The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	565198	575167	4702913	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_080560569.1|565198_567064_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_113068962.1|567277_569065_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	1.5e-73
WP_010675618.1|569154_569598_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
WP_005309452.1|569613_569829_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010675619.1|570008_571022_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.6e-107
WP_010675620.1|571095_572079_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	3.8e-34
WP_010675621.1|572125_573196_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	34.9	1.7e-11
WP_162726112.1|573205_573787_-	DedA family protein	NA	NA	NA	NA	NA
WP_010675623.1|573783_574401_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.4	5.3e-34
WP_113068963.1|574405_575167_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	1.2e-67
>prophage 2
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	872969	911483	4702913	protease,integrase,transposase	uncultured_Caudovirales_phage(20.0%)	24	900533:900548	917156:917171
WP_010672690.1|872969_874313_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_010672689.1|874427_874952_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_113069091.1|875038_878122_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_010672687.1|878335_878653_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_113069092.1|884675_885872_+	NnrS family protein	NA	NA	NA	NA	NA
WP_042015843.1|885872_886445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113070590.1|886519_887710_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_113069093.1|887857_888922_+	DUF3103 family protein	NA	NA	NA	NA	NA
WP_010674220.1|888985_889882_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_113069094.1|890209_891001_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113069095.1|891061_892525_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_113069096.1|892533_894513_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	4.0e-19
WP_042078678.1|894710_895322_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_102983679.1|895868_898697_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
WP_162726122.1|898790_899429_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010674212.1|899947_900517_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	60.1	6.5e-55
900533:900548	attL	AAAGTGTAAGAATAAA	NA	NA	NA	NA
WP_082189281.1|900648_902007_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_113069098.1|901999_903343_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041205622.1|903370_904513_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_113069099.1|904847_906725_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_021140823.1|906712_907192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140822.1|907191_907629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069785361.1|907625_909788_+	AAA family ATPase	NA	A0A2I2L5Q3	Orpheovirus	25.9	1.1e-20
WP_102948393.1|910279_911483_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
917156:917171	attR	AAAGTGTAAGAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	1302670	1331907	4702913	tRNA,integrase,transposase	Escherichia_phage(37.5%)	27	1323705:1323764	1331953:1332057
WP_113069303.1|1302670_1304560_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_039040628.1|1305068_1305518_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_113069305.1|1305889_1307998_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_113069307.1|1308058_1309705_+	multidrug ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
WP_113069309.1|1309751_1310516_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	5.0e-10
WP_113070596.1|1310547_1311450_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_113069311.1|1311446_1313429_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_047437768.1|1313848_1315168_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_017410478.1|1315167_1315422_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102948393.1|1315864_1317068_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
WP_000845039.1|1317455_1318469_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|1318613_1319111_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|1319222_1319513_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|1319518_1320310_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|1320473_1320821_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1320814_1321654_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|1321781_1321985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|1322140_1323346_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|1323356_1323662_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1323705:1323764	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001389365.1|1323888_1324653_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|1325145_1325730_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|1325729_1326968_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|1326964_1327870_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|1327991_1328696_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000018329.1|1328846_1329662_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|1329851_1330556_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000935452.1|1330602_1331907_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1331953:1332057	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATATTGAACCAATAATTAGGAACCACTTTAAACAGACCGATGGGGG	NA	NA	NA	NA
>prophage 4
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	2257446	2291818	4702913	portal,head,holin,capsid,tail,terminase,integrase	Vibrio_phage(24.14%)	47	2256853:2256868	2263144:2263159
2256853:2256868	attL	GGTTCGTCCAGCAGCA	NA	NA	NA	NA
WP_113069701.1|2257446_2258754_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	40.4	2.3e-79
WP_033130544.1|2258729_2258939_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_113069702.1|2259005_2259479_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	61.5	7.6e-49
WP_042016726.1|2259478_2259736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102948876.1|2259791_2259986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113069703.1|2259961_2260399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113069704.1|2260395_2262123_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	42.6	1.8e-140
WP_113069705.1|2263902_2264106_-	hypothetical protein	NA	NA	NA	NA	NA
2263144:2263159	attR	GGTTCGTCCAGCAGCA	NA	NA	NA	NA
WP_080768057.1|2265924_2266617_-	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.2	8.5e-25
WP_113069706.1|2266724_2266943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069707.1|2266962_2267472_+	transcriptional regulator	NA	Q6JIG6	Burkholderia_virus	35.0	1.0e-11
WP_162726151.1|2267811_2268897_+	hypothetical protein	NA	K7P6V7	Enterobacteria_phage	55.7	3.1e-29
WP_162726227.1|2268934_2269363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069709.1|2269362_2269623_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	52.5	7.4e-14
WP_113069710.1|2269619_2270348_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	65.4	3.6e-90
WP_113070618.1|2270347_2270575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069711.1|2270571_2270781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069712.1|2270773_2271079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069713.1|2271068_2271458_+	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.3	1.0e-19
WP_113069714.1|2271561_2272371_+	hypothetical protein	NA	U5P4K5	Shigella_phage	35.6	1.3e-29
WP_113069715.1|2272472_2272697_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	53.4	1.7e-14
WP_113069716.1|2272826_2273090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103244329.1|2273086_2274076_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	30.2	1.7e-34
WP_080768062.1|2274195_2274441_+	hypothetical protein	NA	A0A067ZIN8	Vibrio_phage	58.2	1.4e-19
WP_113069717.1|2274440_2275070_+	antitermination protein	NA	NA	NA	NA	NA
WP_113069718.1|2275779_2275992_+	hypothetical protein	NA	A0A2D0YLN6	Vibrio_phage	55.2	1.4e-15
WP_042648559.1|2276736_2277018_+	hypothetical protein	NA	M9Q2L4	Clostridium_phage	45.5	3.8e-08
WP_113069719.1|2277066_2278341_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.5	4.2e-126
WP_113069720.1|2278343_2278760_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.1	2.5e-32
WP_113069721.1|2278923_2279553_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	43.6	2.3e-45
WP_162726152.1|2280192_2280753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162726153.1|2280785_2281139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069722.1|2281141_2281567_+	preprotein translocase subunit SecB	NA	NA	NA	NA	NA
WP_113069724.1|2282035_2282401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042649263.1|2282565_2282889_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	52.5	1.3e-20
WP_103244337.1|2282875_2283394_+	lysozyme	NA	V5YSX1	Pseudomonas_phage	77.2	1.3e-70
WP_103244338.1|2283390_2283933_+	DUF2514 domain-containing protein	NA	A0A2D1GNE2	Pseudomonas_phage	52.5	9.4e-11
WP_103244339.1|2284019_2284400_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	58.1	8.0e-33
WP_113069725.1|2284495_2284981_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	59.0	5.6e-47
WP_113069726.1|2284990_2286712_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	74.5	7.1e-262
WP_113069727.1|2286705_2286894_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	61.5	7.7e-05
WP_113069728.1|2286893_2288147_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	65.4	7.4e-160
WP_113069729.1|2288134_2289070_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	51.1	1.3e-79
WP_162726154.1|2289229_2289835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113069730.1|2289974_2291264_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.7	3.8e-143
WP_154676067.1|2291330_2291504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042016765.1|2291506_2291818_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	40.4	4.1e-11
>prophage 5
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	2929029	2936426	4702913		Escherichia_phage(50.0%)	7	NA	NA
WP_161646571.1|2929029_2929704_-	response regulator	NA	W8CYM9	Bacillus_phage	34.6	4.7e-28
WP_113069997.1|2930640_2931726_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	9.1e-98
WP_113069998.1|2931725_2932613_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	2.6e-26
WP_113069999.1|2932725_2933604_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	8.1e-105
WP_113070000.1|2933665_2934211_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.6	1.1e-51
WP_113070001.1|2934301_2935120_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_113070002.1|2935109_2936426_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	9.9e-14
>prophage 6
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	2953316	3012648	4702913	transposase	Helicobacter_phage(33.33%)	54	NA	NA
WP_113070013.1|2953316_2954357_+|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	1.7e-72
WP_162726174.1|2954523_2955492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070015.1|2955488_2956535_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_113070016.1|2956524_2957445_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_113070017.1|2957434_2958196_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_113070018.1|2958268_2959318_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_162517492.1|2959615_2960737_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_113070020.1|2960976_2961405_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_113070021.1|2961460_2963638_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_162726175.1|2963788_2964067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162726176.1|2964218_2964809_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_162726177.1|2964856_2965561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162726178.1|2965557_2967642_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_113070023.1|2967728_2969447_+	ligase	NA	NA	NA	NA	NA
WP_039040218.1|2969710_2970364_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_113070024.1|2974499_2975393_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_113070025.1|2975923_2976133_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_113070026.1|2976402_2977422_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_113070027.1|2977693_2978782_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_041213174.1|2978778_2979765_+	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	3.0e-07
WP_053288328.1|2979859_2980960_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_005302803.1|2981166_2981376_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.4	2.8e-16
WP_103260431.1|2981453_2981765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010675310.1|2981751_2982000_-	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_045524136.1|2982246_2982795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010675308.1|2982889_2983282_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_113070028.1|2983368_2985219_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010675306.1|2985309_2986203_-	EamA family transporter	NA	NA	NA	NA	NA
WP_010674034.1|2986475_2986880_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
WP_113070029.1|2986937_2988164_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_103858461.1|2988247_2989438_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_043153817.1|2989610_2990303_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_010675302.1|2990404_2991307_-	DMT family transporter	NA	NA	NA	NA	NA
WP_113070030.1|2991596_2993234_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010674034.1|2993316_2993721_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
WP_021141234.1|2993778_2995005_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_052815063.1|2995057_2995585_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_162726179.1|2995628_2996045_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010675298.1|2996041_2996362_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_080560543.1|2996456_2997140_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_053288335.1|2997299_2998211_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.3e-36
WP_052815061.1|2998228_2999053_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_053288337.1|2999114_2999516_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_053288338.1|2999512_2999932_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_102948625.1|3000022_3000760_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_113070031.1|3000770_3002636_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_113070032.1|3002782_3003529_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_010675290.1|3003543_3004332_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_010675289.1|3004348_3005020_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010675288.1|3005080_3006178_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_113070033.1|3007327_3009325_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_113070034.1|3009328_3010537_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_113070035.1|3011007_3012324_+	magnesium transporter	NA	NA	NA	NA	NA
WP_113070036.1|3012243_3012648_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	2.0e-29
>prophage 7
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	3275595	3283251	4702913		Mycoplasma_phage(33.33%)	8	NA	NA
WP_069785161.1|3275595_3276810_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.3	2.3e-33
WP_010675059.1|3276864_3277248_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.8e-54
WP_010675058.1|3277263_3277587_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	1.2e-21
WP_010675057.1|3277777_3278296_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_113070124.1|3278324_3280172_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	3.8e-104
WP_005299781.1|3280173_3280512_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_113070125.1|3280669_3281971_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.6	1.0e-34
WP_041213015.1|3281967_3283251_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.4	3.3e-30
>prophage 8
NZ_CP025705	Aeromonas caviae strain R25-6 chromosome, complete genome	4702913	4537612	4632821	4702913	portal,transposase,integrase,terminase,bacteriocin	Aeromonas_phage(75.81%)	108	4549200:4549215	4594711:4594726
WP_162540873.1|4537612_4538443_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	38.4	4.1e-50
WP_113070491.1|4538607_4540221_-	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	31.0	5.8e-48
WP_113070492.1|4540233_4540491_-|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	95.3	6.6e-23
WP_103858409.1|4540490_4540871_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	88.9	6.9e-53
WP_113070493.1|4540880_4541513_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	74.1	5.0e-72
WP_113070494.1|4541523_4541901_-	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	81.5	5.6e-55
WP_113070495.1|4541879_4547264_-	DUF1983 domain-containing protein	NA	A0A1I9KGC4	Aeromonas_phage	58.1	1.0e-149
WP_113070496.1|4547263_4548925_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	93.3	0.0e+00
WP_113070497.1|4549028_4549310_-	hypothetical protein	NA	A0A1I9KG33	Aeromonas_phage	93.5	6.3e-43
4549200:4549215	attL	ATAGTTGTGCTGGGCG	NA	NA	NA	NA
WP_113070675.1|4549306_4550578_-	RNA-dependent DNA polymerase	NA	A0A1I9KFG3	Aeromonas_phage	99.8	2.1e-250
WP_043162866.1|4550595_4550940_-	diversity-generating retroelement protein Avd	NA	A0A1I9KFC4	Aeromonas_phage	99.1	4.2e-57
WP_113070498.1|4551001_4552567_-	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	81.5	1.6e-252
WP_113070499.1|4552576_4553254_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	94.7	2.1e-121
WP_113070500.1|4553266_4553848_-	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	99.0	2.2e-106
WP_113070501.1|4553849_4554287_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	89.7	2.4e-57
WP_043162873.1|4554353_4554743_-	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	97.7	2.6e-63
WP_113070502.1|4554808_4556026_-	DUF4043 family protein	NA	A0A1I9KFC6	Aeromonas_phage	94.1	8.6e-222
WP_113070503.1|4556097_4557012_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	88.0	5.1e-142
WP_113070676.1|4557143_4557728_-	hypothetical protein	NA	A0A1I9KG26	Aeromonas_phage	94.9	1.7e-45
WP_113070504.1|4557877_4560004_-|portal	portal protein	portal	A0A1I9KFF7	Aeromonas_phage	98.0	0.0e+00
WP_113070505.1|4560003_4561701_-|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	95.0	0.0e+00
WP_113070506.1|4561703_4562576_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	84.8	1.8e-125
WP_042878098.1|4562576_4562762_-	hypothetical protein	NA	A0A1I9KFC1	Aeromonas_phage	98.4	3.5e-26
WP_043163259.1|4562809_4563040_-	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	100.0	3.9e-35
WP_042880547.1|4563041_4563266_-	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	100.0	1.7e-30
WP_113070507.1|4563319_4563802_-	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	100.0	7.6e-89
WP_042880552.1|4563801_4564116_-	hypothetical protein	NA	A0A1I9KFB8	Aeromonas_phage	99.0	8.8e-54
WP_113070508.1|4564284_4564986_-	hypothetical protein	NA	A0A1I9KFB9	Aeromonas_phage	89.7	5.7e-109
WP_113070509.1|4564982_4565405_-	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	87.1	3.6e-66
WP_113070510.1|4565401_4565641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042062766.1|4565637_4565967_-	DUF1364 family protein	NA	NA	NA	NA	NA
WP_113070511.1|4565963_4566557_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	45.5	5.2e-47
WP_042062769.1|4566559_4566739_-	hypothetical protein	NA	A0A1I9KFG1	Aeromonas_phage	54.7	1.2e-07
WP_113070512.1|4566735_4567029_-	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	91.8	3.1e-45
WP_113070513.1|4567105_4567408_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	90.0	8.5e-46
WP_113070514.1|4567409_4567589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113070515.1|4567588_4568932_-	replicative DNA helicase	NA	O80281	Escherichia_phage	38.0	1.3e-66
WP_113070516.1|4569689_4569821_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_113070517.1|4570019_4570238_-	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	93.1	2.6e-28
WP_113070518.1|4570241_4570631_-	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	95.8	2.8e-57
WP_064339872.1|4570672_4570888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081250460.1|4571019_4571640_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113070519.1|4572253_4572508_+	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	84.5	1.7e-26
WP_113070520.1|4572820_4573312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042880852.1|4573388_4573580_+	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	90.3	4.1e-22
WP_113070521.1|4573582_4573948_+	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	87.6	4.2e-55
WP_113070522.1|4573944_4574262_+	hypothetical protein	NA	H9C0T7	Aeromonas_phage	41.0	2.8e-07
WP_113070523.1|4574258_4575104_+	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	96.1	2.6e-164
WP_113070524.1|4575100_4576078_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	95.1	1.4e-182
WP_113070525.1|4576126_4577215_+	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	95.1	1.5e-103
WP_113070526.1|4577264_4578482_+	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	87.4	1.6e-172
WP_064339862.1|4578478_4579063_+	hypothetical protein	NA	A0A2I7QNI8	Vibrio_phage	58.5	1.5e-59
WP_043163230.1|4579121_4579301_+	hypothetical protein	NA	A0A1I9KFZ1	Aeromonas_phage	91.5	8.3e-25
WP_113070527.1|4579321_4580233_+	recombination-associated protein RdgC	NA	A0A1I9KF67	Aeromonas_phage	52.2	9.7e-85
WP_113070528.1|4580229_4580574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070529.1|4580570_4581350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070530.1|4581313_4581532_+	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	94.4	1.0e-32
WP_113070531.1|4581575_4582277_+	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	75.0	9.4e-96
WP_113070532.1|4582280_4582592_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	99.0	4.8e-52
WP_043163220.1|4582728_4583166_+	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	78.8	1.9e-46
WP_042642185.1|4583158_4583356_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	57.4	3.3e-14
WP_113070533.1|4583322_4584498_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	60.5	9.8e-130
WP_010673972.1|4584728_4585967_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.9	2.1e-114
WP_010673971.1|4586029_4586434_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_162726213.1|4587242_4587449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_113070677.1|4587472_4587973_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	50.9	5.4e-37
WP_113070536.1|4591436_4592078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162726214.1|4592261_4592651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162726215.1|4592717_4593287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113070538.1|4593829_4595995_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
4594711:4594726	attR	CGCCCAGCACAACTAT	NA	NA	NA	NA
WP_113070539.1|4596183_4596612_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_162726216.1|4596622_4597744_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_113070542.1|4602468_4603419_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_162726217.1|4603663_4604359_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041205622.1|4604598_4605741_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_113070544.1|4605759_4606701_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.7	7.2e-176
WP_113070679.1|4606851_4607922_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_039026396.1|4608953_4609268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026397.1|4609264_4610086_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_113070546.1|4610459_4611227_-	hypothetical protein	NA	A0A249XWN1	Proteus_phage	40.0	2.3e-07
WP_162726218.1|4611266_4612247_-	porin OmpA	NA	NA	NA	NA	NA
WP_041205622.1|4612469_4613612_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_113070548.1|4613665_4614518_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.8	3.8e-22
WP_113070549.1|4614755_4615157_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_162726219.1|4615228_4615900_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_113070550.1|4616350_4617934_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_080760913.1|4617911_4618160_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	33.3	9.8e-08
WP_162726220.1|4618437_4620471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070552.1|4621053_4622007_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.2	3.2e-54
WP_113070553.1|4622102_4623104_+	endonuclease	NA	A0A139ZPJ9	Marinitoga_camini_virus	46.2	4.1e-44
WP_113070554.1|4623100_4624039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029303605.1|4624250_4624811_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_029303604.1|4624848_4625274_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_084214686.1|4625284_4625713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042045082.1|4625687_4625972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042045083.1|4626062_4626560_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_029303518.1|4626556_4626748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049636684.1|4626862_4627111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070555.1|4627278_4627785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102948393.1|4627919_4629123_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
WP_113070556.1|4629146_4629338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106842231.1|4629334_4629697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113070557.1|4629775_4630318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021137998.1|4630319_4630676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021137999.1|4630761_4631076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049636683.1|4631141_4631483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039026397.1|4631688_4632510_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_039026396.1|4632506_4632821_-|transposase	transposase	transposase	NA	NA	NA	NA
