.8e-07
WP_017140293.1|915247_915484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140294.1|915482_916238_+	helix-turn-helix domain-containing protein	NA	H6WBQ3	Rhodobacter_phage	40.0	1.7e-13
WP_011339624.1|916594_916792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339625.1|916788_917121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140295.1|917353_917713_+	hypothetical protein	NA	I3UM32	Rhodobacter_phage	44.0	4.0e-18
WP_011339628.1|917731_918718_+	YfdQ family protein	NA	H6WBP5	Rhodobacter_phage	46.9	7.5e-75
WP_017140296.1|918814_918967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140297.1|918953_919163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023004254.1|919165_919369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339629.1|919361_920471_+	phage Gp37/Gp68 family protein	NA	A0A0A8ILD3	Aurantimonas_phage	50.1	1.4e-85
WP_011339630.1|920701_920956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030002922.1|921074_921413_+	DUF4326 domain-containing protein	NA	A0A142K9N0	Gordonia_phage	35.9	4.9e-18
WP_011339632.1|921718_922435_+	hypothetical protein	NA	A0A0U2BXK1	Paracoccus_phage	64.3	3.5e-82
WP_114071702.1|922678_923677_+|integrase	site-specific integrase	integrase	A0A068CCA6	Rhizobium_phage	24.4	2.5e-09
923740:923785	attR	ATGGTGGGTGGTGAGGGGCTCGAACCCCCGACATCCTCGGTGTAAA	NA	NA	NA	NA
>prophage 1
NZ_CP030273	Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence	124316	56791	67181	124316		Enterobacteria_phage(42.86%)	10	NA	NA
WP_002724637.1|56791_57628_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.1	6.0e-49
WP_011836184.1|57829_58555_+	sulfotransferase	NA	NA	NA	NA	NA
WP_011836183.1|58921_59704_+	sulfotransferase	NA	NA	NA	NA	NA
WP_002724812.1|59678_60569_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	54.9	7.7e-87
WP_011836182.1|60565_61417_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.5	3.1e-32
WP_011836181.1|61413_62454_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.1	1.2e-91
WP_009565041.1|62457_63021_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	43.5	7.7e-32
WP_002724804.1|63084_64023_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002724803.1|64073_65036_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.1	1.3e-58
WP_050988687.1|65774_67181_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	26.6	2.1e-06
