The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	4126	14835	4883137	protease	Bacillus_phage(16.67%)	7	NA	NA
WP_112906544.1|4126_5380_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	1.0e-12
WP_003547334.1|5756_6386_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.2	9.4e-63
WP_017963839.1|6689_7967_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.7e-132
WP_017959927.1|8369_10787_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.4	2.5e-204
WP_003558438.1|10993_11269_+	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	34.1	7.1e-07
WP_112902543.1|11641_12541_+	DMT family transporter	NA	NA	NA	NA	NA
WP_112906545.1|12636_14835_+	esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	42.4	7.8e-80
>prophage 2
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	303406	316787	4883137	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_112902752.1|303406_304420_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.6e-24
WP_112902754.1|304438_305296_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.5	3.3e-34
WP_065277110.1|305292_306009_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	2.6e-40
WP_003538990.1|306192_306384_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
WP_018241796.1|306435_307047_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_018241797.1|307043_307871_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	5.2e-53
WP_112902756.1|308071_309355_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	1.8e-97
WP_018241799.1|309359_310133_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	2.4e-23
WP_112902758.1|310129_310783_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.1	8.9e-16
WP_112902760.1|311023_312628_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	5.1e-12
WP_112902762.1|312774_313647_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003558894.1|313853_314201_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	2.4e-12
WP_112902764.1|314246_316787_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.2	6.3e-57
>prophage 3
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	594028	604297	4883137		uncultured_Mediterranean_phage(83.33%)	8	NA	NA
WP_112903055.1|594028_596950_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
WP_018242013.1|597234_597744_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	72.9	1.6e-44
WP_018242015.1|597844_598492_-	MarC family protein	NA	NA	NA	NA	NA
WP_112903057.1|598728_601569_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.2	1.5e-75
WP_112903059.1|602220_602496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112903061.1|602632_603127_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.9	8.8e-24
WP_112903063.1|603185_603758_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.8	1.1e-41
WP_003559389.1|603787_604297_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	4.2e-45
>prophage 4
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	1578908	1592711	4883137		Vibrio_phage(25.0%)	10	NA	NA
WP_112904272.1|1578908_1580966_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
WP_112904274.1|1581537_1581885_-	GFA family protein	NA	NA	NA	NA	NA
WP_075224496.1|1581895_1582933_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	7.1e-15
WP_112904276.1|1583195_1584383_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.3	7.5e-37
WP_112904278.1|1584547_1585276_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.0	2.4e-49
WP_112904280.1|1585324_1587205_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.4	6.7e-72
WP_112904282.1|1587204_1589214_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.2	2.2e-89
WP_112904286.1|1589882_1590773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112904288.1|1590776_1591232_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.7	3.1e-15
WP_105008202.1|1591505_1592711_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	1.1e-40
>prophage 5
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	2557658	2567569	4883137		Mycobacterium_phage(25.0%)	9	NA	NA
WP_018243693.1|2557658_2558369_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	48.7	2.3e-49
WP_018446446.1|2558368_2558725_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_018243695.1|2558721_2559450_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	37.6	2.9e-39
WP_018243696.1|2559454_2560675_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.7	5.4e-14
WP_026188536.1|2560779_2561754_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.1	7.3e-139
WP_112905309.1|2561841_2564046_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.4	4.3e-211
WP_018243699.1|2564024_2564429_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.1	6.5e-17
WP_018243700.1|2564443_2564665_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	7.9e-17
WP_112905311.1|2565316_2567569_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.2	7.4e-126
>prophage 6
NZ_CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	4144087	4190155	4883137	transposase,integrase,protease	Paenibacillus_phage(25.0%)	51	4132977:4132992	4152041:4152056
4132977:4132992	attL	CCGATGACGCCGATGC	NA	NA	NA	NA
WP_112906075.1|4144087_4144645_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	7.1e-14
WP_162710315.1|4144470_4144743_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.0	1.2e-17
WP_112906077.1|4145214_4146390_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_112906078.1|4146402_4147263_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.7	2.4e-32
WP_112906079.1|4147397_4147853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018245083.1|4147918_4148539_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_112906080.1|4148545_4149583_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_112906081.1|4149860_4151144_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_028734869.1|4151227_4151545_+	pyrophosphatase	NA	NA	NA	NA	NA
WP_112906082.1|4151595_4152087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
4152041:4152056	attR	GCATCGGCGTCATCGG	NA	NA	NA	NA
WP_112906083.1|4152103_4153519_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_112906084.1|4153879_4154524_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_018449294.1|4154864_4155749_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_033181404.1|4155766_4157473_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	37.2	6.6e-10
WP_028734865.1|4157540_4158491_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_018245094.1|4158627_4159236_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_018245095.1|4159297_4160176_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_112906085.1|4160230_4160872_-	chloramphenicol phosphotransferase	NA	NA	NA	NA	NA
WP_028734863.1|4161013_4161394_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_112906086.1|4161386_4162142_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_011650764.1|4162205_4163207_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_112906087.1|4163277_4164243_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003545999.1|4164239_4164695_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.8	4.7e-40
WP_112906088.1|4164807_4165893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003546001.1|4166041_4166233_-	CsbD family protein	NA	NA	NA	NA	NA
WP_018245102.1|4166332_4166938_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_112906733.1|4167079_4167931_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_003557102.1|4168013_4168499_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	50.0	3.9e-24
WP_162710316.1|4168580_4169729_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	31.7	2.4e-08
WP_112906090.1|4169752_4170889_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_018449273.1|4170992_4171889_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162710325.1|4172280_4173267_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_112906092.1|4173480_4173999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112906093.1|4173995_4174712_+	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_112906094.1|4174804_4175644_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_112906095.1|4175679_4176057_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_112906096.1|4176153_4177224_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_018245123.1|4177455_4178292_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_112906097.1|4178507_4178924_+	ester cyclase	NA	NA	NA	NA	NA
WP_065277988.1|4179049_4179625_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_112906098.1|4179621_4180104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112906099.1|4180265_4181264_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112906100.1|4181260_4182751_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_112906101.1|4182743_4183484_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	3.1e-25
WP_112906102.1|4183500_4184325_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_018245130.1|4184380_4185088_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_018245131.1|4185107_4185800_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_112906103.1|4186026_4186548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112906105.1|4187323_4188073_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_028734837.1|4188069_4188942_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_112906551.1|4189087_4190155_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP030761	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence	1234209	1027242	1071239	1234209	transposase,integrase	Brevibacillus_phage(14.29%)	35	1027127:1027153	1030502:1030528
1027127:1027153	attL	GTTTATGCCGACCGGCGAACTATGCCG	NA	NA	NA	NA
WP_112904559.1|1027242_1028244_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
WP_112904561.1|1028240_1029164_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_112904563.1|1029160_1030402_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
WP_112907668.1|1031999_1033115_-	hypothetical protein	NA	NA	NA	NA	NA
1030502:1030528	attR	CGGCATAGTTCGCCGGTCGGCATAAAC	NA	NA	NA	NA
WP_112907669.1|1033340_1034954_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	27.3	1.5e-40
WP_112907671.1|1036200_1038765_-	two-component system VirA-like sensor kinase	NA	W8CYF6	Bacillus_phage	23.8	2.3e-06
WP_162710355.1|1038721_1039702_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_162710356.1|1039749_1040493_-	response regulator	NA	NA	NA	NA	NA
WP_162710357.1|1042007_1043138_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_112907675.1|1043660_1044680_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_112907676.1|1044726_1047120_+	transketolase	NA	NA	NA	NA	NA
WP_112907677.1|1047709_1048081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112907678.1|1048077_1048938_-	extradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_112907679.1|1049385_1050303_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162710358.1|1050817_1051516_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_162710359.1|1052240_1053344_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_112907682.1|1053872_1055048_+	cytochrome P450	NA	NA	NA	NA	NA
WP_112907683.1|1055223_1055460_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_112907684.1|1056166_1056496_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_112907685.1|1057059_1058220_+	amidohydrolase	NA	NA	NA	NA	NA
WP_162710360.1|1058371_1058842_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162710361.1|1059230_1059437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162710362.1|1059477_1059627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_112907688.1|1059938_1060454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112907689.1|1060585_1061254_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_112907691.1|1061916_1062219_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112907692.1|1062280_1063270_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	30.2	3.1e-12
WP_112907693.1|1063972_1064236_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_112907694.1|1064254_1064878_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_112907695.1|1064849_1065566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112907696.1|1066805_1067861_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	20.5	2.5e-07
WP_112907697.1|1068918_1069173_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_028739446.1|1069169_1069412_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_112907698.1|1069777_1069978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112907699.1|1070555_1071239_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.1	1.3e-38
>prophage 1
NZ_CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	5065	69842	415988	transposase,integrase	Mycobacterium_phage(21.43%)	47	55655:55714	69900:70016
WP_162710371.1|5065_6012_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.2	1.6e-10
WP_063473322.1|6421_7597_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_063473321.1|7610_8471_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.7	1.4e-32
WP_112907836.1|9754_10075_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.5	2.5e-19
WP_063474895.1|10147_10480_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_063474896.1|11319_12093_-	thiazole synthase	NA	NA	NA	NA	NA
WP_063474897.1|12094_12292_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_063474898.1|12288_13281_-	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_082849701.1|15503_16214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063474901.1|16503_16725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063474902.1|17161_17638_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063474903.1|17780_18800_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_063474904.1|19371_19779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063474905.1|19847_20564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063474906.1|21270_21906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063474907.1|22069_22795_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063474908.1|23340_23985_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	2.5e-10
WP_063474909.1|23977_24754_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.1	3.2e-12
WP_082849703.1|24750_25713_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063474910.1|25709_26606_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063474911.1|26750_28031_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082849704.1|28561_29392_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063474914.1|30945_32109_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_063474915.1|32156_32948_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_063474916.1|33116_34292_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_063474917.1|34761_35295_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112904563.1|36275_37517_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
WP_112904561.1|37513_38437_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_112904559.1|38433_39435_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
WP_112907852.1|39317_40961_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.9	7.9e-45
WP_003592504.1|41128_41473_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_024323553.1|41469_41856_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063474919.1|42038_42953_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_082849708.1|43592_44735_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082849705.1|44739_45357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063474925.1|53139_54393_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	40.4	1.7e-68
WP_028734754.1|54989_55454_-	hypothetical protein	NA	NA	NA	NA	NA
55655:55714	attL	CGTTTATGCCGACCGGCGAACTATGCCGAATGCCTCTTCTGACAGAGACGGCAAACTGTG	NA	NA	NA	NA
WP_112904559.1|55771_56773_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
WP_112904561.1|56769_57693_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_112904563.1|57689_58931_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
WP_028734752.1|60568_60922_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_028734751.1|60918_61305_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_018241647.1|64211_64622_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_018241646.1|64618_64966_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	9.8e-38
WP_112904563.1|66682_67924_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
WP_112904561.1|67920_68844_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_112904559.1|68840_69842_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
69900:70016	attR	CACAGTTTGCCGTCTCTGTCAGAAGAGGCATTCGGCATAGTTCGCCGGTCGGCATAAACGGCAAAGCTCAACGACATTGATCCGCAGGCGTGGCTTGCCGACATCCTCGCCCGCATA	NA	NA	NA	NA
>prophage 2
NZ_CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	93191	156956	415988	transposase	uncultured_virus(11.76%)	49	NA	NA
WP_063474724.1|93191_94193_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.5e-42
WP_112907838.1|94310_95321_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063474865.1|96328_97033_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112907853.1|97785_99408_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_003549661.1|99416_100151_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003549664.1|100159_100312_+	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
WP_112907839.1|100313_101177_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_003549668.1|101188_101374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112907840.1|101550_103119_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_011649553.1|103115_103601_+	cation transporter	NA	NA	NA	NA	NA
WP_063473332.1|103597_105883_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.8	2.6e-78
WP_003549679.1|105879_106038_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_017992270.1|106072_106744_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063473331.1|107077_108157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063473330.1|108190_109198_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
WP_081295608.1|109662_109995_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063473328.1|110314_110986_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_063473327.1|111121_112408_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A218MN59	uncultured_virus	20.5	2.6e-11
WP_063473326.1|112850_114125_+	ROK family protein	NA	NA	NA	NA	NA
WP_012881219.1|115118_115376_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_063473325.1|115375_115762_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_027690734.1|117733_118000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473767.1|118087_119578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473768.1|119574_121032_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_063473769.1|121061_121688_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	44.3	4.4e-44
WP_063473770.1|121687_122695_+	adenylosuccinate synthetase	NA	A0A1B3B082	Gordonia_phage	30.9	6.8e-31
WP_063473771.1|122691_123990_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.7	2.0e-19
WP_063473772.1|124045_124741_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A0A0RTJ1	Escherichia_phage	43.5	3.7e-44
WP_063473773.1|124737_125943_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	36.5	1.2e-66
WP_162710373.1|125939_126611_-	nitrile hydratase subunit alpha	NA	NA	NA	NA	NA
WP_063473775.1|126610_127315_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1V0DY95	Dinoroseobacter_phage	40.5	1.9e-32
WP_162710374.1|127389_128019_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_162710375.1|128051_128591_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_063473778.1|128784_129402_+	6-carboxytetrahydropterin synthase	NA	A0A1B0Z0B1	Vibrio_phage	24.4	5.0e-08
WP_063474878.1|130543_131173_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_063474879.1|131984_132191_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	1.8e-10
WP_088930310.1|135109_136652_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.2	5.7e-37
WP_063473312.1|137365_137608_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_063473309.1|138077_138812_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.7	7.7e-32
WP_063473308.1|138811_140311_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	6.6e-14
WP_082849700.1|140904_143244_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_063474892.1|143255_144245_-	ATP-binding protein	NA	A0A125SJ49	Acidianus_tailed_spindle_virus	33.6	1.7e-13
WP_063474890.1|145116_145797_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063474889.1|146781_147384_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_063474888.1|148228_150424_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.5	2.7e-08
WP_082849699.1|150453_150561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082849698.1|152684_152963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112907841.1|153043_154042_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.0	3.1e-52
WP_112907842.1|156239_156956_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	186867	241042	415988	holin,transposase,integrase	Wolbachia_phage(28.57%)	47	175077:175091	248364:248378
175077:175091	attL	ACTATGCGCTGTTTC	NA	NA	NA	NA
WP_112907843.1|186867_187569_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_063473660.1|187697_188558_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	25.5	2.1e-12
WP_033181974.1|189380_190361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089046350.1|190826_191591_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_063473658.1|192581_193166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473657.1|193484_194402_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	47.7	2.3e-70
WP_027691174.1|195041_195353_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_162710370.1|195653_195815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473655.1|196350_196659_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_063473654.1|197102_197417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473653.1|197659_198109_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_063473652.1|198497_200408_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_063473651.1|200394_200610_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_063473650.1|200614_200911_-	TraC family protein	NA	NA	NA	NA	NA
WP_027681723.1|201739_202039_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_063473648.1|202031_202415_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_063473647.1|202404_203382_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_063473646.1|203378_204017_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_089046349.1|204217_204607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082849656.1|204747_205002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473668.1|205617_206832_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	54.7	1.4e-118
WP_063473644.1|206828_207851_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	34.3	9.3e-44
WP_063473643.1|208006_209311_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	26.5	5.0e-18
WP_112907845.1|211173_213234_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	23.4	1.7e-07
WP_082849655.1|213232_213943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162710376.1|214527_216483_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.9	1.7e-33
WP_063473639.1|216473_217172_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_162710377.1|217201_218095_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_063473636.1|218382_218598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473635.1|218646_219519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473634.1|219765_220929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082849651.1|221077_222223_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_063473633.1|222327_223188_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_125853655.1|223399_224485_+	methyltransferase	NA	NA	NA	NA	NA
WP_125853653.1|224614_225793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063473630.1|226005_226698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027688356.1|229204_229468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473628.1|229525_230158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063473626.1|231070_231655_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_063473625.1|233190_233895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063473624.1|233983_234466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063473666.1|234758_235601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112907847.1|235652_236126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082849659.1|236146_236689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063473621.1|236868_237624_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_011649147.1|237900_239571_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063473620.1|239893_241042_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
248364:248378	attR	ACTATGCGCTGTTTC	NA	NA	NA	NA
>prophage 4
NZ_CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	296262	305713	415988	transposase	Staphylococcus_phage(100.0%)	7	NA	NA
WP_063473580.1|296262_297273_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063473306.1|297620_298787_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_063473307.1|299118_300492_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_063473306.1|300783_301950_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041936326.1|302339_303077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082849634.1|303176_304172_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	7.9e-40
WP_063473343.1|304594_305713_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
