The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	333880	390410	4703465	transposase	Escherichia_phage(22.22%)	50	NA	NA
WP_001705161.1|333880_335089_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	1.3e-206
WP_000703959.1|335258_335606_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|335595_335958_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_032328267.1|335954_336452_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|336459_337644_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|337923_338013_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|338577_338676_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|338781_340470_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001181706.1|340473_340764_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000633668.1|340839_341430_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_001295243.1|341429_342932_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_000936566.1|342941_344261_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_000879194.1|344398_345790_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_001065718.1|345835_347602_-	adenine deaminase	NA	NA	NA	NA	NA
WP_002431302.1|347776_349111_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
WP_001355577.1|349163_349616_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_032328269.1|349826_351017_+	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_000805509.1|351057_351351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779419.1|351572_352391_+	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_032328268.1|352394_353318_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001172882.1|353428_354613_-	sugar efflux transporter	NA	NA	NA	NA	NA
WP_001315909.1|354994_355141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839275.1|356343_356541_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761693.1|356552_357041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854743.1|357037_357415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285298.1|357504_357873_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086754.1|357922_358567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692295.1|358585_358807_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_032328266.1|358875_359352_-	RadC family protein	NA	NA	NA	NA	NA
WP_112059337.1|359366_361340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069707.1|361711_362584_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001355567.1|365200_365773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001706652.1|365858_366137_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001531226.1|366445_367237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453335.1|368121_368334_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001189123.1|370242_371751_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001315617.1|372475_372574_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001298267.1|372575_373358_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350273.1|373663_374584_+	ribokinase	NA	NA	NA	NA	NA
WP_001682518.1|374611_375928_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107478.1|375939_376953_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001310555.1|379327_380344_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_072097498.1|381495_381726_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|381722_382589_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000698190.1|382748_383465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000773452.1|383504_384017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201092.1|384085_386686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001530297.1|386700_387795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|389316_390183_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_072097498.1|390179_390410_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	1154798	1161882	4703465	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000691818.1|1154798_1155020_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001398324.1|1155156_1155336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395295.1|1156883_1157108_+|transposase	transposase	transposase	Q76S41	Shigella_phage	70.8	1.2e-17
WP_000381401.1|1157272_1158844_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|1158863_1159211_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1159210_1159888_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001189123.1|1160373_1161882_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 3
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	1409617	1416757	4703465		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1409617_1410256_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1410252_1411515_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001388215.1|1411511_1412420_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001272547.1|1412585_1413383_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|1413433_1414090_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272895.1|1414195_1416757_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 4
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	1773115	1830894	4703465	capsid,holin,tRNA,tail,integrase,head,plate	Enterobacteria_phage(83.78%)	67	1803102:1803121	1827870:1827889
WP_001311971.1|1773115_1774453_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_000368140.1|1774716_1775649_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000776768.1|1775942_1776698_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937788.1|1776879_1777938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295701.1|1778303_1779644_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296261.1|1780015_1780300_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531952.1|1780480_1781791_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426176.1|1781790_1783935_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1784137_1784623_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033316.1|1785303_1785867_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001416631.1|1785948_1788594_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281606.1|1788613_1789366_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001311011.1|1789365_1789878_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001232541.1|1789874_1790363_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001043398.1|1790359_1790899_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000698745.1|1790900_1791722_+	YfcO family protein	NA	NA	NA	NA	NA
WP_000730806.1|1791792_1792344_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001300582.1|1792509_1793442_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001333535.1|1793476_1794562_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001043825.1|1794565_1795390_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1795389_1796199_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089222.1|1796198_1796747_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1796780_1797059_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683789.1|1797179_1799186_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1799344_1800565_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127751.1|1800829_1802008_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615834.1|1802004_1803000_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1803102:1803121	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001420124.1|1804164_1804497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078916.1|1804674_1804815_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001299564.1|1805005_1805266_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032328495.1|1805308_1806418_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
WP_001397420.1|1806575_1807760_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000290450.1|1807759_1808272_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|1808326_1808692_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|1808727_1808856_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001394249.1|1808842_1811650_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|1811662_1812151_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_044316995.1|1813251_1814097_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.8	2.0e-137
WP_000213447.1|1814100_1814451_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271913.1|1814447_1815029_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	5.6e-102
WP_032328248.1|1815025_1815661_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.1	2.2e-112
WP_000920594.1|1815653_1816121_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|1816258_1816666_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_032328493.1|1816662_1817055_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_000104350.1|1817051_1817375_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000865513.1|1817377_1817578_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_077941749.1|1817577_1817997_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.3	5.4e-75
WP_162627054.1|1817921_1818617_-|capsid	P2 family phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	91.5	3.6e-100
WP_000599412.1|1821202_1821568_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_111986922.1|1821564_1822185_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	7.0e-10
WP_000714524.1|1822238_1823069_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	98.9	9.6e-132
WP_001036813.1|1823065_1823269_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_001274216.1|1823280_1823580_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	3.5e-44
WP_000153702.1|1823576_1823843_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	5.8e-30
WP_000985149.1|1823839_1824043_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	2.5e-25
WP_001583389.1|1824042_1824306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363442.1|1824395_1824509_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
WP_000514277.1|1824505_1824748_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_032328491.1|1824759_1825047_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813363.1|1825057_1825399_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|1825651_1825858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001705258.1|1825864_1826152_-	regulatory phage cox family protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
WP_032327937.1|1826265_1826586_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.8e-15
WP_000023402.1|1826682_1827687_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001705257.1|1827845_1829003_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
1827870:1827889	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289167.1|1829068_1830082_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283585.1|1830081_1830894_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	2045621	2055062	4703465		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|2045621_2046548_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|2046552_2047284_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2047264_2047372_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2047431_2048163_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2048384_2050070_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2050066_2050786_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2050832_2051303_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2051342_2051804_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001355588.1|2051928_2053929_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001333512.1|2053925_2055062_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 6
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	2242539	2311137	4703465	capsid,holin,transposase,tail,terminase,integrase,head,plate,portal	Enterobacteria_phage(74.0%)	84	2262999:2263058	2318710:2318834
WP_077891205.1|2242539_2243199_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.1e-43
WP_001355499.1|2243221_2244430_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_000334609.1|2244469_2245141_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000789493.1|2245249_2245483_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|2245479_2246685_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2246871_2247285_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|2247318_2248806_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015023.1|2248883_2249249_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287768.1|2249248_2249659_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146098.1|2249673_2251086_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032328022.1|2251340_2252915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087467.1|2253079_2253799_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001301374.1|2253844_2254396_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001295643.1|2254483_2255284_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032328023.1|2255388_2256375_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2256389_2257058_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|2257054_2257807_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_032328024.1|2258036_2258759_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2258826_2259051_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001302050.1|2259037_2259214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611338.1|2259509_2260166_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2260162_2261995_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2262051_2262600_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2262999:2263058	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_071595684.1|2263593_2263875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2264064_2264205_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2264394_2264655_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132785.1|2264697_2265807_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_112059341.1|2265964_2267149_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|2267148_2267661_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651572.1|2267716_2268091_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|2268099_2268255_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_112059342.1|2268241_2271055_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.8	0.0e+00
WP_001508246.1|2271067_2271556_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.8e-85
WP_032328286.1|2271584_2272175_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	96.9	4.8e-101
WP_077828520.1|2272306_2273236_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	86.7	1.9e-72
WP_032328284.1|2273239_2273767_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.3	2.0e-90
WP_032328282.1|2273795_2274329_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	1.0e-94
WP_032328280.1|2274331_2276698_-	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	60.5	4.6e-203
WP_032328279.1|2276700_2277231_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.3e-92
WP_001512968.1|2277223_2278120_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_001376278.1|2278123_2278474_-	lysozyme family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.0e-59
WP_024235435.1|2278470_2279052_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	9.5e-102
WP_029788343.1|2279048_2279684_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	6.9e-114
WP_000920586.1|2279676_2280144_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780535.1|2280281_2280689_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_024235437.1|2280685_2281078_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_001092398.1|2281074_2281398_-|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	9.4e-51
WP_000864897.1|2281400_2281601_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|2281600_2282095_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_032328374.1|2282197_2282998_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	3.2e-124
WP_001677415.1|2283043_2284096_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	91.7	1.4e-183
WP_000180563.1|2284119_2284956_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001376476.1|2285110_2286862_+|terminase	ATPase subunit of terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_001705841.1|2286861_2287908_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_000211267.1|2289028_2289340_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_032327983.1|2289344_2290304_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.1	6.0e-178
WP_032327984.1|2290380_2293188_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.9	0.0e+00
WP_000599410.1|2293194_2293560_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_112059343.1|2293556_2294174_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	48.1	5.0e-08
WP_001274214.1|2294185_2294485_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_000153674.1|2294481_2294727_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|2294723_2294927_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021652.1|2295013_2295127_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|2295123_2295366_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|2295377_2295665_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000739032.1|2295675_2296026_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	2.7e-51
WP_000014505.1|2296047_2296251_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2296322_2296460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2296549_2296954_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290347.1|2296969_2297620_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2297649_2297997_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2298002_2299004_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000440337.1|2299265_2300147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172375.1|2300227_2301427_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000054834.1|2301852_2302167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|2302192_2302726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001194747.1|2302798_2303233_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_032328222.1|2303843_2304662_-	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_000515817.1|2304723_2305626_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.5	9.7e-37
WP_000280683.1|2306005_2306332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069517.1|2306380_2308981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256731.1|2309027_2309666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281555.1|2309655_2309856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001121921.1|2310006_2311137_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.6e-15
2318710:2318834	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	2655752	2670782	4703465	transposase,integrase	Salmonella_phage(33.33%)	15	2647857:2647870	2660999:2661012
2647857:2647870	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000598292.1|2655752_2656079_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001355548.1|2656284_2657499_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_001394316.1|2657510_2658530_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|2658587_2658716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876998.1|2658717_2659998_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001296941.1|2660032_2660269_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_040036049.1|2660356_2662813_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
2660999:2661012	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_000169527.1|2662884_2663184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2663180_2664047_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001557860.1|2665010_2665118_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000887491.1|2665162_2665375_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000836768.1|2666928_2667162_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2667230_2667344_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347500.1|2667949_2669233_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|2669321_2670782_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 8
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	3033442	3071205	4703465	holin,tRNA,tail,terminase,integrase,portal	Escherichia_phage(28.57%)	45	3041634:3041648	3071307:3071321
WP_001297484.1|3033442_3034549_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3034584_3035226_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423743.1|3035229_3036600_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.2e-108
WP_001265471.1|3036768_3037440_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3037439_3038900_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3038975_3040097_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|3040145_3041372_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3041621_3042758_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3041634:3041648	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3042741_3043605_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|3043836_3044103_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000239880.1|3044159_3044828_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071597385.1|3044882_3044981_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	75.0	6.1e-06
WP_000985933.1|3046441_3047071_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.2e-102
WP_001072975.1|3047070_3047283_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_032231177.1|3047279_3049382_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000373426.1|3049381_3049876_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_000232223.1|3050325_3050691_-	hypothetical protein	NA	A0A220NRM9	Escherichia_phage	99.1	5.8e-57
WP_001228685.1|3050774_3050960_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001700670.1|3051882_3052416_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	1.1e-99
WP_000193273.1|3052471_3052786_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839572.1|3052790_3053006_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193722.1|3053873_3054752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|3055001_3055388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532210.1|3055401_3055752_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.5e-54
WP_000904105.1|3055741_3056113_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.0e-36
WP_001265281.1|3056125_3057175_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_032289145.1|3057176_3057449_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
WP_000481765.1|3057550_3058672_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	28.7	2.4e-32
WP_001179382.1|3058682_3059276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355535.1|3059449_3059569_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.8	1.2e-08
WP_000200161.1|3059726_3060773_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001151206.1|3061257_3061713_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	2.3e-63
WP_001262390.1|3061753_3062824_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|3062895_3063321_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|3063317_3063572_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|3063651_3064071_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|3064368_3064524_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171936.1|3064683_3064902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327945.1|3064924_3065239_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	6.2e-07
WP_000202162.1|3066066_3066288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449195.1|3066846_3067035_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083284.1|3067031_3067223_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048555.1|3067315_3069787_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	1.6e-57
WP_000003742.1|3069848_3070118_+	excisionase	NA	NA	NA	NA	NA
WP_000074976.1|3070086_3071205_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	4.5e-84
3071307:3071321	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 9
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	3448209	3456055	4703465	lysis	Enterobacteria_phage(66.67%)	7	NA	NA
WP_000586337.1|3448209_3449541_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
WP_001171282.1|3450045_3451008_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001393987.1|3451315_3453148_-	ParB N-terminal domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.8	1.0e-274
WP_032328194.1|3453274_3454744_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3454940_3455126_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135263.1|3455342_3455840_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_000839596.1|3455839_3456055_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
>prophage 10
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	3654095	3708356	4703465	protease,transposase,tRNA,integrase,lysis	Enterobacteria_phage(47.83%)	50	3687361:3687420	3704935:3705703
WP_001393886.1|3654095_3655208_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3655284_3655437_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130653.1|3655889_3657008_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|3657073_3657322_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3657386_3657755_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351480.1|3657848_3658502_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3658609_3659857_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786320.1|3659924_3661301_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3661402_3664546_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3664557_3665781_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3665796_3666129_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3666286_3667660_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3667816_3668500_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253838.1|3668489_3669938_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032327979.1|3670674_3672576_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	9.6e-26
WP_001160804.1|3672603_3673065_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289021.1|3673084_3677338_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_071608736.1|3677344_3677602_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.9	1.4e-12
WP_000889443.1|3677634_3677895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|3678020_3678182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327956.1|3679145_3680282_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383906.1|3680552_3682664_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001355527.1|3682776_3685749_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224564.1|3685749_3686640_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_032328380.1|3686822_3687365_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3687361:3687420	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_112059344.1|3688130_3688361_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001201820.1|3688874_3689828_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001393528.1|3690862_3691603_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000355602.1|3692278_3692572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235988.1|3692582_3693287_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|3693296_3693578_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|3693574_3694267_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|3694677_3695223_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|3695611_3695806_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|3696165_3696459_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3696549_3696732_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|3696948_3697446_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|3697445_3697661_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|3698249_3699332_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|3699521_3699905_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|3699990_3700131_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|3700127_3700490_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|3700559_3700838_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|3700809_3701181_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|3701036_3702200_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001310555.1|3703078_3704095_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000729160.1|3705225_3706092_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
3704935:3705703	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCAGGTATTTCTTAAATTATCTTAATCCTTAGACAAGGAAATAAATCAGTTCCAGATTTACAACGCCATCATGGACGAAAAATGAAGCTTTCAGTCTCAGCGACGGTGCGCCTCACCTTCGCAAGAGGTCGCTTCACGCGATAAATCTGAAACGAAACCTGACAGCGCGCCCCGCTTCTGACAAAATAGGCGCATCCCCTTCGACCTACGTAACAGATGGAATCCTCTCTCTGATGGCAGCAAAGATTATTGACGGTAAAACGATTGCGCAGCAGGTGCGCTCTGAAGTTGCTCAAAAAGTTCAGGCGCGTATTGCAGCCGGACTGCGGGCACCAGGACTGGCCGTTGTGCTGGTGGGTAGTAACCCTGCATCGCAAATTTATGTCGCAAGCAAACGCAAGGCTTGTGAAGAAGTCGGGTTCGTCTCCCGCTCTTATGACCTCCCGGAAACCACCAGCGAAGCGGAGCTGCTGGAGCTTATCGATACGCTGAATGCCGACAACACCATCGATGGCATTCTGGTTCAACTGCCGTTACCGGCGGGTATTGATAACGTCAAAGTGCTGGAACGTATTCATCCGGACAAAGACGTGGACGGTTTCCATCCTTACAACGTCGGTCGTCTGTGCCAGCGCGCGCCGCGTCTGCGTCCCTGCACCCCGCGCGGTATCGTCACGCTGCTTGAGCGTTACAACATTGATACCTTCGGCC	NA	NA	NA	NA
WP_000190288.1|3706093_3706306_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3706413_3706935_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3706970_3708356_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 11
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	3915600	3925286	4703465	integrase	Enterobacteria_phage(33.33%)	13	3913095:3913108	3929458:3929471
3913095:3913108	attL	CTGTTGCTGCTGCT	NA	NA	NA	NA
WP_032328337.1|3915600_3916203_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	1.2e-22
WP_000181940.1|3916195_3916417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|3916413_3916677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3916673_3916868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095033707.1|3916860_3917928_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.3	5.2e-13
WP_000476150.1|3917921_3918104_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019362.1|3918096_3918930_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412538.1|3918942_3919374_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3919373_3919577_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772646.1|3920004_3921219_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	2.2e-132
WP_000893277.1|3921574_3922828_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
WP_001285288.1|3922839_3923943_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3924230_3925286_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
3929458:3929471	attR	CTGTTGCTGCTGCT	NA	NA	NA	NA
>prophage 12
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	4350673	4364531	4703465	transposase,integrase	Enterobacteria_phage(66.67%)	14	4350281:4350294	4355585:4355598
4350281:4350294	attL	GCGCTGGCGCGATT	NA	NA	NA	NA
WP_001355523.1|4350673_4351378_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	43.1	1.2e-42
WP_000783700.1|4351955_4354289_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_000844963.1|4354303_4354624_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032327981.1|4354620_4354848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459282.1|4354952_4355402_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_001133040.1|4355394_4355694_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
4355585:4355598	attR	GCGCTGGCGCGATT	NA	NA	NA	NA
WP_001355524.1|4355686_4356241_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_024171719.1|4356237_4356504_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001297096.1|4357785_4358565_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001295213.1|4358564_4359587_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000984214.1|4359814_4360057_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_000090076.1|4360073_4360649_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_001299662.1|4361879_4362899_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001355687.1|4363028_4364531_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 13
NZ_CP029981	Escherichia coli strain 99-3165 chromosome, complete genome	4703465	4490819	4540023	4703465	transposase,integrase	Stx2-converting_phage(37.5%)	42	4490625:4490646	4510073:4510094
4490625:4490646	attL	ATTCCGAGTCCGGGCACCACTT	NA	NA	NA	NA
WP_032328147.1|4490819_4491992_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.5	3.1e-120
WP_021517873.1|4492426_4493470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281244.1|4493612_4495286_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021517875.1|4495351_4495549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|4495688_4495955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328150.1|4497570_4498650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328152.1|4498698_4499595_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000571845.1|4500018_4500765_-	porin family protein	NA	NA	NA	NA	NA
WP_001421562.1|4500994_4501165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328154.1|4504156_4505692_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	9.5e-101
WP_001282653.1|4505708_4506464_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_021552170.1|4507406_4508531_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	30.3	4.6e-36
WP_000779483.1|4510341_4510668_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
4510073:4510094	attR	AAGTGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
WP_001143297.1|4510664_4510928_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001280426.1|4510999_4511866_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839291.1|4511950_4512148_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032328344.1|4512159_4512648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854727.1|4512644_4513022_-	toxin	NA	NA	NA	NA	NA
WP_024183700.1|4513110_4513479_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692295.1|4513558_4513780_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_032328266.1|4513848_4514325_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206660.1|4514339_4514825_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	1.2e-12
WP_001234693.1|4514916_4515735_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_001278281.1|4515833_4516067_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000010388.1|4516868_4517753_-	GTPase	NA	NA	NA	NA	NA
WP_021538213.1|4517859_4518792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000816117.1|4518788_4519598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|4520526_4521543_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000778605.1|4522175_4522706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328013.1|4523196_4524768_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.7	5.8e-170
WP_112059346.1|4524818_4526351_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	1.4e-43
WP_000624622.1|4526452_4526800_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032328087.1|4526799_4527450_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	2.2e-14
WP_001075480.1|4527752_4528484_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001421645.1|4528704_4528854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013354.1|4528868_4529444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050436863.1|4530755_4531262_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	73.0	2.1e-60
WP_032252209.1|4531498_4533244_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072327863.1|4534417_4534672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|4537407_4538085_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4538084_4538432_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|4538451_4540023_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
>prophage 1
NZ_CP029980	Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence	117740	0	65152	117740	transposase,protease	Stx2-converting_phage(24.0%)	60	NA	NA
WP_000219392.1|254_1271_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000959870.1|1737_2700_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001393279.1|2702_3053_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_032328117.1|3119_4064_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000780221.1|4386_4668_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000471255.1|4648_4978_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_013188501.1|5967_6186_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_001189123.1|8536_10045_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000019162.1|12478_12751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001378495.1|13066_13843_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_013188479.1|13839_14214_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_162627053.1|14534_15371_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.1e-66
WP_001254933.1|15419_16571_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001355566.1|16659_17526_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_122994480.1|17780_17972_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|18112_19391_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|19557_20251_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
WP_140159966.1|20340_20568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|20608_21286_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|21285_21633_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|21652_23224_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_112059334.1|23144_23447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001394776.1|24674_28769_+|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.5	3.3e-257
WP_001705742.1|31181_31823_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001159871.1|32866_33172_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|33173_33392_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343092.1|33836_34094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011387704.1|34093_34624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|34867_35710_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_064734538.1|35712_36801_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_032328199.1|36805_37756_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_000115001.1|39680_40190_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	8.8e-19
WP_000865086.1|40566_40854_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	87.4	5.1e-40
WP_000483538.1|40853_41165_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	93.1	3.6e-47
WP_001393354.1|41293_41434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072328067.1|42136_42994_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|42986_43061_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|43297_43552_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032327992.1|43791_44382_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001393151.1|44533_45160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297500.1|45571_45781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840475.1|45911_46472_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|46574_47435_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000138370.1|49170_49563_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071594518.1|49516_49891_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_032327991.1|50302_51031_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399782.1|51017_51584_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000124827.1|52818_53202_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013188482.1|53524_54127_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001393327.1|54422_55244_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_000107522.1|55360_55648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272235.1|55803_56106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|57020_57179_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000845924.1|58165_58600_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001508949.1|58654_59326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393231.1|59353_60622_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	32.1	5.2e-20
WP_001254933.1|61117_62269_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001171554.1|62839_63220_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|63216_63564_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998103.1|63613_65152_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.9e-291
>prophage 2
NZ_CP029980	Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence	117740	72901	79935	117740	transposase,integrase	Stx2-converting_phage(60.0%)	7	64904:64919	76213:76228
64904:64919	attL	GAGGCGGACAATAACA	NA	NA	NA	NA
WP_112059335.1|72901_73615_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.2e-53
WP_001144037.1|73792_74437_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030204.1|74523_74832_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000897156.1|75053_75431_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	50.0	1.4e-21
WP_001393266.1|75466_75712_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	64.2	9.7e-24
WP_001355604.1|75831_76176_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	57.0	1.6e-27
WP_000544814.1|79137_79935_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
76213:76228	attR	GAGGCGGACAATAACA	NA	NA	NA	NA
>prophage 3
NZ_CP029980	Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence	117740	95407	99114	117740	transposase	Planktothrix_phage(50.0%)	2	NA	NA
WP_000593828.1|95407_96034_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.1e-18
WP_095033721.1|97835_99114_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
>prophage 4
NZ_CP029980	Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence	117740	116500	116674	117740	transposase	Stx2-converting_phage(100.0%)	1	NA	NA
WP_044307862.1|116500_116674_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
>prophage 1
NZ_CP029982	Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence	71543	22898	34746	71543	transposase	Stx2-converting_phage(33.33%)	14	NA	NA
WP_001297832.1|22898_23462_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
WP_001337416.1|23980_24217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290820.1|24281_24809_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	4.6e-47
WP_000005971.1|24865_25099_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_052158500.1|25162_26839_+	plasmid SOS inhibition protein A	NA	G8DH78	Emiliania_huxleyi_virus	31.8	3.4e-19
WP_001178556.1|26838_27357_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	68.5	1.3e-57
WP_000775238.1|27532_27694_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001550495.1|28292_28526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|28588_28885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001705702.1|28995_29802_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.1	1.9e-44
WP_000381401.1|29828_31400_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|31419_31767_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|31766_32444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_112059346.1|33213_34746_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	1.4e-43
