The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	619066	690201	4989783	integrase,transposase,protease,tRNA,tail,plate,capsid	Burkholderia_virus(34.62%)	79	675799:675814	695120:695135
WP_000520781.1|619066_619387_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|619417_621694_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|622378_622597_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|622881_623586_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|623627_625349_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001043561.1|625349_627116_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|627238_628204_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|628747_629242_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|629376_633483_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|633641_634253_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|634263_635607_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|635697_636990_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|637228_639673_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|639683_640301_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|640302_641166_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|641201_641828_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|642141_643290_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|643386_644127_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|644318_646601_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|646655_647513_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|647918_649679_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|649808_650501_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|650699_651788_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|651858_653142_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|653397_653970_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_023142129.1|654041_654503_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|654509_655124_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001486917.1|655123_655606_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_023363137.1|655646_656894_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|656896_657475_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|657467_658571_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|658561_658909_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|658963_659560_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|659556_660711_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|660698_660914_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|660910_661795_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|661794_664746_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|664821_664980_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|664903_665239_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|665336_665618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|665620_666142_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|666141_667569_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|667558_667813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|667809_668274_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|668273_668720_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|668721_669060_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|669069_670023_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|670037_671153_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|671367_671826_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|671828_672650_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|672630_674127_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|674126_675659_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|675718_676264_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
675799:675814	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|676263_676575_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|676574_676901_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|676897_677548_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|677531_678272_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|678274_678625_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|678755_679484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|679459_679864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|679862_680078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|680268_681033_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|681149_681506_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|681599_681788_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|681840_682149_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|682159_683080_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|683079_683397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|683412_685182_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|685192_686359_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|686361_686631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|686658_687189_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|687477_687750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|687759_688056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|688070_688286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|688282_688966_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|688962_689193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|689182_689389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|689390_689840_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|689811_690201_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
695120:695135	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1038518	1109486	4989783	integrase,transposase,terminase,protease,head,holin,tail,portal,capsid	Stx2-converting_phage(24.56%)	79	1034692:1034706	1040602:1040616
1034692:1034706	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1038518_1039649_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1039626_1039875_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1039939_1042411_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1040602:1040616	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1042503_1042695_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1042691_1042880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1043445_1043664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1043823_1043979_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_112032763.1|1044251_1044968_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	7.7e-53
WP_000471549.1|1045017_1045233_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1045229_1045655_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1045677_1046640_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1046646_1047393_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1047414_1048185_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1048200_1048626_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1048800_1049466_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1049646_1049859_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1050026_1050299_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1050300_1051356_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1051356_1051737_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1051733_1052555_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1052781_1052979_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1053130_1054180_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1054981_1055113_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1055393_1055729_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1055989_1057843_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1057993_1058209_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1058213_1058558_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1058523_1058796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|1058897_1060044_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000992071.1|1060154_1060688_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1061242_1061329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1061550_1061736_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1061821_1062037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1062235_1062436_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1062477_1062843_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1063133_1063697_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1063693_1065355_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1065418_1067356_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1067400_1067622_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1067567_1070153_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1070149_1070476_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1070485_1070836_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1070832_1071279_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1071275_1071620_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1071686_1072403_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1072417_1072792_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1072887_1073097_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|1073144_1076387_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|1076379_1076721_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1076720_1077419_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1077429_1078173_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1078118_1078751_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1079093_1082567_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1083207_1084749_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1084763_1085510_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|1085971_1088797_+|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|1088798_1089332_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1089362_1089890_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_112032764.1|1089905_1090874_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	2.9e-47
WP_001421220.1|1090999_1091182_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1091380_1092049_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1092105_1092375_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|1092786_1093344_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1093340_1093616_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1093991_1094798_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1094797_1095991_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1096002_1097361_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1097364_1098960_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1098959_1100522_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1100613_1100658_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1100795_1101677_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1101673_1102294_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1102321_1104217_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1104429_1105305_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|1105510_1106497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1106506_1106815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1106871_1107462_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1107458_1108217_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1108436_1109486_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1601433	1690456	4989783	integrase,transposase,terminase,tRNA,tail,holin,portal,plate,capsid	Escherichia_phage(22.73%)	102	1647130:1647189	1690518:1690642
WP_099156422.1|1601433_1602782_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|1602891_1603902_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1603910_1604522_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1604660_1604726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|1604796_1605399_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1605400_1605922_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1605956_1606697_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1606725_1607178_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|1607170_1608943_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1609252_1609819_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1609815_1610634_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1610686_1611082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1611122_1611866_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|1611862_1612834_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1612869_1615299_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1615323_1616424_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1616811_1617558_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1617571_1618138_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1618353_1620087_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1620139_1620532_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1620531_1622610_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1622602_1623751_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|1623939_1624584_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1624594_1624984_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1624998_1626048_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1626050_1626911_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1627201_1628863_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1629007_1629511_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1629531_1631496_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1631500_1632427_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1632423_1633311_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1633437_1634016_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1634018_1634369_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1635148_1635577_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|1635583_1637008_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|1636982_1637783_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|1637949_1638939_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|1638950_1640465_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|1640534_1641524_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1642318_1642822_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1642899_1643151_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1643265_1643352_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1643615_1643939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1644110_1644608_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1644645_1644885_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1645075_1646287_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1646337_1647003_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1647130:1647189	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1647474_1647894_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1649108_1649333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1649494_1649884_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1649919_1651560_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1651668_1651950_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1651962_1652475_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|1652492_1653995_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1653991_1654381_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1654380_1655565_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1655557_1656184_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1656186_1657107_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1657103_1657445_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1657447_1658350_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1658330_1658867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1658863_1659544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1659575_1659956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1659952_1660372_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1660406_1661441_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1661499_1661829_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1661828_1663136_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1663135_1664710_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1664706_1664940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1664939_1666802_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1666788_1667355_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1667723_1667969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1668028_1668223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1668230_1668710_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1668709_1668982_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1668981_1669365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1669477_1670149_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1670148_1670442_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1670438_1671035_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1671112_1671292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1671443_1672085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1672328_1672562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1672960_1673449_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536231.1|1675302_1676001_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1677189_1678113_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1678287_1679076_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|1679757_1679982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1679978_1680290_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1680286_1680523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1680524_1680935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1680973_1682389_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1682378_1683134_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1683130_1683355_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1683394_1683871_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1683929_1684160_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1684258_1684672_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1685682_1686003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1686033_1688250_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1688246_1688816_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1688815_1688998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1689207_1689471_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1689439_1690456_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1690518:1690642	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1708700	1786694	4989783	integrase,transposase,protease,terminase,head,tail,holin,portal,capsid	Escherichia_phage(38.18%)	98	1765778:1765792	1787383:1787397
WP_001347174.1|1708700_1709225_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|1709381_1710179_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1710188_1710740_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1710908_1711241_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1711584_1711899_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|1712113_1713772_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1713764_1714760_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|1714752_1715439_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|1715438_1716812_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1716830_1717274_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|1717270_1718398_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|1718502_1718967_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1718971_1719976_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1719972_1720386_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1720388_1720754_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1720753_1721491_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1721500_1721770_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1721778_1722564_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|1722853_1723477_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1723520_1723763_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1723871_1724099_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|1724394_1725210_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|1725206_1726901_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1727071_1727254_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1727332_1728250_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1728422_1729343_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1729331_1729802_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|1729782_1731201_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|1731267_1731963_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1732002_1732368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|1732933_1734049_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|1734641_1735493_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1735600_1736959_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|1736958_1737630_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|1737762_1738176_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|1738284_1739289_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|1739289_1739925_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|1740008_1741357_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|1741617_1742268_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_016240857.1|1743348_1743636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|1743645_1743924_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_054575809.1|1743920_1745984_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_021571591.1|1746135_1746735_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
WP_112032766.1|1746802_1750501_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.7	0.0e+00
WP_001445893.1|1750561_1751209_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_000194743.1|1751106_1751850_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152453.1|1751854_1752553_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_072189217.1|1752552_1752909_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	3.7e-40
WP_032180049.1|1752886_1756114_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_077628067.1|1756160_1756421_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|1756462_1756849_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097524.1|1756848_1757553_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001206306.1|1757612_1757957_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|1757953_1758403_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|1758399_1758738_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|1758746_1759064_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_000766109.1|1759140_1760358_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|1760372_1760972_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|1760964_1762191_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_001140892.1|1762338_1764096_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|1764095_1764578_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001111090.1|1764725_1765076_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|1765214_1765754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|1765759_1766026_-	hypothetical protein	NA	NA	NA	NA	NA
1765778:1765792	attL	CGCCTTATTATGCTC	NA	NA	NA	NA
WP_001228685.1|1766243_1766429_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_016245373.1|1766645_1767179_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000193280.1|1767242_1767593_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|1767597_1767813_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064894.1|1768608_1769298_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000140004.1|1769294_1769660_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_024188444.1|1769660_1770716_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_024175747.1|1770717_1770996_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|1771292_1771685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1771828_1772041_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000206826.1|1772274_1772619_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|1772615_1772783_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224227.1|1772793_1773057_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000206712.1|1773058_1773499_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
WP_001514293.1|1773500_1773860_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
WP_021539545.1|1774025_1774208_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	6.9e-27
WP_072189218.1|1774301_1774700_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	5.7e-58
WP_001514296.1|1774659_1775196_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
WP_001514297.1|1775188_1775488_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	5.6e-50
WP_001514298.1|1775484_1775907_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	4.7e-66
WP_001514299.1|1775947_1777018_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693853.1|1777089_1777515_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|1777511_1777739_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|1777838_1778483_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_053881715.1|1778760_1778916_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|1779075_1779294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|1779297_1779462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|1779862_1780051_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|1780047_1780239_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001544673.1|1780332_1782774_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	9.2e-114
WP_000096344.1|1782832_1783036_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|1783035_1784061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001311896.1|1784296_1785094_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|1785431_1786694_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
1787383:1787397	attR	CGCCTTATTATGCTC	NA	NA	NA	NA
>prophage 5
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	1856122	1889880	4989783	transposase	Escherichia_phage(16.67%)	38	NA	NA
WP_001296203.1|1856122_1857319_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|1857442_1857721_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|1857814_1858417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|1859442_1860135_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|1860134_1861157_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|1861302_1861482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001296206.1|1862681_1863827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|1864357_1864615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|1864668_1865436_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|1865432_1866491_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|1866509_1867499_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|1867509_1869675_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|1870103_1870538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|1870755_1873140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|1873136_1874042_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|1874038_1875109_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|1875244_1875658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|1875772_1877314_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1877328_1878075_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|1878523_1878934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1879154_1879973_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1879972_1880218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1880311_1880785_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1880800_1881277_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1881339_1881561_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1881579_1882224_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|1882239_1882608_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|1882696_1883071_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|1883067_1883262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1883274_1883388_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032082634.1|1883676_1883850_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.2	1.1e-10
WP_001296208.1|1883876_1884059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|1884159_1884489_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|1884660_1885719_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|1885916_1886390_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|1886508_1887675_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|1887883_1889311_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|1889421_1889880_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 6
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2014111	2023556	4989783		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2014111_2015248_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2015244_2017248_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2017372_2017834_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2017874_2018345_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2018391_2019111_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2019107_2020793_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2021014_2021746_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2021805_2021913_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2021893_2022625_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2022629_2023556_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 7
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2538033	2544856	4989783		Enterobacteria_phage(100.0%)	9	NA	NA
WP_001430678.1|2538033_2538606_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
WP_000638629.1|2538679_2539180_-	transactivation protein	NA	NA	NA	NA	NA
WP_001569120.1|2539176_2539911_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	6.7e-129
WP_001149160.1|2540461_2540728_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_112032769.1|2540724_2541324_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.5e-49
WP_001356942.1|2541316_2541604_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	4.3e-47
WP_001356941.1|2541596_2542052_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001356940.1|2542187_2542508_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_112032770.1|2542522_2544856_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
>prophage 8
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2613980	2621120	4989783		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2613980_2616542_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2616647_2617304_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|2617354_2618152_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|2618317_2619226_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2619222_2620485_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2620481_2621120_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	2871642	2930236	4989783	integrase,transposase,protease,tRNA	Staphylococcus_phage(33.33%)	52	2872851:2872868	2929633:2929650
WP_001296354.1|2871642_2872401_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|2872830_2873751_-	agmatinase	NA	NA	NA	NA	NA
2872851:2872868	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|2873886_2874618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2874763_2876740_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2876748_2876880_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|2877015_2877231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2877534_2878689_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2879124_2880519_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|2880595_2881093_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2881187_2881895_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2881974_2882706_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|2882718_2883669_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|2883705_2884341_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2884340_2884757_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|2884871_2885852_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2885869_2886574_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2886591_2887158_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|2887154_2887445_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|2887452_2888046_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|2888038_2889175_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|2889489_2890476_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|2890520_2891024_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|2891023_2892325_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|2892380_2893388_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|2893504_2894551_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2894726_2895446_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|2895466_2895607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|2895629_2895956_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2895955_2896675_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|2896835_2897888_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2897915_2898191_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_053889675.1|2898255_2899335_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|2899536_2900793_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|2900841_2902977_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2903369_2904077_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2904455_2905721_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|2905976_2907020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296368.1|2908272_2908494_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_023146305.1|2908960_2909176_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|2909144_2910271_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|2910361_2910475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|2912308_2912569_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|2912610_2913171_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2913210_2913639_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|2914356_2915550_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|2915685_2917410_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|2917410_2918358_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|2918357_2920100_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2920096_2921374_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|2921455_2923657_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|2924600_2928488_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|2929084_2930236_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2929633:2929650	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 10
NZ_CP030337	Escherichia coli strain AR_451 chromosome, complete genome	4989783	4004572	4082240	4989783	integrase,terminase,protease,head,tRNA,tail,holin,portal,lysis,plate,capsid	Escherichia_phage(44.19%)	88	4034421:4034467	4066261:4066307
WP_000560981.1|4004572_4005010_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4005054_4005996_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|4006059_4006968_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|4007196_4007508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4007508_4007799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|4008157_4008436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|4008832_4009051_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|4009235_4009685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112032776.1|4010000_4010816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|4011914_4012157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|4012338_4013268_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4013264_4013900_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|4013896_4014799_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|4014811_4017862_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4018055_4018889_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|4019884_4021279_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|4021319_4021634_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|4021643_4022468_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|4022734_4023994_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|4023990_4025460_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|4025747_4026584_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|4026567_4027506_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4027502_4028537_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|4028821_4029442_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|4029701_4030685_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|4030833_4031508_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4031678_4033052_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|4033048_4033747_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4033896_4034397_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4034421:4034467	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985249.1|4034582_4035563_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001017512.1|4035632_4035926_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4036061_4036334_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217670.1|4036503_4037004_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4037067_4037292_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_032246799.1|4037291_4037594_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	3.8e-46
WP_001113264.1|4037593_4037818_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4037814_4038090_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_112032777.1|4038079_4040347_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_063267205.1|4040430_4041753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|4042082_4043117_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156845.1|4043116_4044889_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|4045062_4045917_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001661061.1|4045975_4047049_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
WP_063267206.1|4047052_4047796_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	7.8e-125
WP_000988633.1|4047895_4048405_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4048404_4048608_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4048611_4048893_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_006778002.1|4048892_4049390_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_021565817.1|4049404_4049830_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
WP_021565816.1|4049817_4050243_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	4.0e-65
WP_001300730.1|4050214_4050388_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917151.1|4050350_4050818_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001780.1|4050810_4051263_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_039022208.1|4051329_4051965_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
WP_069906210.1|4051961_4052309_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001543006.1|4052313_4053222_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	4.4e-162
WP_001285323.1|4053214_4053745_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001599800.1|4053755_4056374_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
WP_001516655.1|4056373_4056952_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_001599801.1|4057280_4058360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908562.1|4058548_4058716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286716.1|4058794_4059985_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4059997_4060516_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4060572_4060848_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4060880_4061000_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_078207294.1|4060992_4063440_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000978916.1|4063454_4063934_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_078207361.1|4063933_4065097_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.5	1.4e-205
WP_000468308.1|4065177_4065396_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|4065665_4066178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076748.1|4066385_4067288_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4066261:4066307	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4067468_4068431_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|4068750_4069740_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|4069846_4070602_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4070656_4071424_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|4071531_4072131_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|4072231_4072672_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4072883_4073183_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4073209_4073638_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|4073642_4074389_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4074485_4075496_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|4075666_4077175_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4077197_4078043_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4078467_4078713_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4078797_4079283_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4079375_4080302_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4080368_4081700_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4081709_4082240_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP030335	Escherichia coli strain AR_451 plasmid unnamed1, complete sequence	75281	20879	59216	75281	protease,transposase,integrase	Burkholderia_phage(20.0%)	37	20146:20163	27330:27347
20146:20163	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_001288432.1|20879_22313_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|22346_23561_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|23821_24586_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|24728_24995_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|25215_25689_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|25844_26858_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|27250_27820_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
27330:27347	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001749982.1|29776_30496_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_000057569.1|31055_31397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|31411_32203_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_001749980.1|32353_33619_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_000861760.1|33606_34047_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_000447669.1|34461_34887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|34944_35349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|35358_35598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|36483_36780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|36776_37136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750002.1|37204_37489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561126.1|37697_38030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|39382_39892_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000214483.1|40617_40797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|40851_41172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|41282_41516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414913.1|41808_42177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|42178_42895_-	StdB	NA	NA	NA	NA	NA
WP_020319858.1|42903_43041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749975.1|43813_44230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342688.1|44231_45761_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012561166.1|45760_48997_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_014839878.1|49370_50762_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|50798_51371_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|51507_52098_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|52532_53147_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|53465_54122_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|54626_55331_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|55618_56224_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206881.1|56318_59216_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
