The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1049739	1056879	4818472		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1049739_1050378_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|1050374_1051637_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|1051633_1052542_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1052707_1053505_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|1053555_1054212_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|1054317_1056879_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 2
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1750241	1758649	4818472		Enterobacteria_phage(33.33%)	8	NA	NA
WP_073470701.1|1750241_1751636_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.4e-18
WP_000183060.1|1751810_1752704_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699439.1|1753075_1754161_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.1e-102
WP_001023643.1|1754160_1755060_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	1.1e-27
WP_045172220.1|1755117_1755993_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
WP_045172218.1|1755996_1757055_+	O54 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_077780088.1|1757078_1757876_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_072020849.1|1757830_1758649_+	DUF616 domain-containing protein	NA	A0A2P0VMU2	Tetraselmis_virus	33.9	6.8e-29
>prophage 3
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	2242855	2310005	4818472	head,terminase,integrase,portal,tail,lysis,protease,capsid	Enterobacteria_phage(46.0%)	75	2239954:2239968	2291065:2291079
2239954:2239968	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|2242855_2243677_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2243776_2243860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|2243952_2244288_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|2244684_2245938_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2246044_2246938_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2247072_2248293_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2248417_2249113_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2249065_2250358_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2250516_2251131_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2251173_2252028_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2252029_2252647_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2252657_2255081_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|2255141_2257568_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|2257766_2258072_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2258179_2258890_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2258892_2259453_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2259487_2259829_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2259963_2260290_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001370501.1|2260495_2261710_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2261721_2262741_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|2262798_2262927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2262928_2264209_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|2264243_2264480_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001083273.1|2267131_2267323_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001331023.1|2267319_2267508_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|2267908_2268061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|2268047_2268263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2268422_2268578_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|2268843_2269263_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|2269363_2269645_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|2269628_2270054_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|2270125_2271196_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|2271236_2271659_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|2271999_2273997_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625668.1|2274060_2275338_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|2275468_2276350_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|2276346_2277039_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|2277050_2278250_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|2278761_2278869_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|2278913_2279126_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|2279293_2279572_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|2279573_2280623_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|2280635_2281010_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|2281006_2281828_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|2282728_2282860_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|2283226_2283655_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2283826_2284201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2284452_2284668_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|2284667_2285165_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|2285381_2285564_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2285654_2285948_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|2286310_2286505_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_000453566.1|2286893_2287439_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001609942.1|2287413_2289339_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198150.1|2289335_2289542_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_001331248.1|2289538_2291140_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
2291065:2291079	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_000123295.1|2291120_2292440_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_001513196.1|2292449_2292782_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063218.1|2292837_2293863_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|2293904_2294300_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|2294311_2294665_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|2294676_2295255_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|2295251_2295647_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001609944.1|2295654_2296395_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479169.1|2296410_2296833_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459488.1|2296814_2297249_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840326.1|2297241_2299803_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000847345.1|2299799_2300129_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152538.1|2300128_2300827_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_001746230.1|2300832_2301576_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
WP_071596891.1|2301512_2302145_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	7.4e-92
WP_047656194.1|2302205_2305619_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_001230353.1|2305688_2306288_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_072005420.1|2306352_2309424_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001593356.1|2309423_2310005_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 4
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	2972941	3059170	4818472	head,tRNA,terminase,portal,integrase,tail,lysis,protease,plate,capsid	Salmonella_phage(62.96%)	89	2965902:2965917	3061741:3061756
2965902:2965917	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|2972941_2974234_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2974324_2975668_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2975678_2976290_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077012.1|2976444_2980512_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2980646_2981141_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2981685_2982651_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|2982773_2984540_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|2984540_2986262_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	9.0e-15
WP_001241678.1|2986303_2987008_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2987292_2987511_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2988195_2990472_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2990502_2990823_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2991145_2991370_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|2991442_2993389_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|2993385_2994501_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|2994651_2995608_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|2995604_2997263_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|2997688_2998384_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001614291.1|2998878_2999778_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458832.1|2999921_3001574_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3001585_3002554_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3002686_3004405_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3004441_3005443_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3005453_3006884_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3006982_3007996_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3007992_3008823_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3008819_3009143_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3009268_3009784_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3010001_3010730_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3010747_3011479_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3011485_3012202_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3012201_3012870_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3013161_3013893_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|3014067_3015195_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3015235_3015724_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3015783_3016629_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3016625_3017579_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_112021738.1|3017588_3018722_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	33.5	4.2e-29
WP_000126065.1|3018816_3019929_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3020280_3020757_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3020844_3021747_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|3021807_3022530_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3022513_3022801_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3022960_3023218_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3023247_3023625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3023894_3025580_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_139816873.1|3025826_3026348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085456902.1|3026451_3026667_-	late control protein B	NA	Q53ZE7	Salmonella_virus	75.8	6.7e-21
WP_085456901.1|3026757_3027858_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980401.1|3027854_3028340_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_112021739.1|3028336_3031414_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3031406_3031526_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3031540_3031843_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207661.1|3031897_3032413_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046146.1|3032422_3033595_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_000120166.1|3033727_3034162_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
WP_085456899.1|3034161_3035892_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	6.1e-80
WP_001086848.1|3035888_3036494_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	6.4e-109
WP_085456898.1|3036486_3037395_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.0e-142
WP_000177580.1|3037381_3037741_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_112021740.1|3037737_3038316_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	6.1e-93
WP_060588806.1|3038555_3039761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060588805.1|3039747_3040200_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.6	8.5e-58
WP_001039945.1|3040192_3040624_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000196197.1|3040719_3041148_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.3e-57
WP_060588804.1|3041144_3041660_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_000171568.1|3041640_3041856_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|3041859_3042063_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_060588803.1|3042062_3042527_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059205.1|3042622_3043273_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000742513.1|3043276_3044335_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_060588802.1|3044351_3045185_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	1.8e-122
WP_085456894.1|3045327_3047094_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_085456893.1|3047093_3048128_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.6	4.8e-173
WP_000497736.1|3048179_3049331_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_001059831.1|3049815_3050151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085456892.1|3050358_3050583_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	3.6e-33
WP_001154431.1|3050593_3050782_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_072712151.1|3050934_3053349_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.4	0.0e+00
WP_072712148.1|3053345_3054203_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	93.7	1.7e-155
WP_001556503.1|3054199_3054427_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001244230.1|3054426_3054660_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963473.1|3054727_3055069_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956185.1|3055032_3055233_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000460897.1|3055240_3055750_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3055782_3056004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077875397.1|3056092_3057031_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.6	6.1e-34
WP_112021742.1|3057041_3058031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112021743.1|3058117_3059170_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.0e-106
3061741:3061756	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 5
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	3655473	3714655	4818472	terminase,integrase,holin,tail,capsid	Salmonella_phage(34.78%)	85	3668031:3668078	3710752:3710799
WP_001585369.1|3655473_3656895_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	2.2e-123
WP_000909175.1|3656894_3657572_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|3657565_3658027_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001585368.1|3658789_3661546_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001208878.1|3661532_3661904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|3661896_3662238_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058748.1|3662248_3662851_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|3662843_3663065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3663061_3663325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3663321_3663516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025693500.1|3663508_3664576_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	5.0e-16
WP_000476150.1|3664569_3664752_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032312024.1|3664744_3665578_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412531.1|3665590_3666022_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|3666021_3666225_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|3666652_3667867_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
3668031:3668078	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_021567260.1|3668567_3669311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|3670135_3670909_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_112021751.1|3670969_3671524_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	1.3e-87
WP_077626228.1|3671550_3671952_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_097234235.1|3671955_3672375_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	2.9e-36
WP_112021752.1|3672346_3672949_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.0	8.9e-95
WP_112021753.1|3672948_3673788_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.8	1.1e-50
WP_106661647.1|3673787_3674468_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	3.8e-102
WP_112021754.1|3674464_3675664_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.1	4.1e-184
WP_001270634.1|3675663_3676017_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_032216973.1|3676016_3676772_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	85.7	4.5e-112
WP_023565512.1|3676814_3677231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023565513.1|3677232_3677805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112021755.1|3677973_3678327_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.5	1.3e-29
WP_112021756.1|3678326_3679394_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	1.6e-158
WP_061355750.1|3679396_3679699_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	3.5e-47
WP_061355751.1|3679698_3680286_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	5.8e-83
WP_112021757.1|3680285_3682274_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.1	1.8e-269
WP_061355753.1|3682451_3682904_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	3.0e-55
WP_000109249.1|3682907_3683348_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046931.1|3683358_3684504_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	4.7e-161
WP_032211368.1|3684507_3685071_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_001142484.1|3685045_3685435_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_112021758.1|3685421_3685976_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	1.8e-81
WP_112021759.1|3685972_3686380_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	1.1e-67
WP_160393966.1|3686378_3686612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024246478.1|3686608_3687550_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_024246479.1|3687561_3688068_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	2.9e-70
WP_112021760.1|3688071_3689292_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	7.1e-200
WP_000246482.1|3689306_3690044_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_000113494.1|3689928_3691398_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
WP_112021761.1|3691397_3693020_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	3.0e-312
WP_001218996.1|3693022_3693574_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001472362.1|3693527_3694142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113285.1|3694274_3694460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112021762.1|3694603_3694996_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	79.1	1.8e-48
WP_112021763.1|3694979_3695456_-	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	95.6	1.6e-83
WP_000544528.1|3695442_3695748_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_112021764.1|3696069_3696759_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3696755_3696896_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_112021765.1|3696892_3697255_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
WP_074523363.1|3697251_3697542_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_000224914.1|3697534_3697705_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3697704_3698160_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3698156_3698258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3698350_3698803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112021766.1|3698799_3699360_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
WP_000145917.1|3699844_3700138_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3700134_3700836_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3700832_3701762_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_112021767.1|3701848_3702388_-	regulator	NA	K7PJT7	Enterobacteria_phage	66.5	7.5e-61
WP_001067458.1|3702457_3702688_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3702726_3703482_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|3703604_3704354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3704350_3705178_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3705686_3705893_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_033561765.1|3705968_3706265_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100845.1|3706270_3707056_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186846.1|3707052_3707733_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682559.1|3707729_3707888_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.2	1.5e-22
WP_000129285.1|3707884_3708442_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3708452_3708734_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763373.1|3708832_3709051_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488407.1|3709098_3709377_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446902.1|3709348_3709699_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	98.3	3.5e-59
WP_000051905.1|3709575_3710739_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_000893255.1|3710943_3712197_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3710752:3710799	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3712208_3713312_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|3713599_3714655_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 6
NZ_CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	3746815	3809089	4818472	protease,tRNA,transposase,plate	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611738.1|3746815_3747229_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|3747232_3749083_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|3749046_3750129_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3750153_3751434_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3751430_3751955_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|3751957_3753289_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_112021768.1|3753293_3754055_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001766987.1|3754063_3756907_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.6	1.0e-79
WP_000088859.1|3756903_3757647_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3757651_3759064_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3759172_3762607_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|3762617_3763970_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3763993_3764476_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|3764519_3765434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3765443_3765923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3766059_3766845_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3767384_3768116_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3768180_3768648_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3768644_3769367_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052710.1|3769400_3770156_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3770227_3771586_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211689.1|3771633_3772404_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3772481_3773282_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3773522_3774437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3774433_3775237_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|3780996_3781569_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3781756_3782788_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3782780_3783434_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3783473_3784289_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3784406_3784811_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3784807_3785515_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3785626_3787345_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|3788425_3789406_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3789655_3790366_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635316.1|3790379_3790802_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3790798_3791344_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3791509_3791710_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3791696_3791957_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3792005_3793304_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3793368_3793758_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3793814_3795956_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3796054_3797014_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3797026_3800509_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3800545_3801142_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3801138_3802287_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3802286_3803075_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3803078_3803534_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3803638_3804664_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3804667_3805153_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3805274_3807707_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3807736_3809089_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP030329	Escherichia coli strain AR_452 plasmid unnamed1, complete sequence	128762	2577	58942	128762	transposase,integrase	Escherichia_phage(31.25%)	50	26355:26370	28309:28324
WP_001747814.1|2577_4110_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001470697.1|4336_4990_-|integrase	site-specific integrase	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_001083725.1|5134_5632_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|5743_6034_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|6039_6831_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|6994_7342_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7335_8175_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8579_10121_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|10433_11465_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|11475_12114_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|12118_12484_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|12487_13300_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|13858_14563_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|14684_15590_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|15586_16825_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|16824_17409_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|17901_18666_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|18967_19525_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|19707_20568_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_029702172.1|24195_24645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702141.1|25597_26338_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
26355:26370	attL	TTATATAAGCTGTGGT	NA	NA	NA	NA
WP_001440647.1|27017_27179_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032355874.1|27302_27428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586233.1|27548_28289_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
WP_123002471.1|28611_29601_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.7	2.5e-102
28309:28324	attR	TTATATAAGCTGTGGT	NA	NA	NA	NA
WP_001275013.1|30488_30758_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000348883.1|30761_31292_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001261274.1|31878_32109_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001586230.1|32307_34929_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.7	5.9e-18
WP_001403958.1|35319_35805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545985.1|36772_37906_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001586228.1|37939_38452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586226.1|38738_40304_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001586225.1|40360_41230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024187432.1|41231_42134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586223.1|42134_42320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991831.1|42612_43545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|43548_44544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039052452.1|45221_45572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039052451.1|45641_46250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157916581.1|46356_46596_+	resolvase	NA	NA	NA	NA	NA
WP_000239529.1|47215_47491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|47484_48129_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_039052450.1|48357_49329_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.6	9.7e-67
WP_039052449.1|49333_49726_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_039052448.1|51234_52215_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.2	2.9e-180
WP_039052447.1|52557_54822_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_039052454.1|54823_55600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087758690.1|56582_57703_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_061856962.1|57724_58942_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	2.0e-226
