The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	393528	403419	4042190		Synechococcus_phage(50.0%)	9	NA	NA
WP_016937017.1|393528_394821_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_053104705.1|394896_395616_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	7.5e-48
WP_003155758.1|395615_395870_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408898.1|395866_396550_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_061046488.1|396533_398762_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	5.5e-158
WP_007609856.1|398737_400168_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_061046489.1|400259_401300_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	2.2e-64
WP_012116999.1|401296_401884_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
WP_007408903.1|401880_403419_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	2.5e-77
>prophage 2
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	846640	927281	4042190	integrase,holin,head,tail,portal,coat,tRNA,terminase	Bacillus_phage(33.33%)	99	891886:891936	935119:935169
WP_039062893.1|846640_847633_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_039062894.1|848376_850011_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003155043.1|850117_851053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|851056_851974_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|851986_853063_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_012117283.1|853055_853973_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_052248589.1|854079_855267_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|855384_855963_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|856141_856537_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_061046903.1|856594_857251_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155032.1|857526_858183_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_007409108.1|858333_859494_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_113629831.1|859721_861551_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_007409106.1|862041_862944_-	DsbA family protein	NA	NA	NA	NA	NA
WP_053104216.1|862940_863339_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_061046902.1|863567_864254_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_061046901.1|864258_864831_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|864955_865321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|865348_865984_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|866001_866802_+	NAD kinase	NA	NA	NA	NA	NA
WP_053104219.1|866816_867710_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
WP_061046900.1|867743_868493_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.8	4.5e-11
WP_061046899.1|868720_870565_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_007409099.1|870814_871522_+	thiaminase II	NA	NA	NA	NA	NA
WP_061046898.1|871499_872117_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_061046897.1|872100_873210_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|873206_873410_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_100001371.1|873406_874177_+	thiazole synthase	NA	NA	NA	NA	NA
WP_061046896.1|874173_875184_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_061046895.1|875206_876019_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|876149_876926_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_007409092.1|877023_877632_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409091.1|877690_878134_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007610670.1|878282_878765_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409089.1|878915_879416_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409088.1|879507_879819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409087.1|879858_880245_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409086.1|880415_880772_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154990.1|881058_881256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610678.1|881348_881510_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|881676_881931_+	sporulation protein	NA	NA	NA	NA	NA
WP_061046894.1|881999_884285_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.8	3.1e-87
WP_061046893.1|884404_884659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046892.1|884727_885477_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_039062912.1|885518_886241_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409079.1|886233_886971_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-27
WP_007409078.1|886971_887205_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012117312.1|887365_887797_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409076.1|887801_888317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409075.1|888342_889065_-	esterase family protein	NA	NA	NA	NA	NA
WP_007409074.1|889433_890555_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	2.5e-18
WP_007409073.1|890547_891723_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
891886:891936	attL	CGCTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCATA	NA	NA	NA	NA
WP_061046891.1|892066_893296_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.5	4.6e-106
WP_061046890.1|893300_893822_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	65.2	1.6e-55
WP_061046889.1|893888_894461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046888.1|894706_895072_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	41.9	2.1e-14
WP_061046887.1|895233_895464_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470596.1|895474_895666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015388430.1|895816_896389_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.1	2.0e-59
WP_061046886.1|896385_896643_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	37.2	1.1e-06
WP_014470593.1|896639_896843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408617.1|896944_897133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046885.1|897129_898047_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.5	1.1e-88
WP_076983708.1|898066_898804_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	1.9e-51
WP_061046883.1|899001_899703_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	34.1	5.8e-05
WP_141228462.1|899587_900535_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	50.7	2.0e-56
WP_061046882.1|900769_901198_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	63.5	9.6e-43
WP_003155894.1|901480_901684_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_015388418.1|901715_902000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046881.1|901996_902257_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.0	7.4e-06
WP_031378527.1|902725_903304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046880.1|903816_904332_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	40.9	6.4e-25
WP_042635075.1|904456_904669_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	51.4	9.6e-12
WP_061046878.1|904987_905941_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_061046877.1|906076_906334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046876.1|906489_907245_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	56.3	6.9e-52
WP_113629795.1|907231_908506_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0K2CP71	Brevibacillus_phage	72.6	1.1e-179
WP_061046875.1|908527_909976_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	48.1	5.4e-122
WP_061046874.1|909962_910880_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	6.5e-81
WP_061046873.1|911040_911706_+	scaffolding protein	NA	I1TLE1	Bacillus_phage	48.0	1.0e-22
WP_061046872.1|911718_912705_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	2.1e-48
WP_076983707.1|912682_912967_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	65.4	3.3e-23
WP_013351227.1|912967_913159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046871.1|913163_913460_+	hypothetical protein	NA	Q4ZBR3	Staphylococcus_phage	39.4	7.4e-10
WP_061046870.1|913456_913795_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_061046869.1|913787_914204_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	4.3e-32
WP_015239630.1|914222_914621_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_053075464.1|914634_915147_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.4	1.5e-26
WP_076983182.1|915088_915403_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	4.6e-26
WP_076983168.1|915416_915659_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_061046868.1|915715_916222_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.9	2.3e-11
WP_061046963.1|916269_916578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113629796.1|916582_921724_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	26.9	3.3e-36
WP_061046867.1|921720_922485_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_061046866.1|922497_925881_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	45.9	1.3e-131
WP_061046865.1|925894_926284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388395.1|926422_926590_+	XkdX family protein	NA	NA	NA	NA	NA
WP_007408578.1|926602_926824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046864.1|926858_927281_+|holin	holin	holin	D6R405	Bacillus_phage	85.7	3.9e-57
935119:935169	attR	CGCTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCATA	NA	NA	NA	NA
>prophage 3
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	980972	1012732	4042190	holin,plate,tail,portal,terminase	Bacillus_phage(32.26%)	42	NA	NA
WP_087920760.1|980972_982109_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|982098_982233_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|982375_983329_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|983366_983744_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_020955680.1|983856_984462_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.8	3.0e-42
WP_032866122.1|984600_985191_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_061046848.1|985339_985678_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.9	2.4e-17
WP_032866121.1|985868_986048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284603.1|986037_986865_+	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_061046847.1|986764_987565_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_007407281.1|987829_988171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407280.1|988160_988364_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_012117362.1|988477_988990_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
WP_007407278.1|989102_989900_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	4.0e-58
WP_032866117.1|989896_991195_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_106080344.1|991243_992629_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	1.1e-137
WP_007407275.1|992654_993500_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_053104250.1|993526_994462_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	63.1	4.3e-104
WP_020955683.1|994478_994862_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_020955684.1|994858_995215_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_020955685.1|995211_995715_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	40.4	1.6e-36
WP_007407270.1|995711_996158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407269.1|996154_996364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407268.1|996363_997761_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	2.0e-81
WP_003154837.1|997762_998206_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|998282_998729_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|998770_998923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113629799.1|998910_1003911_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	4.3e-41
WP_061046846.1|1003903_1004563_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	2.9e-22
WP_061046845.1|1004576_1005554_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.2	8.3e-34
WP_007407264.1|1005553_1005820_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	1.3e-05
WP_020955689.1|1005923_1006349_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
WP_039062947.1|1006341_1007388_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	1.1e-68
WP_039062948.1|1007371_1007950_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
WP_003154822.1|1007946_1008219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046843.1|1008221_1009844_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.7	1.4e-41
WP_039062950.1|1009856_1010228_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_039062951.1|1010232_1010430_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_039062952.1|1010486_1011248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1011299_1011563_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1011576_1011840_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1011853_1012732_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 4
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	1651858	1812778	4042190	integrase,bacteriocin,head,plate,holin,tail,protease,portal,capsid,tRNA,terminase	Bacillus_phage(62.96%)	101	1804966:1804981	1806938:1806953
WP_031379075.1|1651858_1652068_+|bacteriocin	bacteriocin-like WGxF protein	bacteriocin	NA	NA	NA	NA
WP_052248596.1|1652371_1652641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039063171.1|1652931_1654068_-|holin	choline esterase	holin	NA	NA	NA	NA
WP_032865987.1|1654327_1655827_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_007410147.1|1656274_1656586_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	5.9e-10
WP_032871589.1|1656639_1658037_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	2.2e-27
WP_061046744.1|1658039_1658747_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	4.0e-38
WP_020955895.1|1658888_1660160_-	glucuronoxylanase	NA	NA	NA	NA	NA
WP_053104450.1|1660221_1661757_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_061046743.1|1661930_1669790_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.1	2.4e-91
WP_061046742.1|1669873_1685998_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	1.5e-90
WP_061046741.1|1686042_1697991_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.4	2.8e-115
WP_038458191.1|1698010_1699213_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_007410137.1|1699771_1700557_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_014305098.1|1700569_1701232_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_007410135.1|1701249_1701951_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_020954028.1|1701975_1703412_-	GntP family permease	NA	NA	NA	NA	NA
WP_015239958.1|1703717_1704914_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007410132.1|1704915_1705935_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_061046740.1|1705937_1706639_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_061046739.1|1706635_1707796_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.5	1.6e-31
WP_061046738.1|1707785_1709132_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.2	2.9e-13
WP_047935774.1|1709128_1709899_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_014418060.1|1710166_1710574_+	GtrA family protein	NA	NA	NA	NA	NA
WP_061046737.1|1710580_1711480_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.9	4.0e-83
WP_061046736.1|1711547_1712138_+	DedA family protein	NA	NA	NA	NA	NA
WP_007410124.1|1712192_1713722_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_042635250.1|1713739_1714519_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_007410122.1|1714532_1715432_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_007410121.1|1715447_1715660_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_032865960.1|1715656_1717006_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_042635251.1|1717027_1718668_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.4	1.4e-46
WP_007410118.1|1718712_1719855_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_007410117.1|1719995_1721534_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_007410116.1|1721655_1722036_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_061046735.1|1722109_1725913_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.6	1.8e-84
WP_113629804.1|1725931_1736707_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.7	1.3e-159
WP_061046733.1|1736732_1744382_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.0	2.2e-73
WP_039063201.1|1744397_1752095_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.7	5.9e-159
WP_113629805.1|1752120_1759779_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	23.5	1.9e-80
WP_061046732.1|1760258_1761734_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_053104033.1|1761752_1762721_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_042635256.1|1762837_1764226_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_061046731.1|1764454_1764997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046730.1|1765339_1767166_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	41.5	1.3e-104
WP_061046729.1|1767181_1767622_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_061046728.1|1767814_1768540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046727.1|1768579_1769593_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	2.4e-185
WP_015239640.1|1769640_1770063_-|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_013353491.1|1770112_1770301_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_061046726.1|1770297_1770660_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
WP_094031763.1|1770656_1771934_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.1	1.1e-153
WP_061046725.1|1771950_1774512_-	peptidase G2	NA	D6R401	Bacillus_phage	94.4	0.0e+00
WP_061046724.1|1774551_1776255_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	98.8	4.0e-310
WP_061046723.1|1776266_1777106_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	98.6	1.3e-160
WP_061046722.1|1777105_1780981_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.4	0.0e+00
WP_061046721.1|1781181_1781520_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	91.1	2.3e-52
WP_061046720.1|1781575_1782184_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	91.5	2.0e-102
WP_081093610.1|1782184_1782673_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	97.5	4.4e-84
WP_015968221.1|1782561_1782945_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	100.0	3.8e-67
WP_061046718.1|1782937_1783297_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	99.2	3.2e-60
WP_024085414.1|1783229_1783577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	93.0	5.2e-55
WP_094031764.1|1783591_1784182_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	84.7	8.6e-34
WP_094031765.1|1784208_1784520_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	78.0	2.9e-33
WP_032858696.1|1784532_1785735_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	72.8	6.0e-159
WP_061046716.1|1785774_1786401_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	96.6	2.7e-110
WP_061046715.1|1786390_1787641_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.6	3.5e-242
WP_032858702.1|1787646_1787877_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	81.7	7.2e-21
WP_032858704.1|1787888_1789598_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	97.2	0.0e+00
WP_015968210.1|1789597_1790104_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	100.0	8.8e-88
WP_061046714.1|1790190_1790517_-	hypothetical protein	NA	Q9T203	Bacillus_phage	97.2	7.0e-54
WP_061046713.1|1790485_1790860_-	HNH endonuclease	NA	Q38456	Bacillus_phage	95.2	3.0e-69
WP_022553324.1|1790994_1791624_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_061046712.1|1791737_1792403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458303.1|1792938_1793481_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_061046711.1|1793477_1793930_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	1.7e-37
WP_048367324.1|1793948_1794164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046710.1|1794262_1795477_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_061046709.1|1795754_1796189_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.8	5.3e-49
WP_017417491.1|1796297_1796648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046708.1|1796791_1797616_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
WP_061046707.1|1797619_1797880_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.7	7.4e-06
WP_061046706.1|1797876_1798212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046705.1|1798244_1798448_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	9.8e-14
WP_113629806.1|1798695_1798836_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_061046704.1|1798941_1799490_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	34.9	7.8e-05
WP_024085441.1|1799641_1799791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046959.1|1799805_1800639_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	2.7e-33
WP_094031766.1|1800622_1801495_-	replication protein	NA	V9QKF6	Oenococcus_phage	41.7	1.3e-49
WP_061046703.1|1801487_1801706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305165.1|1801723_1802047_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	40.7	4.6e-13
WP_061046702.1|1802113_1802317_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|1802481_1802880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061046701.1|1803311_1804412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046700.1|1804654_1805761_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.3	4.6e-113
1804966:1804981	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
WP_007407359.1|1806034_1806580_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	5.5e-43
WP_003153848.1|1806895_1807126_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
1806938:1806953	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
WP_007407357.1|1807369_1809145_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_007407356.1|1809191_1810367_-	MFS transporter	NA	NA	NA	NA	NA
WP_007407355.1|1810509_1810812_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020954032.1|1810858_1812778_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.8	1.4e-138
>prophage 5
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	2044816	2051070	4042190		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2044816_2045410_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2045399_2046155_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|2046362_2046452_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_020956020.1|2046540_2047062_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2047127_2047502_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2047618_2048083_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_047935905.1|2048115_2049312_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.8e-116
WP_047935906.1|2049326_2049974_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_061046646.1|2049954_2051070_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	9.8e-55
>prophage 6
NZ_CP030097	Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome	4042190	3376475	3421592	4042190	coat,protease	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
WP_003151043.1|3376475_3377135_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3377240_3377429_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_020957978.1|3377466_3377886_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032865071.1|3378271_3379651_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|3379716_3380217_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007407654.1|3380256_3381558_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3381716_3381941_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_007407656.1|3382143_3382917_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_079891039.1|3383216_3383492_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020957980.1|3383492_3384047_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_020957981.1|3384144_3385065_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
WP_025285429.1|3385061_3386015_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020957983.1|3386004_3386841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020957984.1|3386831_3387629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407663.1|3387597_3388521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3388569_3388749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407665.1|3388900_3389764_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3389810_3390710_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_061047013.1|3390825_3391803_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_007407668.1|3391840_3392812_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3393074_3393839_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_007407669.1|3393958_3394738_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032869430.1|3394754_3395954_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3395966_3397148_-	MFS transporter	NA	NA	NA	NA	NA
WP_020957989.1|3397144_3398563_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_020957990.1|3398580_3399342_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.7e-21
WP_032869426.1|3399338_3400049_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015418458.1|3400038_3400653_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_061047012.1|3400814_3402053_-	MFS transporter	NA	NA	NA	NA	NA
WP_061047011.1|3402275_3403478_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.9e-27
WP_061047010.1|3403510_3404929_-	amino acid permease	NA	NA	NA	NA	NA
WP_007407678.1|3404953_3406636_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_061047009.1|3406707_3408255_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025285442.1|3408462_3409749_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_022537147.1|3409937_3410399_-	member of the processed secretome	NA	NA	NA	NA	NA
WP_007407682.1|3410614_3411070_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007407683.1|3411066_3411915_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
WP_007407684.1|3411935_3412883_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_003150981.1|3412885_3413623_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_061047008.1|3413650_3414655_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_113629821.1|3414656_3415400_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_061047006.1|3415389_3416511_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007407690.1|3416510_3417374_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007407691.1|3417374_3418544_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_007407692.1|3418566_3419991_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015240806.1|3419995_3420766_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_007614539.1|3421046_3421592_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 1
NZ_CP030098	Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence	61634	1042	43033	61634	terminase,tail,portal,holin	Bacillus_phage(65.79%)	62	NA	NA
WP_113629842.1|1042_1345_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	56.2	1.4e-16
WP_162782346.1|1344_1509_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	70.4	7.9e-14
WP_113629843.1|1609_1849_+	hypothetical protein	NA	A0A2H4JBR7	uncultured_Caudovirales_phage	62.7	8.6e-17
WP_113629844.1|2204_2489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113629845.1|2476_2773_+	hypothetical protein	NA	A0A2P1JTW1	Anoxybacillus_phage	45.5	5.3e-16
WP_113629847.1|3061_3346_+	hypothetical protein	NA	A0A288WG88	Bacillus_phage	38.6	4.7e-06
WP_162782347.1|3315_3540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162782348.1|6163_6898_+	hypothetical protein	NA	U5PU90	Bacillus_phage	42.3	9.0e-41
WP_048367533.1|6884_7142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367534.1|7211_7634_+|holin	holin family protein	holin	D6R405	Bacillus_phage	78.6	4.2e-51
WP_061046992.1|9019_9829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079979775.1|10295_11135_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	57.7	1.9e-74
WP_048367544.1|11205_11439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071182137.1|11769_12642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046991.1|12718_12898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145925697.1|12983_13859_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	42.5	3.2e-53
WP_071182136.1|13848_14163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367548.1|14406_14622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013412.1|14645_15041_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	37.3	2.3e-11
WP_061046990.1|15270_15510_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048367550.1|15542_15734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367554.1|16358_16958_+	hypothetical protein	NA	D7RWM7	Brochothrix_phage	37.4	1.3e-24
WP_048367555.1|16961_17624_+	single-stranded DNA-binding protein	NA	A0A1J0MF78	Staphylococcus_phage	36.8	7.6e-31
WP_048367559.1|17862_18081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367563.1|18406_18943_+	hypothetical protein	NA	Q0H273	Geobacillus_phage	53.4	6.2e-39
WP_048367565.1|18936_19386_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	71.3	1.4e-52
WP_155641729.1|19567_19741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367567.1|20019_20355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367569.1|20354_20660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079979778.1|20656_20968_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	1.5e-16
WP_048367575.1|21456_21642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367577.1|21638_22043_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	40.5	2.6e-18
WP_048367579.1|22088_22307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046988.1|22312_22753_+	hypothetical protein	NA	M1HNE7	Bacillus_virus	51.4	7.6e-27
WP_053075460.1|22767_23220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046987.1|23216_23429_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	52.9	8.7e-13
WP_061046986.1|23452_23908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046985.1|24175_24520_+	hypothetical protein	NA	Q38579	Bacillus_phage	59.6	1.3e-29
WP_061046984.1|24884_25397_+	hypothetical protein	NA	A0A0A7AQW8	Bacillus_phage	35.8	2.3e-14
WP_061046983.1|25589_26237_+|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	38.6	3.6e-17
WP_061046982.1|26217_27495_+|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	70.8	1.6e-181
WP_061046981.1|27507_29019_+|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	54.3	3.5e-140
WP_071182140.1|29018_30134_+	hypothetical protein	NA	A0A1B1P858	Bacillus_phage	43.4	3.9e-80
WP_155641728.1|30148_30289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046980.1|30367_31006_+	hypothetical protein	NA	B3GW02	Streptococcus_phage	43.2	1.6e-17
WP_061046979.1|31019_31922_+	hypothetical protein	NA	A0A1B1P885	Bacillus_phage	61.0	5.1e-102
WP_071182139.1|31854_32178_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	72.6	9.5e-27
WP_061046978.1|32190_32454_+	hypothetical protein	NA	A0A1B1P891	Bacillus_phage	54.7	1.7e-10
WP_061046977.1|32469_32871_+	hypothetical protein	NA	A0A1B1P889	Bacillus_phage	41.8	4.1e-19
WP_061046976.1|32863_33202_+	hypothetical protein	NA	I1TLE5	Bacillus_phage	39.8	1.8e-15
WP_048367517.1|33198_33546_+	hypothetical protein	NA	B5LPR8	Bacillus_virus	47.0	8.6e-26
WP_061046975.1|33555_33945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046974.1|33957_34419_+	hypothetical protein	NA	I1TLE8	Bacillus_phage	39.0	6.1e-19
WP_076983588.1|34378_34675_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	61.7	7.1e-21
WP_061046973.1|34883_35171_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_061046972.1|35228_35618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061046971.1|35625_36270_+	hypothetical protein	NA	A0A1B1P868	Bacillus_phage	41.4	2.0e-23
WP_061046970.1|36271_38920_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	58.8	3.2e-104
WP_071182138.1|38916_39642_+|tail	phage tail family protein	tail	A0A1B1P894	Bacillus_phage	37.9	1.7e-28
WP_061046993.1|39657_42297_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	45.8	2.9e-113
WP_048367533.1|42283_42541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367534.1|42610_43033_+|holin	holin family protein	holin	D6R405	Bacillus_phage	78.6	4.2e-51
