The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	210670	218175	5018145	integrase	Enterobacteria_phage(85.71%)	10	202242:202256	218827:218841
202242:202256	attL	CATGCTGGATAAAGA	NA	NA	NA	NA
WP_032620857.1|210670_211120_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620855.1|211112_211412_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620854.1|211404_211959_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_026094409.1|211955_212222_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620852.1|212784_213528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023323621.1|213530_213749_+	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_017692853.1|213777_214341_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_032620851.1|214679_215819_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080288371.1|215815_216877_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_032620849.1|216912_218175_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
218827:218841	attR	TCTTTATCCAGCATG	NA	NA	NA	NA
>prophage 2
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	332198	379980	5018145	protease,transposase,tRNA	Vibrio_phage(25.0%)	38	NA	NA
WP_003855994.1|332198_333203_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003855992.1|333205_334465_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_003855991.1|334521_335802_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003855990.1|335876_336188_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_023302956.1|336273_337224_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_022650252.1|337216_339061_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	2.2e-59
WP_015572465.1|339070_340408_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.3e-17
WP_003855970.1|340424_340886_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032620824.1|340878_342402_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_015572463.1|342400_343540_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_021264257.1|344728_345475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021264256.1|345594_345807_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021264255.1|345849_346725_+	ParA family protein	NA	NA	NA	NA	NA
WP_021264254.1|346708_346957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023912118.1|346949_348584_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021205172.1|348599_349160_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_022580260.1|349163_350408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021264252.1|350724_351507_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_021264251.1|351503_352031_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_021264250.1|352104_352557_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_021264249.1|352830_354843_+	DNA topoisomerase III	NA	A0A076FM50	Aureococcus_anophage	23.1	7.0e-11
WP_021264047.1|356707_357271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077946514.1|358714_359143_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001257840.1|359864_361040_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|361143_361770_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|361766_361949_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|361976_363191_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_111978112.1|363711_365241_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_050597109.1|365431_367015_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	62.8	6.9e-163
WP_032634098.1|367265_368339_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	NA	NA	NA	NA
WP_050597110.1|368335_369226_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_032634099.1|369251_370007_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB4	NA	NA	NA	NA	NA
WP_072031533.1|370086_370614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111978114.1|370841_372374_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032634100.1|373132_374347_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	30.0	7.0e-22
WP_111978116.1|374799_376338_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_023911614.1|376961_377756_+	aminoglycoside 3-N-acetyltransferase	NA	O64018	Bacillus_phage	29.9	7.8e-30
WP_111978118.1|378450_379980_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	560476	606419	5018145	portal,integrase,terminase,holin,protease,plate,tRNA,tail	Enterobacteria_phage(21.43%)	60	556007:556022	585177:585192
556007:556022	attL	CTGCACCAGCTGCGCG	NA	NA	NA	NA
WP_003860298.1|560476_561889_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	8.2e-200
WP_003860300.1|561949_562933_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017382623.1|563117_563360_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_050597113.1|563496_564534_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_032634111.1|564621_565716_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	3.1e-178
WP_032634139.1|565909_566680_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	30.3	7.3e-09
WP_032634112.1|566944_567190_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.9e-20
WP_133259045.1|567173_567440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012906750.1|567640_567820_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032634114.1|567841_568252_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	50.4	1.9e-35
WP_032634115.1|568333_568900_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032634116.1|568903_569326_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	48.6	1.0e-25
WP_082194851.1|569327_571559_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.4	7.2e-57
WP_032634117.1|571561_572113_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
WP_032634118.1|572105_573020_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	7.0e-59
WP_023299874.1|573003_573357_-	hypothetical protein	NA	E5FFH4	Burkholderia_phage	50.0	5.0e-21
WP_032634119.1|573393_574512_-	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	4.1e-37
WP_032634120.1|574514_574730_-|tail	tail protein	tail	R9TR63	Vibrio_phage	51.4	7.5e-12
WP_032634121.1|574704_575175_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.1	2.4e-15
WP_032635091.1|577376_577664_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023299868.1|577715_578222_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_032635090.1|578218_579688_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	46.8	3.7e-78
WP_032635089.1|579726_580350_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	9.4e-07
WP_032635088.1|580342_580897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059512105.1|580905_581568_-	hypothetical protein	NA	R9TR34	Vibrio_phage	34.3	7.9e-20
WP_048208474.1|581569_581926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032658106.1|581925_582261_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.7	9.9e-11
WP_111978120.1|582329_584387_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032634300.1|584379_585900_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.6e-153
585177:585192	attR	CGCGCAGCTGGTGCAG	NA	NA	NA	NA
WP_023299859.1|585908_586124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634299.1|586120_588241_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.8	8.3e-305
WP_032619489.1|588244_588748_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032634295.1|589618_590155_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.8	1.9e-80
WP_032634294.1|590151_590688_-	lysozyme	NA	K7PM52	Enterobacteria_phage	80.6	1.5e-82
WP_032634292.1|590687_590903_-|holin	holin	holin	H9C183	Pectobacterium_phage	73.9	5.0e-24
WP_032634291.1|590973_592026_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.0	2.6e-174
WP_016240136.1|592176_592368_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
WP_032634289.1|592553_593261_-	antitermination protein	NA	NA	NA	NA	NA
WP_032634287.1|593282_594350_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	2.3e-106
WP_032634284.1|594346_596074_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	59.8	1.5e-224
WP_032634317.1|596066_596957_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	79.9	7.4e-138
WP_032634282.1|596959_597823_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	79.4	2.1e-52
WP_032634280.1|597819_597999_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032634315.1|598000_598645_-	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	51.2	5.7e-47
WP_032634277.1|598874_599432_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634276.1|599475_599676_-	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634275.1|599764_600439_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_032634274.1|600607_600802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634272.1|600779_601034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154598144.1|601032_601188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634314.1|601544_601916_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	94.3	1.7e-59
WP_032634271.1|601973_602801_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	91.6	1.7e-141
WP_032634270.1|602936_603476_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.3	3.5e-74
WP_032634269.1|603463_603661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109923596.1|603657_603954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634267.1|604184_604493_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	88.0	3.0e-14
WP_032634265.1|604494_605064_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.5	2.1e-77
WP_032634264.1|605102_605375_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	87.6	3.4e-38
WP_032634262.1|605409_605871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634261.1|605876_606419_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	27.8	6.3e-07
>prophage 4
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	830539	839113	5018145	integrase	Enterobacteria_phage(100.0%)	10	815803:815816	832489:832502
815803:815816	attL	TATTTCTTTGTGAA	NA	NA	NA	NA
WP_032634248.1|830539_831715_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.4	2.7e-204
WP_032634246.1|831720_833097_+	hypothetical protein	NA	NA	NA	NA	NA
832489:832502	attR	TTCACAAAGAAATA	NA	NA	NA	NA
WP_032634244.1|833309_833873_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_032634242.1|833901_834120_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	66.7	5.1e-16
WP_032634239.1|834122_834866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634237.1|835403_835670_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.9	1.4e-31
WP_032634234.1|835666_836224_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.0	2.2e-31
WP_032634233.1|836220_836448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634232.1|836444_836765_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032634231.1|836779_839113_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.1	0.0e+00
>prophage 5
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	1247875	1275186	5018145	transposase	uncultured_virus(25.0%)	22	NA	NA
WP_020833813.1|1247875_1248718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351431.1|1248704_1250828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049182.1|1250827_1252276_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_024143025.1|1252317_1253874_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262426.1|1253885_1254812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097217.1|1255174_1255474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118028.1|1256036_1257863_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000694954.1|1258029_1258380_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	2.1e-19
WP_013087110.1|1258461_1259430_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
WP_000790483.1|1259589_1260021_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555738.1|1260270_1261746_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_000697969.1|1261738_1262419_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000475511.1|1262608_1263994_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|1264021_1264375_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|1264488_1265781_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_032620969.1|1265791_1268938_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758228.1|1269024_1269465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620970.1|1269591_1272039_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
WP_000843494.1|1272079_1272277_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|1272310_1273048_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001067855.1|1273316_1274021_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032620177.1|1274205_1275186_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	4.0e-185
>prophage 6
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	1678897	1721738	5018145	head,portal,integrase,lysis,terminase,capsid,plate,tRNA,tail	Salmonella_phage(76.74%)	53	1673422:1673441	1728756:1728775
1673422:1673441	attL	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
WP_032618958.1|1678897_1680457_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
WP_017382401.1|1680453_1680948_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017692642.1|1681093_1681858_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017692643.1|1681858_1683028_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032610576.1|1683405_1684419_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_087920841.1|1684428_1685334_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032610574.1|1685339_1685954_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.2e-38
WP_015386350.1|1686055_1686292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|1686326_1686836_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|1686843_1687044_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_032610572.1|1687007_1687349_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
WP_001744223.1|1687416_1687650_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_032634595.1|1687649_1687877_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.9e-35
WP_032634592.1|1687873_1688731_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	74.0	4.1e-117
WP_032634589.1|1688727_1691121_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.1	0.0e+00
WP_032610566.1|1691282_1691471_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	91.9	5.7e-24
WP_001217561.1|1691483_1691717_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_154818865.1|1691894_1692101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634586.1|1692188_1693238_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	4.2e-156
WP_017382378.1|1693237_1695001_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_032634584.1|1695150_1695978_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	64.6	2.7e-73
WP_014884904.1|1695993_1697142_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_006777754.1|1697145_1697799_+|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_014884903.1|1697897_1698365_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|1698364_1698568_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884902.1|1698571_1698787_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_014884901.1|1698767_1699283_+	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
WP_014884900.1|1699279_1699708_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.0	4.0e-57
WP_014884898.1|1699803_1700235_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_014884897.1|1700227_1700674_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_032634579.1|1700742_1701321_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	2.4e-105
WP_014884895.1|1701317_1701677_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
WP_014884894.1|1701663_1702572_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	6.1e-148
WP_014884893.1|1702564_1703170_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
WP_032634577.1|1703166_1704573_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	74.0	3.5e-142
WP_124304495.1|1704650_1704938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634171.1|1705374_1705848_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	3.3e-52
WP_133259046.1|1705943_1706384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634575.1|1706407_1706995_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	6.2e-85
WP_015386375.1|1707053_1707806_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	51.1	1.1e-62
WP_032634572.1|1707886_1709059_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
WP_007848874.1|1709068_1709584_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_014884889.1|1709638_1709941_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
WP_007848878.1|1709955_1710075_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_032634569.1|1710067_1713601_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	68.4	0.0e+00
WP_017384021.1|1713600_1714086_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	95.3	1.1e-63
WP_032634567.1|1714082_1715183_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.3	1.1e-183
WP_042863286.1|1715252_1715471_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	73.6	3.2e-26
WP_017384024.1|1715807_1716314_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015571912.1|1716414_1718259_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032634565.1|1718411_1720157_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|1720272_1720488_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015571911.1|1720724_1721738_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
1728756:1728775	attR	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
>prophage 7
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	2327307	2371855	5018145	holin,tail,terminase,integrase	Salmonella_phage(37.25%)	54	2319498:2319513	2354338:2354353
2319498:2319513	attL	TGACGGCAAACTGCTG	NA	NA	NA	NA
WP_003860601.1|2327307_2328774_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
WP_006811514.1|2328841_2330419_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032634917.1|2330611_2331865_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	80.4	3.6e-191
WP_032634918.1|2331861_2332413_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.3	2.6e-53
WP_032634919.1|2332409_2333096_-	hypothetical protein	NA	R9VWB9	Serratia_phage	63.7	9.8e-82
WP_032634920.1|2333092_2333251_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_032634921.1|2333243_2333540_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.1e-33
WP_032634922.1|2333649_2333898_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	79.3	1.2e-32
WP_032634923.1|2333949_2334969_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	97.6	4.6e-184
WP_032634924.1|2334978_2335878_-	endonuclease	NA	Q858E0	Salmonella_phage	94.6	1.6e-161
WP_032634926.1|2335874_2336174_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_162843058.1|2336170_2336320_-	hypothetical protein	NA	T1SA20	Salmonella_phage	63.8	3.3e-11
WP_032634927.1|2336471_2337062_-	transcriptional regulator	NA	G9L6A6	Escherichia_phage	75.5	1.8e-79
WP_032634928.1|2337216_2337447_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	84.0	1.5e-31
WP_032634929.1|2337595_2337805_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.2	2.3e-26
WP_032634930.1|2337804_2338572_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	93.7	1.1e-142
WP_032634931.1|2338568_2339354_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	1.3e-133
WP_032634933.1|2339471_2339825_+	hypothetical protein	NA	T1SA23	Salmonella_phage	74.1	3.3e-41
WP_032634935.1|2340490_2341168_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	33.6	1.3e-06
WP_032634936.1|2341277_2341664_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	93.8	2.1e-33
WP_163375019.1|2341666_2341843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050597125.1|2341853_2342438_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	62.0	3.0e-39
WP_032634937.1|2342437_2342743_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	69.3	1.7e-33
WP_032634938.1|2342732_2342999_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	82.5	2.4e-20
WP_032634939.1|2342986_2343166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634940.1|2343158_2343497_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.4	1.9e-46
WP_032634941.1|2343574_2343904_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	64.3	2.5e-30
WP_032634942.1|2343963_2344548_+|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	88.4	1.5e-86
WP_032634943.1|2344544_2346020_+	hypothetical protein	NA	Q858H3	Salmonella_phage	90.8	1.3e-272
WP_050597126.1|2346063_2346321_-	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	43.4	6.0e-08
WP_032634944.1|2347140_2347347_+	hypothetical protein	NA	T1SA67	Salmonella_phage	95.6	1.6e-08
WP_032634945.1|2347361_2349032_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	94.8	2.8e-303
WP_032634946.1|2349028_2349325_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	90.8	9.2e-45
WP_032634947.1|2349327_2350032_+	peptidase	NA	G9L6C4	Escherichia_phage	82.9	5.6e-72
WP_032634948.1|2350049_2351036_+	phage protein	NA	G9L6C5	Escherichia_phage	85.7	4.8e-162
WP_032634949.1|2351087_2351528_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	1.8e-65
WP_032634950.1|2351532_2351898_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.6	2.2e-35
WP_032634951.1|2351949_2352273_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	86.9	3.3e-48
WP_032634952.1|2352272_2352878_+	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	86.1	2.4e-100
WP_032634953.1|2352877_2355343_+	hypothetical protein	NA	Q858G3	Salmonella_phage	92.6	0.0e+00
2354338:2354353	attR	TGACGGCAAACTGCTG	NA	NA	NA	NA
WP_032634954.1|2355342_2355807_+	hypothetical protein	NA	T1SA73	Salmonella_phage	88.3	2.6e-78
WP_032634955.1|2355806_2356346_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	73.3	4.4e-61
WP_032634956.1|2356358_2358887_+	bacteriophage protein	NA	Q858G0	Salmonella_phage	94.4	0.0e+00
WP_032634957.1|2358886_2360776_+	hypothetical protein	NA	Q858F9	Salmonella_phage	91.0	0.0e+00
WP_032634958.1|2360775_2363532_+	hypothetical protein	NA	Q858F8	Salmonella_phage	97.2	0.0e+00
WP_032634960.1|2363755_2364016_-	hypothetical protein	NA	T1SA06	Salmonella_phage	80.2	9.9e-35
WP_072031552.1|2366694_2368110_-	hypothetical protein	NA	A0A0N7CG72	Salmonella_phage	28.7	1.1e-13
WP_032634963.1|2368113_2369028_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	92.4	2.4e-160
WP_032634964.1|2369024_2369387_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	4.4e-49
WP_032634965.1|2369540_2369945_+	membrane protein	NA	T1SA79	Salmonella_phage	83.6	1.3e-54
WP_032634966.1|2369931_2370219_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	63.7	3.4e-28
WP_032634967.1|2370208_2370838_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	82.8	5.8e-97
WP_032634968.1|2370834_2371365_+	DUF2514 family protein	NA	A0A193GYI0	Enterobacter_phage	78.5	5.9e-58
WP_032634969.1|2371348_2371855_+	HNH endonuclease	NA	A0A291AXF2	Shigella_phage	48.4	1.8e-35
>prophage 8
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	2459964	2560153	5018145	head,portal,integrase,terminase,holin,capsid,protease,tRNA,tail	Enterobacterial_phage(23.21%)	104	2451385:2451400	2502064:2502079
2451385:2451400	attL	CACTGTTGCAGTTCTT	NA	NA	NA	NA
WP_015572231.1|2459964_2461380_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023295106.1|2461431_2461797_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015572232.1|2461819_2462182_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032634977.1|2462804_2464994_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006811440.1|2465040_2466228_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_017383466.1|2466573_2467812_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_015572233.1|2467845_2468193_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023304172.1|2468319_2469318_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_023304171.1|2469504_2471163_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_032619299.1|2471163_2472399_-	ion channel protein	NA	NA	NA	NA	NA
WP_003861352.1|2472604_2473570_+	glucokinase	NA	NA	NA	NA	NA
WP_015572237.1|2473605_2474337_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.5	1.7e-15
WP_032619300.1|2474350_2476048_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023304168.1|2476434_2477670_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099458937.1|2477728_2477800_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_160840461.1|2478159_2479131_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.7	5.1e-76
WP_023304167.1|2479348_2480728_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-15
WP_032634979.1|2481008_2482178_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	85.3	2.1e-201
WP_165298120.1|2482161_2482347_-	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	59.6	8.9e-14
WP_032634981.1|2483481_2484042_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	44.4	1.2e-05
WP_032634982.1|2484038_2484866_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	87.8	6.0e-126
WP_050597128.1|2484865_2485225_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	82.4	1.7e-45
WP_133259047.1|2486274_2486598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023315868.1|2486805_2487432_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.6e-46
WP_023315869.1|2487531_2487747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634986.1|2487769_2488324_+	hypothetical protein	NA	S5FXP0	Shigella_phage	54.1	6.4e-47
WP_032634987.1|2488487_2488673_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.4e-13
WP_032634988.1|2488656_2489610_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	97.5	2.3e-177
WP_032634989.1|2489606_2490101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634990.1|2490100_2490760_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.9	6.7e-96
WP_023293907.1|2490756_2490984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634993.1|2490980_2491301_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	70.8	1.2e-37
WP_032634995.1|2491297_2491705_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	84.3	1.9e-56
WP_023330784.1|2491775_2492570_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	61.4	1.1e-92
WP_032634997.1|2492577_2493567_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	93.9	4.7e-186
WP_032634999.1|2493579_2494158_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	9.6e-46
WP_022648767.1|2494741_2495137_+	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_032635000.1|2495123_2495405_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	92.5	5.3e-42
WP_032635002.1|2495404_2496031_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	95.2	1.4e-111
WP_032635003.1|2496038_2496314_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	90.1	2.9e-08
WP_032635005.1|2496520_2496796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635006.1|2497058_2498516_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	90.1	3.5e-270
WP_157843589.1|2498575_2499157_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	1.1e-14
WP_032635007.1|2499150_2499729_+	hypothetical protein	NA	S4TR53	Salmonella_phage	72.2	1.6e-77
WP_044703918.1|2499728_2500079_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.5e-51
WP_032619868.1|2500236_2500710_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619866.1|2500709_2502467_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
2502064:2502079	attR	AAGAACTGCAACAGTG	NA	NA	NA	NA
WP_032619865.1|2502466_2503771_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
WP_032619863.1|2503784_2504633_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_023296252.1|2504642_2505854_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619860.1|2505896_2506223_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_022648888.1|2506231_2506570_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032634447.1|2506566_2507016_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.1e-73
WP_022648886.1|2507012_2507360_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_032634444.1|2507419_2507863_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	7.8e-72
WP_001549114.1|2507871_2508255_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_111978130.1|2508977_2512469_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.8	0.0e+00
WP_006809151.1|2512471_2512810_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	4.3e-38
WP_006809150.1|2512806_2513565_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_023296258.1|2513567_2514278_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_006809148.1|2514277_2514865_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
WP_111978132.1|2514917_2518478_+|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	70.6	0.0e+00
WP_032634448.1|2518522_2518837_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	67.6	7.8e-34
WP_032634342.1|2518837_2519509_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	5.8e-87
WP_032634343.1|2519616_2519850_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032634345.1|2519908_2521207_+	hypothetical protein	NA	G8C7K5	Escherichia_phage	66.0	9.4e-150
WP_032634348.1|2521248_2521515_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	93.2	1.4e-39
WP_015570278.1|2521879_2522446_-	hydrolase	NA	NA	NA	NA	NA
WP_017384352.1|2522708_2524481_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023296808.1|2524482_2524926_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003859747.1|2524953_2525694_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859749.1|2525728_2526250_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859751.1|2526330_2526945_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859753.1|2526953_2527964_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_032619520.1|2528016_2528802_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_023296807.1|2528798_2529554_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
WP_032103662.1|2529631_2530576_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023303894.1|2530591_2531911_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	9.0e-15
WP_015570283.1|2532028_2533000_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003859767.1|2533043_2534486_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003859769.1|2534600_2535470_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859771.1|2535826_2537302_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_017384346.1|2537535_2539347_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003859774.1|2539386_2540028_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_023303893.1|2540102_2541281_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_015570286.1|2541452_2542103_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_032619522.1|2542178_2544254_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_015570288.1|2544235_2544898_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_003859783.1|2544922_2545573_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003859784.1|2545684_2545915_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_017384342.1|2546052_2546424_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_017693249.1|2546425_2547295_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003859787.1|2547311_2547650_+	YebY family protein	NA	NA	NA	NA	NA
WP_017693250.1|2547775_2547973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303891.1|2548018_2548999_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_017693252.1|2549166_2549811_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
WP_003859885.1|2549845_2550085_-	YebV family protein	NA	NA	NA	NA	NA
WP_032619523.1|2550191_2551655_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_017693254.1|2551711_2554345_-	PqiB family protein	NA	NA	NA	NA	NA
WP_020480541.1|2554313_2555597_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_006811006.1|2555729_2556227_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003859895.1|2556323_2557010_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_015570296.1|2557029_2559078_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_015570297.1|2559271_2560153_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3368689	3375161	5018145		Enterobacterial_phage(33.33%)	6	NA	NA
WP_023299884.1|3368689_3369973_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
WP_032634435.1|3370235_3370556_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.7	1.2e-26
WP_032634437.1|3370555_3370795_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	74.7	2.2e-28
WP_032634440.1|3370870_3371452_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.1	6.8e-76
WP_050597119.1|3371738_3373631_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	39.0	8.1e-118
WP_032634442.1|3373913_3375161_-	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.1	1.1e-107
>prophage 10
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3379588	3435197	5018145	coat,head,portal,integrase,lysis,terminase,capsid,protease,tRNA,tail	Enterobacteria_phage(47.73%)	67	3398557:3398572	3417392:3417407
WP_032619853.1|3379588_3380176_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_022648880.1|3380175_3380886_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619855.1|3380888_3381647_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648882.1|3381643_3381982_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032620356.1|3381984_3385287_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_032619857.1|3385344_3385686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619858.1|3385741_3386020_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3386028_3386412_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3386420_3386864_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3386923_3387271_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648887.1|3387267_3387717_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_022648888.1|3387713_3388052_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032619860.1|3388060_3388387_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_023296252.1|3388430_3389642_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619863.1|3389651_3390500_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_032619865.1|3390513_3391818_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
WP_032619866.1|3391817_3393575_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619868.1|3393574_3394048_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619870.1|3394205_3394556_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619873.1|3394555_3395146_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032635115.1|3395127_3396588_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	89.9	8.3e-272
WP_157843456.1|3396587_3396989_-	hypothetical protein	NA	A0A220NRM6	Escherichia_phage	94.0	2.3e-70
WP_032635114.1|3397302_3397764_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	76.5	4.8e-56
WP_032634767.1|3397760_3398255_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.6	7.1e-90
WP_001752682.1|3398232_3398457_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	91.9	6.8e-32
3398557:3398572	attL	AATAAAAAACCCGGCG	NA	NA	NA	NA
WP_032635112.1|3398853_3399636_-	molecular chaperone	NA	F1C595	Cronobacter_phage	76.4	2.4e-108
WP_032635111.1|3399663_3401043_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	68.1	9.0e-175
WP_032635110.1|3401039_3401921_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	3.7e-81
WP_032635109.1|3401936_3402848_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	63.3	1.6e-92
WP_032635108.1|3402844_3403141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064664.1|3403166_3403394_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032635107.1|3403505_3404195_+	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	64.8	4.6e-71
WP_032635106.1|3404385_3404598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635105.1|3404598_3405018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635104.1|3405087_3405747_+	AP2 domain-containing protein	NA	L0AQZ0	Klebsiella_phage	44.0	2.4e-45
WP_016240231.1|3405883_3406087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795057.1|3406067_3406430_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	65.5	9.6e-36
WP_032635103.1|3406426_3406648_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	63.9	3.2e-18
WP_032635102.1|3406644_3407052_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.1	1.2e-23
WP_032635101.1|3407051_3407246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635100.1|3407242_3408070_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.7	3.2e-111
WP_032635099.1|3408115_3408859_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	4.6e-133
WP_032635098.1|3408861_3409287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029591919.1|3409279_3409525_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	86.8	1.9e-35
WP_032635097.1|3409580_3410894_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	85.6	6.0e-221
WP_049133548.1|3410872_3411646_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
WP_003859737.1|3411697_3412093_+	membrane protein	NA	NA	NA	NA	NA
WP_003859735.1|3412133_3412877_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_023303898.1|3412873_3413845_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_023303899.1|3414019_3414763_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032619519.1|3414841_3415402_-	VOC family protein	NA	NA	NA	NA	NA
WP_023294934.1|3415640_3417374_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.0e-86
WP_026080697.1|3417408_3418548_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
3417392:3417407	attR	CGCCGGGTTTTTTATT	NA	NA	NA	NA
WP_017693238.1|3418552_3420136_-	MFS transporter	NA	NA	NA	NA	NA
WP_023303901.1|3420396_3420789_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_023303902.1|3420788_3422867_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006811100.1|3422859_3424008_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859718.1|3424158_3424803_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763862.1|3424813_3425203_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_014884341.1|3425220_3426270_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_017384409.1|3426266_3427133_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_017693235.1|3427152_3428754_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_023303904.1|3428798_3430466_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_017384412.1|3430551_3431514_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303905.1|3431510_3433895_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032619515.1|3433870_3434632_-	molecular chaperone	NA	NA	NA	NA	NA
WP_015570265.1|3434648_3435197_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 11
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3469619	3573760	5018145	head,portal,integrase,lysis,terminase,holin,protease,plate,tail	Cronobacter_phage(19.0%)	139	3538977:3538993	3579235:3579251
WP_012906750.1|3469619_3469799_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619507.1|3469820_3470225_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_032635096.1|3470265_3471336_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619505.1|3471412_3471991_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_050597130.1|3471990_3474168_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.7	1.5e-54
WP_032619504.1|3474170_3474722_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_032635095.1|3474714_3475629_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	46.0	2.8e-60
WP_032619502.1|3475612_3475966_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032635094.1|3476002_3477121_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	4.6e-36
WP_032620301.1|3477123_3477339_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032635093.1|3477313_3477784_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	2.9e-16
WP_032619498.1|3480027_3480315_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058671048.1|3480366_3480873_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058671049.1|3480869_3482339_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619493.1|3482377_3483001_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_023303465.1|3482993_3483548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058671051.1|3483556_3484219_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	3.2e-21
WP_023303463.1|3484220_3484577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634302.1|3484576_3484912_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_032634880.1|3484984_3487045_-|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	57.5	3.7e-201
WP_032634670.1|3487034_3488555_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.2	4.8e-153
WP_032634673.1|3488563_3488779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634676.1|3488775_3490896_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.8	6.4e-305
WP_023299857.1|3490899_3491403_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.9	3.1e-48
WP_032619488.1|3491678_3491939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619487.1|3492127_3492355_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_020690713.1|3492427_3492631_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619486.1|3492779_3493037_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_032634681.1|3493162_3493441_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	1.0e-08
WP_032634683.1|3493448_3494078_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	1.7e-101
WP_032634686.1|3494077_3494356_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.5e-36
WP_017384387.1|3494345_3494735_-	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_032634689.1|3495732_3497031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634692.1|3497223_3497568_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	2.8e-53
WP_032634695.1|3497582_3498572_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	88.4	8.1e-178
WP_032634698.1|3498568_3498958_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.4	8.9e-64
WP_032634701.1|3498954_3499278_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	76.9	4.2e-43
WP_032634704.1|3499274_3499934_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	1.5e-98
WP_032634707.1|3499933_3500428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023315872.1|3500424_3501351_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	55.2	9.9e-69
WP_072031544.1|3501313_3501520_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.5e-14
WP_032634711.1|3501760_3502231_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_032634882.1|3502256_3502454_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
WP_032634713.1|3502553_3503210_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
WP_154590105.1|3503587_3503743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634680.1|3504015_3504429_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	1.4e-54
WP_032634715.1|3504428_3505463_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	94.2	1.7e-178
WP_032634717.1|3505449_3505689_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	80.4	4.9e-12
WP_032634718.1|3505803_3506637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072031545.1|3506677_3506905_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	96.0	1.2e-36
WP_032634720.1|3506904_3507915_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	90.5	3.7e-178
WP_032634721.1|3508053_3508497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859652.1|3509237_3509786_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_017384477.1|3509842_3511675_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_017384478.1|3511671_3512328_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_003859644.1|3512792_3513017_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_017384479.1|3513081_3513804_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_003859634.1|3514027_3514780_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	2.2e-26
WP_003859632.1|3514776_3515445_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_017384480.1|3515466_3516453_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_003859627.1|3516556_3517357_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015570235.1|3517443_3517995_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_003859623.1|3518049_3518769_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_023303919.1|3518932_3520471_-	flagellin	NA	NA	NA	NA	NA
WP_023303920.1|3520740_3522153_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032619462.1|3522183_3522594_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_006811148.1|3522593_3522965_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_032619461.1|3523063_3524551_+	alpha-amylase	NA	NA	NA	NA	NA
WP_003859613.1|3524653_3525067_-	lipoprotein	NA	NA	NA	NA	NA
WP_032634723.1|3525415_3526684_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.0	4.9e-228
WP_032634725.1|3526683_3526989_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	41.7	3.5e-15
WP_072031546.1|3527417_3528407_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	26.3	2.1e-08
WP_032634728.1|3528439_3530614_-	hypothetical protein	NA	B1GS50	Salmonella_phage	63.6	9.2e-57
WP_032634730.1|3530672_3533150_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	93.2	0.0e+00
WP_032619452.1|3533136_3533502_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.9	2.1e-62
WP_032634732.1|3533515_3533986_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	87.8	8.0e-75
WP_032634734.1|3533985_3534483_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	3.9e-88
WP_032634736.1|3534482_3538004_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	55.9	1.0e-230
WP_032634738.1|3538062_3538746_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	60.6	3.0e-78
WP_032634739.1|3538805_3539549_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	81.6	5.0e-71
3538977:3538993	attL	GGTTGGTGCGATATTCA	NA	NA	NA	NA
WP_050596971.1|3539614_3540166_-	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	53.6	4.4e-48
WP_032634741.1|3540265_3540649_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	1.0e-40
WP_032634743.1|3540645_3541014_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	64.8	7.2e-39
WP_023330659.1|3541016_3541373_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	57.3	7.2e-28
WP_006820518.1|3541372_3541546_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_032634744.1|3541545_3541926_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	2.0e-28
WP_032634746.1|3541928_3542294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634748.1|3542303_3543401_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	1.0e-160
WP_006808955.1|3543411_3543846_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.5	6.9e-49
WP_032634750.1|3543849_3545253_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.0	5.6e-124
WP_165824840.1|3545319_3545904_-	HNH endonuclease	NA	M4Q138	Vibrio_phage	43.0	1.1e-33
WP_082194859.1|3546110_3547094_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	64.4	1.0e-103
WP_032634753.1|3547047_3548508_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.4	4.7e-198
WP_032634755.1|3548519_3549995_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	77.0	1.0e-229
WP_032634757.1|3550004_3550454_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.9	1.5e-54
WP_032634759.1|3550486_3551125_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.9	1.3e-115
WP_032634761.1|3551128_3551332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634763.1|3551508_3552054_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	66.1	3.0e-57
WP_032634765.1|3552405_3552867_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	75.2	2.4e-55
WP_032634767.1|3552863_3553358_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.6	7.1e-90
WP_001752682.1|3553335_3553560_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	91.9	6.8e-32
WP_032634769.1|3553851_3554352_-	antiterminator	NA	G8C7V7	Escherichia_phage	96.3	9.3e-90
WP_032634771.1|3554464_3555109_-	bacteriophage Lambda NinG protein	NA	S4TSR3	Salmonella_phage	71.0	9.6e-79
WP_032634772.1|3555101_3555272_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	89.3	5.9e-20
WP_032634774.1|3555271_3555727_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_032634776.1|3555938_3556193_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	42.1	4.2e-06
WP_032634778.1|3556192_3556393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050597123.1|3556385_3557312_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	31.4	7.2e-19
WP_023296419.1|3557308_3557719_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	88.6	4.7e-31
WP_032634780.1|3557715_3557973_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	91.8	3.3e-38
WP_032634782.1|3558391_3558688_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.6	8.7e-19
WP_032634783.1|3558687_3560121_-	AAA family ATPase	NA	Q716D2	Shigella_phage	87.5	9.8e-233
WP_032634785.1|3560110_3561010_-	hypothetical protein	NA	Q37929	Escherichia_phage	53.8	3.5e-79
WP_015571544.1|3561002_3561149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514165.1|3561238_3561805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608751.1|3561835_3562057_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_032634894.1|3562174_3562885_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	95.8	6.5e-129
WP_032634788.1|3562959_3563340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634790.1|3563381_3563591_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	81.2	2.5e-20
WP_133259049.1|3564185_3564824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634793.1|3564973_3565222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634795.1|3565218_3565377_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	88.5	1.2e-19
WP_001752704.1|3565373_3565580_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_032634797.1|3565656_3566694_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	2.0e-38
WP_032634799.1|3566701_3566986_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	89.4	1.4e-45
WP_032634801.1|3567004_3567850_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	56.9	5.3e-69
WP_032634803.1|3567846_3568527_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.1	1.2e-127
WP_032634805.1|3568523_3568952_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	94.4	2.2e-71
WP_032634807.1|3568948_3569101_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	46.2	9.6e-06
WP_032634809.1|3569097_3569757_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	5.0e-123
WP_023300422.1|3569753_3569972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619395.1|3569968_3570580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619394.1|3570576_3570768_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	61.0	1.3e-12
WP_032634811.1|3570859_3571075_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	5.0e-16
WP_050597124.1|3571074_3571530_+	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	52.9	2.9e-37
WP_032634813.1|3571492_3571732_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	4.9e-12
WP_032634815.1|3571741_3572068_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	81.9	5.0e-44
WP_032634816.1|3572173_3572419_+	excisionase family protein	NA	S4TND0	Salmonella_phage	61.2	3.6e-26
WP_032634818.1|3572464_3573760_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.9	3.9e-180
3579235:3579251	attR	TGAATATCGCACCAACC	NA	NA	NA	NA
>prophage 12
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3657195	3668008	5018145		Bodo_saltans_virus(12.5%)	9	NA	NA
WP_017693103.1|3657195_3657807_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_032619360.1|3657846_3658827_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032634833.1|3659021_3660026_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	4.3e-33
WP_032619358.1|3660075_3661242_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_017693099.1|3661480_3662362_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619357.1|3662362_3663448_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_032619355.1|3663537_3664944_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032634835.1|3665109_3666480_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619353.1|3666589_3668008_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
>prophage 13
NZ_CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3927985	3991134	5018145	head,portal,integrase,terminase,holin,capsid,protease,tRNA,tail	Enterobacterial_phage(28.3%)	77	3922333:3922347	3990512:3990526
3922333:3922347	attL	AGTCGTCCACCAGCA	NA	NA	NA	NA
WP_023295093.1|3927985_3928798_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_023304157.1|3928797_3929811_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017692991.1|3929877_3931014_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	2.3e-19
WP_023304159.1|3931125_3932130_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_032619305.1|3932215_3933394_-	MFS transporter	NA	NA	NA	NA	NA
WP_017383449.1|3933461_3934679_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023304161.1|3934837_3936835_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_017383451.1|3936893_3937172_-	YfcL family protein	NA	NA	NA	NA	NA
WP_023304162.1|3937185_3937731_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_003861386.1|3937730_3938540_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_015572248.1|3938539_3939364_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_023304163.1|3939366_3940452_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	8.5e-88
WP_023304164.1|3940512_3941445_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015572246.1|3941590_3942142_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_003861375.1|3942188_3942674_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_032634868.1|3942883_3945031_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_023304166.1|3945030_3946341_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_017692981.1|3946569_3946854_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_017383456.1|3947226_3948510_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_003861365.1|3948552_3949305_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_015572241.1|3949619_3950549_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.6	4.1e-139
WP_032634870.1|3950810_3951077_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	93.2	6.8e-39
WP_032634872.1|3951118_3952417_-	hypothetical protein	NA	G8C7K5	Escherichia_phage	66.0	2.7e-149
WP_032634343.1|3952475_3952709_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032634342.1|3952816_3953488_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	5.8e-87
WP_032634448.1|3953488_3953803_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	67.6	7.8e-34
WP_111978132.1|3953847_3957408_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	70.6	0.0e+00
WP_006809148.1|3957460_3958048_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
WP_023296258.1|3958047_3958758_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_006809150.1|3958760_3959519_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_006809151.1|3959515_3959854_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	4.3e-38
WP_111978130.1|3959856_3963348_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.8	0.0e+00
WP_032634878.1|3963394_3963730_-	membrane protein	NA	S4TR42	Salmonella_phage	94.6	3.0e-52
WP_006809154.1|3963785_3964064_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_001549114.1|3964072_3964456_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_032634444.1|3964464_3964908_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	7.8e-72
WP_022648886.1|3964967_3965315_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_032634447.1|3965311_3965761_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.1e-73
WP_022648888.1|3965757_3966096_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032619860.1|3966104_3966431_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_023296252.1|3966473_3967685_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619863.1|3967694_3968543_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_032619865.1|3968556_3969861_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
WP_032619866.1|3969860_3971618_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619868.1|3971617_3972091_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619870.1|3972248_3972599_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619873.1|3972598_3973189_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619877.1|3973170_3974628_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619880.1|3974714_3974975_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_047715785.1|3975223_3975418_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619884.1|3975368_3975644_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_032619887.1|3975640_3976183_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_000220248.1|3976179_3976461_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032264642.1|3976457_3976862_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619892.1|3977089_3977893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619895.1|3977929_3978292_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619897.1|3978306_3979296_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_050595702.1|3979292_3980018_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619898.1|3980033_3980423_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_032619899.1|3980419_3980743_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619900.1|3980739_3981399_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619901.1|3981398_3981893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634002.1|3981889_3982768_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619902.1|3982757_3982937_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_023315870.1|3983100_3983655_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_071842884.1|3983683_3983935_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_032619903.1|3983969_3984722_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_032619905.1|3984769_3985204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620359.1|3985303_3985513_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032103842.1|3985540_3985750_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620361.1|3986469_3986883_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032619906.1|3986882_3987710_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620364.1|3988307_3988652_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619908.1|3988731_3989001_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_022650818.1|3989033_3989297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619909.1|3989271_3990414_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_015570783.1|3990633_3991134_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
3990512:3990526	attR	AGTCGTCCACCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	6742	52221	152715	protease,integrase,transposase	Escherichia_phage(26.32%)	50	4462:4475	49826:49839
4462:4475	attL	GCCCTGGTGAACAG	NA	NA	NA	NA
WP_025760373.1|6742_7453_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.5	2.2e-15
WP_032635065.1|7611_7866_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	48.8	1.5e-11
WP_000143805.1|7855_8146_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.1	3.0e-24
WP_001067858.1|8318_9023_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004896925.1|9907_10450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|10808_11693_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|11748_13224_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|13622_14807_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|14855_15041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|15260_15542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|15522_16296_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|17694_19236_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|19640_20480_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|20473_20821_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_004201164.1|21038_21851_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|21854_22220_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|22224_22863_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_000050481.1|23778_25320_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|25724_26564_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|26557_26905_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|27068_27860_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|27865_28111_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|28267_28765_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|28909_29923_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|30038_30743_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|30975_31836_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|31848_32391_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|32872_33064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|33087_33315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|33365_34502_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|34468_34618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|34616_35987_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|36128_36254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|36807_37668_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_160458683.1|38805_38931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160458682.1|38923_40411_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
WP_000776034.1|40816_41248_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|41247_42519_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|42600_43575_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|43574_44780_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_111978107.1|45194_45464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|45819_46686_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|47220_47325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|47453_47711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049245386.1|47768_48545_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_023280892.1|48547_49231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946795.1|49388_49694_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_004197642.1|49695_49914_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
49826:49839	attR	CTGTTCACCAGGGC	NA	NA	NA	NA
WP_009654315.1|50482_51064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635019.1|51219_52221_+|protease	CAAX amino protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	62091	106761	152715	transposase	Escherichia_phage(27.78%)	40	NA	NA
WP_032635071.1|62091_63087_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	2.0e-19
WP_032635023.1|63220_65359_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032635024.1|65355_67140_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.8	9.6e-20
WP_074173284.1|67280_67577_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	41.6	2.9e-06
WP_001067855.1|67629_68334_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|70655_70988_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|71034_71910_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_072031555.1|72165_72384_-	hypothetical protein	NA	A0A1B0VDR3	Salmonella_phage	100.0	1.4e-18
WP_001067855.1|72374_73079_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|73710_74541_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|74671_75226_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|75369_76074_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012783960.1|76064_77654_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_032635028.1|78248_78500_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_020323529.1|78733_78811_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_087758039.1|78791_79667_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_154816811.1|80525_80672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072916.1|80810_81659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072917.1|81718_82003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072918.1|82091_82385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635033.1|82507_82990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045265539.1|83016_83598_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032635034.1|84041_84599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635035.1|84726_85599_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_032635036.1|85595_86246_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	29.9	3.1e-08
WP_074177407.1|86653_88057_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.6	6.2e-107
WP_154816812.1|88091_89306_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	41.9	4.7e-34
WP_032635040.1|89655_90213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635041.1|90215_90803_-	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032635042.1|91036_92314_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_032635075.1|92377_94375_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_032635043.1|94664_95261_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_032635044.1|96066_96666_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001067858.1|96927_97632_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|99404_100109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001217881.1|101849_102407_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|102640_103195_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|103264_104053_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|104112_104937_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_004099053.1|105792_106761_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 1
NZ_CP030350	Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence	106698	54093	61115	106698	integrase	Escherichia_phage(33.33%)	10	49607:49620	70390:70403
49607:49620	attL	TGCCGCATCGAGGG	NA	NA	NA	NA
WP_022650030.1|54093_54786_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
WP_022650031.1|55182_55650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080332517.1|55627_55885_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_022650032.1|56015_56444_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
WP_022650033.1|56443_57715_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
WP_022650034.1|57718_58108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650035.1|58112_59084_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
WP_022650036.1|59320_59959_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
WP_022650037.1|59958_60237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650038.1|60335_61115_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
70390:70403	attR	TGCCGCATCGAGGG	NA	NA	NA	NA
