The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	4859	26229	2259968	tail,capsid,transposase,plate	Listeria_phage(29.41%)	29	NA	NA
WP_113896302.1|4859_5822_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.2e-22
WP_113896303.1|5975_6617_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_113896304.1|6617_7589_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	46.0	3.2e-62
WP_113896305.1|7588_7789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896306.1|7769_8114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896307.1|8122_8557_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	35.6	1.2e-08
WP_113896308.1|8556_8937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896309.1|8920_9388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896310.1|9384_10488_+	DUF3383 family protein	NA	A8ATH2	Listeria_phage	34.9	5.3e-53
WP_113896311.1|10502_10901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896312.1|10983_11310_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	32.4	6.0e-05
WP_113896313.1|11296_11497_+	hypothetical protein	NA	A8ATH5	Listeria_phage	49.1	1.3e-05
WP_113896314.1|11489_16853_+	hypothetical protein	NA	E9LUR1	Lactobacillus_phage	23.7	1.8e-08
WP_019253329.1|16855_17419_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1L2JY61	Aeribacillus_phage	36.9	8.8e-20
WP_019253328.1|17418_17754_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	50.9	2.9e-26
WP_019253327.1|17746_18610_+	hypothetical protein	NA	A8ATH9	Listeria_phage	35.2	4.9e-38
WP_113896315.1|18613_18979_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094502455.1|18965_19298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094502456.1|19290_20517_+|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	33.3	3.0e-57
WP_113896316.1|20513_21422_+	hypothetical protein	NA	A8ATI3	Listeria_phage	28.4	5.2e-14
WP_162859756.1|21435_23133_+|tail	phage tail protein	tail	H7BVG0	unidentified_phage	40.9	2.8e-101
WP_113896318.1|23157_23415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162816320.1|23407_23566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094502460.1|23577_23955_+	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	60.8	2.7e-41
WP_019253318.1|23959_24124_+	hypothetical protein	NA	A0A0A1ENA2	Lactobacillus_phage	54.9	4.2e-07
WP_113896319.1|24110_24467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896320.1|24468_25380_+	SH3 domain-containing protein	NA	Q9AZ81	Lactobacillus_prophage	57.0	1.3e-97
WP_066035699.1|25554_25827_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066035700.1|25890_26229_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	49.0	1.8e-20
>prophage 2
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	69039	147429	2259968	transposase	Streptococcus_phage(25.0%)	56	NA	NA
WP_113896344.1|69039_70326_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_065533058.1|70512_70992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162859785.1|71161_72181_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_113896346.1|72340_74263_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_113896347.1|74272_76291_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_113896348.1|76489_77470_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_113896349.1|77550_78450_+	prenyltransferase	NA	NA	NA	NA	NA
WP_113896350.1|78931_80314_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	2.7e-30
WP_113896351.1|80389_81097_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_113896352.1|81117_82353_-	MFS transporter	NA	NA	NA	NA	NA
WP_113896353.1|82471_83350_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003667006.1|83495_83765_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_113896354.1|84111_84804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065869119.1|85037_85700_+	serine dehydratase	NA	NA	NA	NA	NA
WP_065869118.1|85711_86593_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003675595.1|86692_87256_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_113896355.1|87269_88937_+	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	41.4	4.0e-52
WP_113896356.1|89035_90364_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	4.3e-49
WP_003663607.1|91077_92046_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113896357.1|92223_97323_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_113896358.1|97623_98133_+	serine-rich glycoprotein adhesin	NA	NA	NA	NA	NA
WP_113896359.1|100768_101779_+	sugar transferase	NA	NA	NA	NA	NA
WP_019253804.1|101797_102988_+	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
WP_113896360.1|102990_104502_+	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
WP_113896361.1|104513_106001_+	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_113896362.1|106003_106891_+	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
WP_113896363.1|106894_109249_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_113896364.1|109263_110802_+	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_113896365.1|110794_112129_+	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_019253797.1|112112_112313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119206179.1|112551_119451_+	serine-rich glycoprotein adhesin	NA	NA	NA	NA	NA
WP_019252827.1|119517_120921_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_113896367.1|121058_122888_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_065533034.1|122967_123153_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_113896368.1|123288_124791_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_113896369.1|124836_125349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066036079.1|125392_125629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896370.1|125638_126214_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113896371.1|126430_127153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896372.1|127260_127659_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113896373.1|128055_129051_+	LCP family protein	NA	NA	NA	NA	NA
WP_113896374.1|129958_130702_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.8	3.9e-23
WP_113896375.1|130718_131360_+	sugar transferase	NA	NA	NA	NA	NA
WP_003663607.1|131361_132330_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113896376.1|132908_133841_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_113896377.1|133833_135237_+	amino acid permease	NA	NA	NA	NA	NA
WP_113896378.1|135315_135573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896379.1|136188_138081_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_113896380.1|138179_138956_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_113896381.1|139124_139517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113896382.1|139978_140692_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	46.3	2.5e-51
WP_113896383.1|140835_141498_+	glycoside hydrolase family 25	NA	A0A0A1ERA5	Lactobacillus_phage	53.9	4.6e-68
WP_113896384.1|141519_141738_+	SH3 domain-containing protein	NA	A0A0A1ERA5	Lactobacillus_phage	61.8	5.8e-20
WP_113896385.1|141891_143010_+	exonuclease SbcCD subunit D	NA	A0A222Z7Y3	Bacillus_phage	25.3	3.2e-05
WP_113896386.1|143011_146113_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_003663607.1|146460_147429_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	369192	377256	2259968	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_019251613.1|369192_370035_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	8.0e-17
WP_003666062.1|370213_370858_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003666061.1|370846_371335_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	4.3e-23
WP_035152640.1|371350_372313_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.3	1.8e-113
WP_113896509.1|372331_374242_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	4.7e-57
WP_113896510.1|374243_375455_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	1.1e-35
WP_113896511.1|375580_376846_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003666054.1|376980_377256_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
>prophage 4
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	436410	500496	2259968	tRNA,protease,transposase	Klosneuvirus(10.0%)	60	NA	NA
WP_113896493.1|436410_438072_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_113896344.1|438815_440102_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_035170602.1|440449_440704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896542.1|440733_441171_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_020843069.1|441181_443419_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1V0SJX2	Klosneuvirus	41.7	1.1e-12
WP_003674298.1|443437_443773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065867360.1|443851_444592_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_113896543.1|444592_445552_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_020843066.1|445629_445935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020843065.1|446131_446311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003665815.1|446417_447377_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_113896544.1|447610_448687_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_113896545.1|448759_450175_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003665812.1|450666_452502_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.5e-23
WP_003665811.1|452632_453784_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.3e-30
WP_113896546.1|453912_455778_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.4e-135
WP_003665807.1|455802_456375_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_113896547.1|456387_457440_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003668175.1|457560_457932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896548.1|457992_458940_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_113896549.1|458952_459858_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003665800.1|460056_460416_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_065532820.1|460435_462694_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	6.7e-18
WP_003665798.1|462707_463019_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003668183.1|463005_463308_-	YlxR family protein	NA	NA	NA	NA	NA
WP_019254158.1|463336_464524_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003674323.1|464544_465018_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_113896550.1|465151_469483_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	29.7	2.7e-15
WP_113896551.1|469558_471292_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	22.0	1.1e-07
WP_113896552.1|471320_472595_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003665791.1|472617_473403_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_113897585.1|473422_474202_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.8	5.8e-22
WP_035157866.1|474531_475095_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003666862.1|475099_475822_-	UMP kinase	NA	NA	NA	NA	NA
WP_003666861.1|475903_476779_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003666860.1|476877_477666_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_113896553.1|477828_478821_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	32.2	3.6e-40
WP_003668197.1|478822_479113_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_113896554.1|479102_479858_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003668200.1|479952_480591_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003666855.1|480634_480862_-	YneF family protein	NA	NA	NA	NA	NA
WP_003674333.1|480935_481187_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003666853.1|481315_481942_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	5.6e-15
WP_191981125.1|482029_482743_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.8	5.5e-27
WP_113896302.1|482628_483591_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.2e-22
WP_113896555.1|483660_484818_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_113896556.1|484843_485512_-	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	34.3	1.6e-31
WP_113896356.1|485992_487321_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	4.3e-49
WP_113896557.1|487377_487992_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003666848.1|488102_488621_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	1.7e-30
WP_113896558.1|488637_490965_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	2.3e-74
WP_029507544.1|491098_491932_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003666845.1|491948_492878_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_113896559.1|492910_494227_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_113896560.1|494291_496103_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_162859759.1|496246_496384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896561.1|496467_497850_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	1.8e-29
WP_003674350.1|498336_498636_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	49.0	5.0e-22
WP_003668240.1|498637_499228_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003666838.1|499245_500496_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	2.3e-137
>prophage 5
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	575133	643819	2259968	tRNA,transposase	Burkholderia_virus(16.67%)	59	NA	NA
WP_113896606.1|575133_575643_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_113896607.1|575814_576672_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_113896608.1|576786_577815_+	lactonase family protein	NA	NA	NA	NA	NA
WP_191981150.1|578067_578340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663607.1|579213_580182_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113896610.1|581496_581853_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003667696.1|581842_582031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896611.1|587693_588599_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003666883.1|588598_589411_-	NAD kinase	NA	NA	NA	NA	NA
WP_019251188.1|589414_590068_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_113896612.1|590232_590871_+	DsbA family protein	NA	NA	NA	NA	NA
WP_113896613.1|590913_592290_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_113896614.1|592291_593326_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_113896615.1|593409_594081_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003666877.1|594205_594607_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003666876.1|594854_595346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035162055.1|597164_597764_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113896496.1|597700_598606_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_113896616.1|598681_600013_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	1.6e-48
WP_113896617.1|607643_608291_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_113896618.1|608258_608912_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_113896619.1|608895_609666_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_113896620.1|609674_610211_-	YutD family protein	NA	NA	NA	NA	NA
WP_113896621.1|610231_610840_-	metallophosphoesterase	NA	A0A076G7D9	Bacillus_phage	37.7	4.5e-30
WP_035162055.1|611085_611685_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113896496.1|611621_612527_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_113896622.1|612613_613810_-	acetate kinase	NA	NA	NA	NA	NA
WP_113896623.1|613823_614657_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_113896624.1|615071_615503_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_113896625.1|615499_615790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896626.1|615776_616211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667658.1|616207_616519_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_113896627.1|616518_617589_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_113896628.1|617506_618484_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_019252894.1|618603_619350_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_113896629.1|619424_620270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896630.1|620283_621294_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_162859760.1|621454_622555_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_113896632.1|622699_624361_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	1.9e-99
WP_113896633.1|624389_624848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896634.1|624840_625281_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_113896635.1|625423_626299_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_113896636.1|626288_627125_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_113896637.1|627230_627674_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_029507422.1|627688_628213_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_113896638.1|628216_628807_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.4	3.6e-08
WP_113896639.1|628808_629612_-	glutamate racemase	NA	NA	NA	NA	NA
WP_080707427.1|629739_630321_+	YslB family protein	NA	NA	NA	NA	NA
WP_113896640.1|630414_631797_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	3.0e-29
WP_003666692.1|632285_632600_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.4	6.2e-15
WP_113896641.1|632690_635066_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	45.2	6.6e-16
WP_003666690.1|635067_635604_-	CvpA family protein	NA	NA	NA	NA	NA
WP_003666689.1|635698_635995_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003666687.1|636004_636448_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003666685.1|636444_636711_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_113896642.1|636983_639638_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.5	6.5e-65
WP_113896643.1|639897_641271_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.4	1.6e-51
WP_113896644.1|641284_642244_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_113896645.1|642487_643819_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.6e-49
>prophage 6
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	766843	820593	2259968	tRNA,protease,transposase	Paenibacillus_phage(16.67%)	45	NA	NA
WP_113896708.1|766843_767425_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_113896709.1|767508_768411_+	EamA family transporter	NA	NA	NA	NA	NA
WP_191981136.1|768520_769234_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	6.5e-28
WP_172395775.1|769158_770082_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
WP_113896710.1|770142_771075_-	carbamate kinase	NA	NA	NA	NA	NA
WP_003670402.1|771091_772099_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_019251320.1|772351_773191_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_113896711.1|773303_774812_-	xylulokinase	NA	NA	NA	NA	NA
WP_086120626.1|774945_776295_-	xylose isomerase	NA	NA	NA	NA	NA
WP_113896712.1|776514_778809_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_113896713.1|778829_780236_-	MFS transporter	NA	NA	NA	NA	NA
WP_113896714.1|780410_781574_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_113896715.1|781688_783728_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_191981146.1|783747_785247_-	MFS transporter	NA	NA	NA	NA	NA
WP_113896716.1|785396_786311_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_113896717.1|786596_787994_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_094504059.1|788093_788393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019252520.1|788454_789636_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_113896718.1|790021_791380_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_113896719.1|791560_792175_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_056968813.1|792221_793883_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.0	9.7e-99
WP_102816611.1|794053_794914_-	sugar transporter	NA	NA	NA	NA	NA
WP_113896720.1|795081_796569_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.9	6.7e-35
WP_003670412.1|796568_797288_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	4.7e-34
WP_035155145.1|797897_798509_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	54.1	6.6e-29
WP_013923961.1|798831_799638_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_042746466.1|800108_801974_-	acetyltransferase	NA	C6ZR20	Salmonella_phage	28.1	5.7e-23
WP_019253915.1|802035_802347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065532676.1|802607_804428_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.5	1.4e-90
WP_113896344.1|804696_805983_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_065532675.1|806157_807513_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003667494.1|808423_809287_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_113896721.1|809434_810790_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003666460.1|810809_811205_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003666459.1|811216_812140_-	ribokinase	NA	NA	NA	NA	NA
WP_003676233.1|812472_813369_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_078009114.1|813493_814033_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	26.4	3.7e-07
WP_019253908.1|814044_814467_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_113896722.1|814498_815008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003667485.1|815007_815466_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003666452.1|815749_816724_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_102816875.1|816784_817474_-	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	49.2	2.2e-41
WP_003667483.1|817624_818209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896723.1|818335_819691_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	4.4e-49
WP_113896496.1|819687_820593_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
>prophage 7
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	899761	908698	2259968		Streptococcus_phage(66.67%)	11	NA	NA
WP_020843070.1|899761_901144_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	3.6e-30
WP_113896763.1|901645_902407_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_113896764.1|902416_903283_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	54.3	2.1e-76
WP_113896765.1|903291_903642_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	28.0	5.0e-05
WP_113896766.1|903652_904666_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	8.7e-34
WP_003666336.1|904680_905004_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_113896767.1|905023_905665_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.7	1.7e-56
WP_019253644.1|905674_905923_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003666331.1|905927_906530_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003667377.1|906533_906854_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_113896768.1|906862_908698_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	1.0e-56
>prophage 8
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	1181669	1283649	2259968	tRNA,protease,transposase	Lactobacillus_phage(14.29%)	55	NA	NA
WP_113897003.1|1181669_1182977_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	1.0e-95
WP_113897005.1|1184627_1198820_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003663607.1|1207915_1208884_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086878860.1|1209062_1209989_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_113897008.1|1209991_1211242_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	44.9	8.4e-39
WP_003665363.1|1211241_1211814_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	46.2	2.2e-42
WP_113897009.1|1212071_1213478_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.4	1.3e-80
WP_113897010.1|1213611_1214622_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_113897011.1|1214782_1216156_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_113897012.1|1216535_1217624_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_113897013.1|1217616_1220787_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_113897014.1|1220865_1222251_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_113897015.1|1222268_1223951_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_113897016.1|1224133_1226077_-	fibrinogen-binding adhesin SdrG C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_113897017.1|1226188_1227691_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_113897018.1|1227692_1229234_-	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_003665350.1|1229372_1229777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109884254.1|1229842_1230484_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003663607.1|1230609_1231578_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897019.1|1232274_1232661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897020.1|1232755_1233292_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_113897021.1|1233464_1234244_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_113897022.1|1234353_1235652_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.4	3.3e-70
WP_113897023.1|1235847_1236822_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	66.9	2.3e-132
WP_113897024.1|1236881_1238231_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_113897025.1|1238499_1238997_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_113897026.1|1239049_1240804_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	NA	NA	NA	NA
WP_066035753.1|1240942_1241809_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.8	1.3e-57
WP_065533524.1|1241926_1242655_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_113897027.1|1242786_1244127_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_113897028.1|1244278_1245460_-	chloride channel protein	NA	NA	NA	NA	NA
WP_113897029.1|1245462_1246728_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_113897030.1|1246721_1247387_-	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	25.2	1.0e-06
WP_003669576.1|1247388_1248009_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_019253731.1|1248096_1248582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669573.1|1248658_1249321_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_113897031.1|1249339_1251592_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_035154886.1|1251680_1253030_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_113897032.1|1253341_1254520_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_042746418.1|1254583_1255519_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_113897033.1|1255519_1259698_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	23.8	1.2e-17
WP_113897034.1|1259697_1263480_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_113896632.1|1263593_1265255_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	1.9e-99
WP_113897035.1|1265417_1266881_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_113897036.1|1266978_1267605_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113897037.1|1267688_1270607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897038.1|1271418_1272573_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_113897039.1|1272636_1273965_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	1.6e-48
WP_113897040.1|1274090_1276328_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.8	7.1e-121
WP_003670244.1|1276445_1276667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897041.1|1277171_1278359_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_113897593.1|1278360_1279356_+	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.5	1.4e-33
WP_113897042.1|1279423_1279852_+	OsmC family protein	NA	NA	NA	NA	NA
WP_113897044.1|1280347_1282498_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.4	2.5e-46
WP_113897045.1|1282680_1283649_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	1316579	1381880	2259968	tRNA,transposase	Bacillus_virus(15.79%)	57	NA	NA
WP_113896496.1|1316579_1317485_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_035162055.1|1317421_1318021_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_191981141.1|1318468_1319353_-	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_065533488.1|1319529_1319856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065533487.1|1319868_1321071_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	31.3	5.4e-43
WP_003665244.1|1321192_1322584_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.5	4.0e-122
WP_003665243.1|1322617_1323070_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_113897063.1|1323075_1325094_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003665240.1|1325310_1325547_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_065533485.1|1325580_1326144_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	51.9	1.3e-42
WP_003665235.1|1326181_1326478_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_113897064.1|1326680_1329185_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.1	1.1e-114
WP_003669489.1|1329227_1331177_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	2.0e-140
WP_003665231.1|1331173_1332298_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003665230.1|1332306_1332528_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_113897065.1|1332776_1333919_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	31.2	1.1e-13
WP_003665228.1|1334094_1335417_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003665227.1|1335912_1336047_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003665224.1|1336185_1336539_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004562481.1|1336542_1337376_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_113897067.1|1337471_1338239_+	Jag N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_113897068.1|1338395_1339784_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_113897069.1|1339795_1341739_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_113897070.1|1341937_1343857_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	28.9	5.7e-18
WP_113897071.1|1343994_1345545_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_113897072.1|1345562_1346807_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_113896632.1|1347450_1349112_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	1.9e-99
WP_003665211.1|1350440_1351046_+	signal peptidase I	NA	NA	NA	NA	NA
WP_113897073.1|1351578_1352442_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	29.4	7.1e-29
WP_113897074.1|1352540_1353125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896640.1|1355926_1357309_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	3.0e-29
WP_113897075.1|1358091_1358967_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035156241.1|1359155_1359989_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	3.9e-16
WP_113897076.1|1359981_1360701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_052040472.1|1360697_1360913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897077.1|1361247_1361520_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_113896496.1|1361600_1362506_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_035162055.1|1362442_1363042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113897078.1|1363275_1363929_+	glucose-6-phosphate 1-dehydrogenase family protein	NA	NA	NA	NA	NA
WP_162859769.1|1363975_1364122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191981139.1|1364870_1365548_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.1	1.2e-20
WP_113896632.1|1365785_1367447_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	1.9e-99
WP_003665189.1|1367481_1368018_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	25.5	1.3e-07
WP_113897079.1|1368232_1369252_+	serine hydrolase	NA	NA	NA	NA	NA
WP_113897080.1|1369321_1369732_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	49.6	4.6e-26
WP_113897081.1|1370092_1370587_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_113897082.1|1370800_1371091_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_113897083.1|1371080_1371407_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_113897084.1|1371593_1372016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897085.1|1371990_1372761_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_113897086.1|1372773_1373763_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_113897087.1|1374393_1374879_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_113897088.1|1375939_1376617_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_003669430.1|1376718_1377648_-	AEC family transporter	NA	NA	NA	NA	NA
WP_113897089.1|1378079_1379048_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897090.1|1379682_1381014_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	28.8	2.0e-22
WP_113897091.1|1381430_1381880_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.8	2.2e-34
>prophage 10
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	1402240	1472805	2259968	tRNA,transposase	Staphylococcus_virus(10.53%)	60	NA	NA
WP_029507411.1|1402240_1403539_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.7	2.1e-56
WP_003665121.1|1403558_1404569_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.1	7.2e-65
WP_191981138.1|1404945_1405506_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_113897105.1|1405739_1408271_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.4	2.6e-63
WP_113897106.1|1408416_1409058_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_113897107.1|1409262_1410585_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.5	2.9e-66
WP_162859771.1|1411088_1411241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896493.1|1411237_1412899_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_113897108.1|1413067_1414282_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	5.9e-29
WP_113897109.1|1414454_1415630_+	MFS transporter	NA	NA	NA	NA	NA
WP_113897110.1|1415641_1416955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669387.1|1416947_1417400_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113897111.1|1417464_1418067_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_113897596.1|1418164_1418476_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113897112.1|1418604_1419261_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_113897113.1|1419438_1419876_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113897114.1|1420004_1420238_+	cytochrome B5	NA	NA	NA	NA	NA
WP_172395775.1|1420295_1421219_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
WP_191981136.1|1421143_1421857_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	6.5e-28
WP_003665104.1|1422055_1422274_+	cytochrome b5	NA	NA	NA	NA	NA
WP_113897115.1|1422286_1422550_+	cytochrome B5	NA	NA	NA	NA	NA
WP_113897116.1|1424616_1425573_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_113897117.1|1425638_1427033_-	amino acid permease	NA	NA	NA	NA	NA
WP_113897118.1|1427262_1428555_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_113897119.1|1429857_1431741_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.3	2.8e-86
WP_113897120.1|1431991_1432699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191981137.1|1432963_1434604_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003665087.1|1435126_1436137_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.8	3.1e-07
WP_113897122.1|1436347_1436860_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113897123.1|1436871_1437930_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065533430.1|1437948_1438638_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	8.5e-33
WP_113897124.1|1438734_1440717_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.7	1.4e-32
WP_113897125.1|1440826_1441063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003665080.1|1441166_1441484_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003663607.1|1441665_1442634_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897126.1|1442750_1444460_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	40.9	5.6e-25
WP_113897127.1|1444886_1445831_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	1.2e-16
WP_003665077.1|1445963_1446149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897128.1|1446373_1446994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897129.1|1446995_1448192_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.3	7.5e-53
WP_003670084.1|1448513_1449791_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_113897130.1|1449909_1450404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897131.1|1450507_1451146_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_113897132.1|1451343_1452729_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003665067.1|1453245_1453902_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_113897133.1|1454100_1454682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663607.1|1454795_1455764_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897134.1|1455831_1457043_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_113897135.1|1457110_1457965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_113896496.1|1458029_1458935_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_035162055.1|1458871_1459471_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113897136.1|1459665_1460787_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_113897137.1|1460944_1463074_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.3e-159
WP_113897138.1|1463199_1463463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897139.1|1463603_1464257_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_113897140.1|1464425_1465979_+	YfcC family protein	NA	NA	NA	NA	NA
WP_113897141.1|1466140_1467550_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_113897142.1|1467862_1469191_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.8	2.1e-35
WP_113897143.1|1469557_1470991_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_056968813.1|1471143_1472805_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.0	9.7e-99
>prophage 11
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	1874766	1933868	2259968	tRNA,transposase	Erysipelothrix_phage(12.5%)	46	NA	NA
WP_113897346.1|1874766_1875537_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003672672.1|1875642_1876086_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003668771.1|1876093_1876495_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_035157140.1|1876609_1877383_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_153700582.1|1877490_1878159_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	48.3	5.5e-29
WP_113897347.1|1878176_1878752_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_113897348.1|1878768_1879902_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003664509.1|1880058_1882332_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	43.2	5.5e-137
WP_113897349.1|1882350_1884393_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.9	4.8e-100
WP_113897350.1|1884396_1885512_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_113897351.1|1885663_1885981_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_113897352.1|1885980_1887453_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_113897353.1|1887454_1888879_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_065533224.1|1888890_1889904_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.0	6.0e-19
WP_191981131.1|1889996_1891367_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	53.5	8.1e-136
WP_162859776.1|1892337_1893672_+	site-specific DNA-methyltransferase	NA	I7KLR2	Campylobacter_virus	40.4	6.7e-34
WP_113897355.1|1894286_1896944_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_113897356.1|1897648_1898050_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	52.0	2.5e-29
WP_113897601.1|1898622_1898754_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_113897602.1|1898970_1899156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897357.1|1902864_1903098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897358.1|1903197_1903497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_113897359.1|1904718_1905213_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_113897603.1|1905700_1907083_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	6.1e-30
WP_050780398.1|1907289_1907562_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050780397.1|1907552_1907909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897360.1|1908045_1909902_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.5	7.5e-76
WP_003664466.1|1909964_1910201_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_113897361.1|1910193_1910739_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_113897362.1|1910763_1911438_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_113897363.1|1911443_1912772_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.3	1.2e-48
WP_003663607.1|1913136_1914105_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897364.1|1915234_1918780_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_113897365.1|1918757_1919126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897366.1|1919887_1920739_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	6.6e-27
WP_113897367.1|1921032_1921347_+	multidrug transporter	NA	NA	NA	NA	NA
WP_113897368.1|1921402_1924180_+	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	29.5	3.9e-28
WP_029507439.1|1925008_1925455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897604.1|1925978_1926752_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_113897369.1|1926886_1928068_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.9	1.8e-27
WP_113897370.1|1928293_1929625_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	2.5e-28
WP_035154007.1|1929768_1930251_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	43.8	1.2e-25
WP_003663607.1|1930368_1931337_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897371.1|1931436_1931949_+	hydrophobic protein	NA	NA	NA	NA	NA
WP_113897372.1|1932691_1933132_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_113897373.1|1933418_1933868_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	2.7e-32
>prophage 12
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	2040342	2084383	2259968	tRNA,protease,integrase,transposase	Staphylococcus_virus(25.0%)	49	2072112:2072131	2086427:2086446
WP_056968813.1|2040342_2042004_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.0	9.7e-99
WP_020843194.1|2042178_2043027_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003664225.1|2043159_2043591_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_113897435.1|2043717_2045220_+	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.0	1.9e-32
WP_113897436.1|2045219_2045663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843191.1|2045686_2046211_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003664220.1|2046537_2046705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897437.1|2046716_2047328_-	VanZ family protein	NA	NA	NA	NA	NA
WP_113897438.1|2047419_2048766_+	amino acid permease	NA	NA	NA	NA	NA
WP_003664217.1|2048797_2049253_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_113897439.1|2049376_2050816_+	MFS transporter	NA	NA	NA	NA	NA
WP_113897440.1|2050890_2051430_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003664212.1|2051590_2052778_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	4.7e-148
WP_113897441.1|2053099_2055520_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.7	0.0e+00
WP_113897442.1|2055582_2055846_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_113897443.1|2055960_2057610_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_113897444.1|2057673_2058534_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_113897445.1|2058622_2060026_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_081305735.1|2060051_2060564_+	universal stress protein	NA	NA	NA	NA	NA
WP_113897446.1|2060652_2061696_+	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	32.2	1.5e-09
WP_113897447.1|2061760_2062153_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162816324.1|2062250_2063495_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_113896493.1|2063603_2065265_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_003664204.1|2065460_2066093_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_113897449.1|2066308_2066917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897450.1|2066998_2068015_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_113897451.1|2068071_2068995_+	ribokinase	NA	NA	NA	NA	NA
WP_113897452.1|2069121_2069367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897453.1|2069350_2070028_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003664194.1|2070371_2070650_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_113897454.1|2071146_2071329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162859778.1|2071330_2071507_-	hypothetical protein	NA	NA	NA	NA	NA
2072112:2072131	attL	ATTCATCATCCGGTTTTTAT	NA	NA	NA	NA
WP_113896493.1|2072198_2073860_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_113897455.1|2074261_2074441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897456.1|2076254_2076656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897457.1|2076676_2077078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897458.1|2077098_2078106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897459.1|2078105_2078576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897460.1|2078566_2078851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897461.1|2078843_2079119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065532702.1|2079290_2079605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162859779.1|2079618_2079756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162816323.1|2079799_2080075_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113897463.1|2080092_2080713_-	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	41.4	2.2e-27
WP_113897464.1|2080779_2081136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897465.1|2081148_2081367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897466.1|2081492_2082164_+	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	57.4	2.5e-13
WP_113897467.1|2082800_2083886_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	48.5	6.5e-88
WP_113897468.1|2084026_2084383_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	45.6	1.8e-26
2086427:2086446	attR	ATAAAAACCGGATGATGAAT	NA	NA	NA	NA
>prophage 13
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	2128839	2189541	2259968	tRNA,protease,integrase,transposase	Bacillus_phage(17.65%)	60	2140447:2140462	2194282:2194297
WP_113897496.1|2128839_2129487_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_113897497.1|2129613_2130918_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_113897498.1|2131009_2131723_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_035162055.1|2131945_2132545_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113896496.1|2132481_2133387_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_020843164.1|2133441_2134116_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_113897499.1|2134239_2136906_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.0	9.5e-48
WP_113897500.1|2136920_2137751_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	28.8	1.9e-26
WP_113897501.1|2137754_2138354_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_113897502.1|2138399_2138864_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_113897503.1|2138881_2140237_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_113897504.1|2140257_2141199_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	35.1	1.3e-28
2140447:2140462	attL	AAGCAATTAATTGAAA	NA	NA	NA	NA
WP_003664107.1|2141424_2141937_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.2	1.0e-11
WP_003664106.1|2141959_2142157_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003664105.1|2142201_2142555_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_113897505.1|2142707_2143238_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_019253098.1|2143230_2144358_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_003664099.1|2144381_2144693_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_113897506.1|2144714_2145359_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_102816573.1|2145351_2145966_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003670865.1|2145965_2146322_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_113897507.1|2146321_2147062_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_113897508.1|2147073_2148207_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003664093.1|2148336_2148894_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003664092.1|2148948_2149128_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_113897509.1|2149349_2150036_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	1.0e-30
WP_003668473.1|2150048_2151524_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.1	4.8e-25
WP_113897510.1|2151712_2153206_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_113897511.1|2153178_2154903_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	3.4e-99
WP_113897512.1|2155122_2156502_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_113897513.1|2156580_2156991_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	38.0	3.0e-09
WP_113897514.1|2157054_2158005_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_113897515.1|2158103_2158379_-	acylphosphatase	NA	NA	NA	NA	NA
WP_113897516.1|2158477_2159254_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003664081.1|2159967_2160306_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035156926.1|2160599_2161646_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.5	9.0e-26
WP_113897517.1|2161652_2164070_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_113897518.1|2164255_2164894_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	33.3	3.6e-09
WP_113897519.1|2165005_2165662_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	2.1e-36
WP_003664064.1|2165725_2166202_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_113896667.1|2166348_2167680_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	4.3e-49
WP_113897520.1|2167774_2169412_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.1	1.1e-97
WP_113897521.1|2169645_2170035_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_113897522.1|2170102_2172718_-	YfhO family protein	NA	NA	NA	NA	NA
WP_113897605.1|2172968_2175026_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003664049.1|2175164_2175314_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_035156916.1|2175451_2176006_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_113897523.1|2176009_2176669_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_035156913.1|2176675_2176915_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_003664041.1|2176939_2177911_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003672480.1|2177924_2178344_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_113897524.1|2178933_2180316_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	2.1e-30
WP_003664039.1|2180417_2180594_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_035156911.1|2180708_2181632_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003668435.1|2181801_2183145_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_035156909.1|2183389_2184895_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	31.9	1.3e-09
WP_113897525.1|2185008_2186190_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_113897526.1|2186871_2187723_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063164476.1|2188291_2188696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113897527.1|2188794_2189541_-|integrase	site-specific integrase	integrase	Q37880	Lactobacillus_phage	42.9	3.4e-43
2194282:2194297	attR	AAGCAATTAATTGAAA	NA	NA	NA	NA
>prophage 14
NZ_CP029615	Lactobacillus reuteri strain SKKU-OGDONS-01 chromosome, complete genome	2259968	2195231	2255915	2259968	protease,integrase,transposase	Lactobacillus_phage(31.58%)	75	2227701:2227760	2244589:2246419
WP_113897533.1|2195231_2196482_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.5	1.9e-54
WP_113897534.1|2196678_2196867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164500.1|2196893_2197331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897535.1|2197361_2199374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897536.1|2199455_2199638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897537.1|2199874_2200225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663607.1|2200549_2201518_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897538.1|2201665_2201953_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_113897539.1|2201939_2202209_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_113897540.1|2202331_2202868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162859781.1|2202977_2203985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897542.1|2204057_2205722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113896496.1|2205718_2206624_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_035162055.1|2206560_2207160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113897543.1|2207411_2209136_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	36.6	1.9e-81
WP_086118111.1|2209159_2209456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897544.1|2209557_2209875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663607.1|2210039_2211008_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_113897545.1|2211120_2213541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897546.1|2213701_2214775_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_113897547.1|2214879_2217819_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_113897548.1|2217822_2220534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118391.1|2220657_2221002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897549.1|2220991_2221663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897550.1|2221677_2223606_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_086878936.1|2223605_2223854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118394.1|2223869_2225069_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	46.5	2.4e-27
WP_086878938.1|2225087_2225666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897551.1|2225667_2226309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897552.1|2226318_2226999_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_113897553.1|2227261_2227729_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.1e-18
2227701:2227760	attL	GGGGCTGGGAATTAACTATTATTTTCTAGCTTCTAACTAAGAAAATGCGAACTATGATTT	NA	NA	NA	NA
WP_113896493.1|2227725_2229387_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_113897554.1|2229931_2231206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897555.1|2231265_2231862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162859782.1|2232026_2232224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897556.1|2232282_2233053_+	Fic family protein	NA	NA	NA	NA	NA
WP_113897557.1|2233279_2233807_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_042746122.1|2233809_2234124_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_016496718.1|2234431_2235319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897558.1|2235308_2236337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897559.1|2236366_2236873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897560.1|2236959_2238342_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	3.6e-30
WP_003668419.1|2239448_2240081_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003664009.1|2240292_2240601_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_113897561.1|2240616_2240940_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_019254008.1|2240965_2241247_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_113897562.1|2241336_2242449_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.2	4.5e-52
WP_113897563.1|2242451_2242769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113896493.1|2242961_2244623_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-99
WP_113897564.1|2244664_2245219_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_113897565.1|2245273_2245720_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	35.1	3.2e-09
WP_113897566.1|2245739_2246171_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	43.6	3.6e-21
WP_113897567.1|2246324_2246564_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	41.3	4.4e-05
2244589:2246419	attR	AAATCATAGTTCGCATTTTCTTAGTTAGAAGCTAGAAAATAATAGTTAATTCCCAGCCCCGCTATTTTTTATTAAATTACAAGTTTAATATTTGTTTTTTCTTTTTATCGTATTCTTCTTGAGTAATAGCATTCTCATCAAGTAGCTTTTTTAACTTTGTGATTTCCTCAGTATAACCATAAGAGTTTTCTGTATTATTCTTTGTTTTCATTTGTGGACTATTTGAACTTGCTGATTGATAAGGCATATTTGGGTATCCATTTTTAGACCAAGGAATCGCAACAAGCAACGAGACTATACAAATTATTAAGAGTGTCCAGTGAAAGCCATTGGTAAATTCAGATTGTGGGAACTCAACAAGGCAAAGAGCACCTGAAAAACATGAAAGTGCAATAACAACATAGTCTATCCATTTTTTTGGAAACATATATGAAGTAGAAACTAATATGATTCCTGCAATTAAATTTCCAAAGCCTAATATTGCAAGATCACCACCAAGAGAGGTTAGTTCTCCATAGCCGCTTTGGACACCCATACTTGAATATGTAATACCAAGATAGACGATATAAGCGGCAACTAAAATAAGTGCTATTCCAGCTATTAGCCTTCTTAAAATCAATTCTTTTTTCATCAAAACTCCTCCAATTGGTCAGCTTTTAGTGTCGATCAGTTATTGGACATAGTACTAATTATCAAACTTTGGAATGTACCTTAACAAATCTTCATCGATTCCAAGATAATAAATAAGTTGTGACTTTGTGAGACGCTTTATTTCTTCCAGATCATGCATATCAAGTAATAATTTCATAGCTAATTCATTTGCTTCGTTTTCTATCTTAGGTACAAAACGACCAGCCCCGATACGGCGATAGTATGGTGTGCTTGATCCTCCGTGTAATACCAGATGGCTAAATTCATGCAAAATAACAAAGCCAATATAATGTTCATCCCAGTTAGAATTAATAACAATTGTTGAGCAGCGATTGTTGGTCATCGTAAAACCACCGGTATTATCATCTAATGGAAAAGGAAGCAAATCAATATCTGCTTCTTTTAAGAGGTCTTCTGGAGATATAAGAGTGTATTTACTTTTTATCTTTGCGTAACTTTTTTCTATAAATGAACCACTCATAATACAGTTCACCACCTAATTAATCACGATACTTTTTAGGGGTAAATTTCTTTTTAGCTTTACGTTTGTTCATTTCCATAGCAGTTTGTACGGCAATAAGTAATCTTTCCTTTTGCTCCTCAGTAGCAGGTTCCCCATAGAAATTAAGATTTTCTCCTGACTCAATACCTTCCATTAATTTTTCAGCTTGAAGGGCAATATCATTTTTTTCTTTATTGGATAGTTCATAATAGGCCTCTGTTTTAATTTCACGACCCAGTAAATAATCAACGGAAACATGAAAATAATCAGCTAATTTATTCAACATTTCAGGATTAGGGCTTCTCTTTCCCGTTTCATACATCCCTAAAGTACTTGTGCCGATATTAAGTTCTTTGGCTAATTGTGATTGTGACATACCTCTTTTCTTTCTTAAGTTAGCTATCTTTTCTCCTATATTATTCGTATTCATTGTTTCCGCCTCTTTTTATTACTATTCGTGATAATAATATCACGATGAGTGATTTTATAAAACTAAAAATTTATCACAATTTGTGGTTGACTTATCTCAAAATGTGATTTAGTATAATAGACGTAAATTAATCACATATTGTGATAGGAAGGAGTGGAAGTATTGCCAAATAATACTTTAATTAATTTGAGAAAAAATAAAGGTTTATCTCAAGCTGTTGCTGCTAAGAAGATTGGGATTTCCCAATC	NA	NA	NA	NA
WP_113897568.1|2246560_2247289_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	37.6	1.6e-29
WP_113897569.1|2247313_2247667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897570.1|2247796_2248003_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_113897571.1|2248017_2248266_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113897572.1|2248243_2248429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162816322.1|2248462_2248615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253372.1|2248674_2248896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253371.1|2248897_2249485_+	host-nuclease inhibitor Gam family protein	NA	NA	NA	NA	NA
WP_066035675.1|2249484_2250258_+	ERF family protein	NA	D6PSU1	Lactobacillus_phage	59.9	2.0e-43
WP_019253369.1|2250269_2250932_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	46.2	6.4e-54
WP_113897573.1|2250924_2251299_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	63.3	9.2e-42
WP_066035677.1|2251311_2252118_+	conserved phage C-terminal domain-containing protein	NA	Q8SDH3	Lactococcus_phage	51.5	5.2e-58
WP_113897574.1|2252136_2252940_+	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	45.4	3.3e-52
WP_162859783.1|2252963_2253110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066035678.1|2253099_2253372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135950863.1|2253368_2253818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897575.1|2253817_2254279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897576.1|2254278_2254746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253361.1|2254738_2254993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253360.1|2255005_2255218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113897577.1|2255204_2255399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029507471.1|2255591_2255915_+	MazG-like family protein	NA	A0A2K9VC24	Lactobacillus_phage	50.5	1.1e-19
