The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029065	Mycobacterium tuberculosis strain TBMENG-03 chromosome, complete genome	4359659	2917497	2955050	4359659	tRNA,protease,head,capsid,terminase,integrase	Mycobacterium_phage(30.0%)	46	2945579:2945606	2955203:2955230
WP_003413486.1|2917497_2919576_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2919684_2919912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413574.1|2921437_2921878_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2922024_2922702_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2922686_2923040_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2923052_2923478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2923474_2924149_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2924226_2925048_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2925183_2926077_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2926079_2926898_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2926912_2928094_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2928152_2928584_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2929097_2930339_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003413600.1|2930648_2931011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2931357_2932482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2932483_2933023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2933161_2934460_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2934498_2934780_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003903963.1|2934924_2935410_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2935436_2935694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031654299.1|2935694_2938031_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2938059_2938302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2938302_2938980_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2939175_2939832_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2939994_2940441_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2940615_2940948_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2941067_2941427_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2941528_2941987_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2942122_2942503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2942499_2943996_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2944230_2944422_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2944494_2944668_+	hypothetical protein	NA	NA	NA	NA	NA
2945579:2945606	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2945712_2946144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908027.1|2946140_2947139_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	1.6e-61
WP_003900539.1|2947152_2947617_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2947604_2947856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2948026_2949466_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2949473_2950007_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2950159_2950786_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003903987.1|2950817_2951141_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2951220_2951466_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_050954864.1|2951462_2952890_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2952891_2953284_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2953280_2953541_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2953557_2953920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2953922_2955050_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2955203:2955230	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
