The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	739109	772367	5379490	capsid,integrase,tail,head,protease,portal,terminase,tRNA	uncultured_Caudovirales_phage(75.0%)	34	756717:756734	772712:772729
WP_002919147.1|739109_740057_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|740071_740581_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|740709_741834_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|741805_742279_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|742304_742847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|742851_743424_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|743427_744246_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|744242_744500_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|744475_745030_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|750825_751047_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|751340_754451_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|754463_755603_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|755981_756632_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
756717:756734	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|756907_758134_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|758226_759168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|759349_759634_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|759644_760424_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|760926_761145_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|761137_761326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|761402_761531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|761629_761998_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|761994_762360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|762359_764495_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|764837_765173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|765221_765734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|765997_767164_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|767215_767776_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|767777_769019_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|769015_769351_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|769347_769647_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|769646_770090_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|770082_770235_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|770365_770722_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004207387.1|770705_772367_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
772712:772729	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	1528943	1575178	5379490	coat,capsid,integrase,tail,head,plate,lysis,portal,terminase,tRNA	Salmonella_phage(83.72%)	61	1527237:1527283	1563804:1563850
1527237:1527283	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1528943_1529969_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1529971_1530601_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1530723_1530966_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1530998_1531508_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1531515_1531716_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1531679_1532018_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1532085_1532319_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1532318_1532546_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1532542_1533394_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1533390_1535775_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1535937_1536126_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1536137_1536371_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1536466_1537150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1537136_1538216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1538215_1539217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1539738_1540008_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1540064_1541108_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1541107_1542871_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1543011_1543845_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1543861_1544914_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1544917_1545571_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1545666_1546131_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1546130_1546334_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1546337_1546553_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1546533_1547043_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1547047_1547431_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1547427_1547856_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1547830_1547989_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1547951_1548374_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1548366_1548813_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1548835_1549702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1549796_1550369_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1550365_1550728_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1550714_1551623_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1551615_1552287_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1552288_1554238_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1554247_1555366_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1555417_1556491_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1556639_1557812_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1557821_1558337_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1558389_1558689_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1558703_1558823_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1559049_1561446_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1561442_1561928_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1561924_1563019_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1563085_1563304_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1563331_1563709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1564312_1564795_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1563804:1563850	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1564905_1565382_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1565371_1565662_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1565728_1566070_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1566051_1566192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1566217_1567879_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1567965_1568844_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1568968_1569559_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1569678_1570965_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1570984_1571776_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1571939_1573304_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1573563_1573812_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1573830_1574379_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1574410_1575178_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	1679903	1724746	5379490	integrase,holin,terminase,tail	Salmonella_phage(40.43%)	54	1682467:1682481	1693647:1693661
WP_004151980.1|1679903_1681370_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1681437_1683015_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1682467:1682481	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004152549.1|1683207_1684458_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1684474_1684666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|1684662_1684845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1684841_1685435_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1685431_1685590_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1685582_1685876_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1685985_1686234_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1686285_1687308_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1687317_1688217_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1688213_1688513_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152539.1|1688879_1689461_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1689614_1689848_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1689994_1690204_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1690203_1690971_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1690967_1691753_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1691872_1692220_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1692412_1692823_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1692806_1692998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1692994_1693420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1693416_1694160_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1693647:1693661	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004141386.1|1694330_1694543_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1694539_1695208_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1695200_1695440_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1695439_1695778_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1695852_1696110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1696187_1696772_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004154331.1|1696768_1698244_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152449.1|1698310_1698622_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004141368.1|1699423_1699630_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152447.1|1699644_1701327_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004152446.1|1701323_1701620_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152445.1|1701622_1702303_+	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152444.1|1702317_1703304_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152443.1|1703357_1703795_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152442.1|1703805_1704147_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152441.1|1704197_1704521_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152440.1|1704520_1705126_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152439.1|1705125_1707624_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152438.1|1707623_1708088_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152437.1|1708087_1708627_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152436.1|1708637_1711469_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152435.1|1711468_1713379_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152434.1|1713378_1716144_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_071531206.1|1716286_1716670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|1716755_1717445_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_004152432.1|1717759_1718056_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152705.1|1719637_1720579_+	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
WP_004146394.1|1720863_1721268_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1721254_1721560_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1721549_1722179_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1722175_1722658_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1722877_1724746_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	2053642	2060549	5379490	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|2053642_2054506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|2054516_2055290_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|2055532_2056429_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|2056671_2058033_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|2058351_2059074_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|2059070_2060549_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	2097080	2104705	5379490		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|2097080_2098487_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|2098711_2099776_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|2099802_2100672_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|2100703_2101594_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|2101608_2102163_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|2102343_2103510_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|2103703_2104705_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	2345536	2402023	5379490	protease,plate,transposase	Microcystis_virus(25.0%)	54	NA	NA
WP_002910830.1|2345536_2346283_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2346721_2347708_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2347700_2348501_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2348487_2348661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2348958_2349102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2349278_2350220_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2350313_2351303_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2351328_2352660_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2352687_2353896_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2353924_2356219_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2356270_2356417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2356706_2357765_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2357874_2358789_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2358798_2360076_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2360072_2360948_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2360944_2361664_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2361669_2362563_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2362846_2364490_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2364539_2365016_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2365114_2366041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2366344_2367640_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2367651_2368461_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2368435_2369335_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2369444_2369927_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004219568.1|2370024_2370816_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|2370841_2371381_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2371495_2371825_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004148795.1|2371995_2372157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2372393_2373734_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2373730_2374384_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2374387_2376085_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2379048_2380404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2380404_2380914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2380910_2381417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2381653_2382163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2383768_2384737_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2384878_2385061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2385057_2385387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2385383_2385890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199323.1|2387399_2387711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2387732_2388626_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2388671_2388788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2388809_2389703_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2389728_2389857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217421.1|2389998_2390772_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_004152632.1|2390947_2391838_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2392174_2393155_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072093175.1|2393380_2393515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2393775_2393961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2394258_2394525_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2394528_2395686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2395669_2399080_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2399213_2400977_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2401006_2402023_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3078730	3088144	5379490		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|3078730_3080365_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|3080419_3081685_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|3081715_3082804_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|3082890_3083151_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|3083448_3084309_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|3084329_3085091_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|3085351_3086254_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|3086265_3087531_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|3087523_3088144_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3312364	3355412	5379490	integrase,transposase,terminase	Klebsiella_phage(33.33%)	63	3346525:3346539	3352534:3352548
WP_014343022.1|3312364_3315388_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3315443_3315641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3315615_3315747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3315867_3316032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3316506_3317280_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3317276_3318473_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3318472_3318826_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3318827_3319481_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3319534_3319885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3320137_3320323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3320375_3320717_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3320716_3321739_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3321741_3321969_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3322044_3322458_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3322643_3324647_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3324636_3324789_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3324824_3325250_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3325576_3326768_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3326709_3327000_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3327010_3328156_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3328159_3328600_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3328694_3329081_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3329080_3329587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3329583_3330003_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3329971_3330253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3330292_3331234_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3331245_3331740_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3331743_3332946_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3332997_3333546_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3333601_3335053_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3335290_3336691_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3336641_3337130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3337495_3337816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3338050_3338440_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3338436_3338967_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3338969_3339218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3339235_3339364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3339401_3339557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3339623_3340406_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3340402_3340879_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3340875_3341853_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3341839_3343498_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3344074_3344296_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3344393_3345062_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3345232_3345547_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3345539_3345728_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3346101_3346263_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3346255_3346510_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3346525:3346539	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3346577_3346700_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3346696_3347122_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3347118_3347313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3347309_3348137_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3348241_3348760_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3348765_3349476_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3349465_3349690_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3349785_3349899_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3350141_3350375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3350447_3350594_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3350553_3350796_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3350776_3351958_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3352154_3352703_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3352534:3352548	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3352901_3354434_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3354650_3355412_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3767115	3860066	5379490	capsid,integrase,plate,tail,head,protease,lysis,portal,terminase,tRNA	Salmonella_phage(57.63%)	97	3822641:3822659	3860141:3860159
WP_002898139.1|3767115_3768408_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3768498_3769842_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3769850_3770462_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3770584_3774838_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3774973_3775468_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3775751_3775883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3776000_3776969_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3777083_3778850_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3778850_3780572_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3780598_3781318_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3781671_3781890_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3782010_3784290_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3784320_3784638_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3784963_3785185_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3785261_3787202_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3787198_3788314_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3788460_3790119_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3790538_3791234_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3791349_3792249_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3792392_3794045_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3794055_3795024_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3795235_3795670_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3795821_3797540_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3797578_3798580_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3798590_3800033_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3800120_3801134_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3801130_3801961_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3801992_3803132_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3804009_3804525_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3804751_3805480_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3805500_3806232_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3806238_3806955_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3806954_3807623_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3807806_3808538_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3808580_3810053_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3810049_3810766_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3810844_3811972_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3812013_3812502_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3812559_3813405_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3813401_3814355_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3814365_3815532_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3815662_3816775_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3817123_3817603_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3817691_3818594_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3819415_3819703_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3819905_3820169_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3820175_3820559_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3820825_3822511_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3822502_3822625_-	hypothetical protein	NA	NA	NA	NA	NA
3822641:3822659	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3822730_3822949_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3823040_3824141_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3824137_3824623_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3824619_3827013_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3827239_3827359_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3827373_3827673_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3827725_3828241_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3828250_3829423_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3829561_3830638_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3830667_3830829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3830867_3831599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3831602_3834554_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3834555_3835155_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3835147_3836056_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3836042_3836405_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3836401_3836974_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3837088_3837253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3837251_3837761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3837757_3838204_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3838196_3838628_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3838590_3838737_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3838723_3839152_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3839148_3839532_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3839536_3840046_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3840026_3840242_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3840245_3840449_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3840448_3840913_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3841008_3841659_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3841662_3842721_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3842737_3843571_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3843713_3845480_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3845479_3846505_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3846566_3848309_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3848584_3849262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3849376_3849610_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3849620_3849809_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3849962_3852377_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3852373_3853231_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3853227_3853455_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3853454_3853688_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3853755_3854097_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3854060_3854261_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3854268_3854778_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3854810_3855032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3855177_3856056_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3856067_3857012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3857110_3858598_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3859085_3860066_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3860141:3860159	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	4305176	4350451	5379490	integrase,lysis,tRNA,head	Escherichia_phage(26.42%)	65	4298389:4298435	4347523:4347569
4298389:4298435	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4305176_4307654_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4307640_4308036_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4308032_4308503_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4308502_4308979_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|4309021_4312468_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4312560_4313064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4313191_4313977_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4314042_4314756_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4314745_4314916_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4315015_4315375_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4315391_4315862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4316155_4316410_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4316412_4317168_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4317343_4318021_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4318073_4318826_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4318894_4319287_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4319283_4319709_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4319711_4320074_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4320073_4320247_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4320246_4320627_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4320629_4320869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4320879_4321974_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4321985_4322414_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4322417_4323803_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4323875_4324352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4324393_4325398_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4325372_4326794_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4326806_4328279_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4328278_4328881_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4329251_4329581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4329686_4330151_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4330147_4330678_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4330680_4330929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4331838_4332528_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4332524_4333055_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4333047_4333185_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4333181_4333817_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4333809_4333980_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4333979_4334435_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4334935_4335583_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4335755_4336598_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4336704_4337211_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4337207_4337501_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4337500_4338916_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4338920_4339772_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4339812_4339959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4340044_4340266_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4340306_4340540_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4340667_4341357_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4341707_4341923_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4341919_4342030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4342022_4342217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4342305_4342590_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4342605_4343451_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4343447_4344128_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4344124_4344283_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4344279_4344936_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4344932_4345700_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4345696_4345915_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4345916_4346132_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4346133_4346469_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4346345_4347509_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4347939_4348806_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4347523:4347569	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4348807_4349020_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4349065_4350451_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 11
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	4560006	4571660	5379490	integrase	Enterobacteria_phage(70.0%)	15	4559858:4559871	4564071:4564084
4559858:4559871	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4560006_4561110_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4561120_4562374_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4562726_4563917_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4563904_4564855_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4564071:4564084	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4564854_4565280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4565626_4565776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4565848_4566415_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4566432_4566678_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4566674_4567412_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4567711_4567849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4567953_4568220_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4568222_4568774_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4568818_4568998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4568994_4569315_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4569326_4571660_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 12
NZ_CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	5039906	5045731	5379490		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|5039906_5042240_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|5042254_5042575_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|5042571_5042799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|5042795_5043338_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|5043340_5043607_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|5044167_5044905_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|5044901_5045147_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|5045164_5045731_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP030343	Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence	207546	2530	47280	207546	protease,transposase,integrase	Escherichia_phage(30.0%)	43	10187:10201	27528:27542
WP_004152557.1|2530_2878_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|2874_3261_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|3808_4444_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|4440_5553_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|5545_6934_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_016197752.1|6933_7164_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|8141_8801_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|9001_9379_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|9445_12412_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
10187:10201	attL	TTCGTGGTACAGCAG	NA	NA	NA	NA
WP_000147567.1|12414_12975_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|13100_13451_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|13653_14667_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|14811_15309_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|15420_15711_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|15716_16508_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|16671_17019_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|17012_17852_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|17979_18183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|18338_19544_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|19554_19860_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|20086_20851_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|21343_21928_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|21927_23166_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|23162_24068_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|24189_24894_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|25044_25860_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044503635.1|26049_26718_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_004217321.1|28021_28726_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
27528:27542	attR	TTCGTGGTACAGCAG	NA	NA	NA	NA
WP_004153729.1|29581_30409_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|30405_31269_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|31277_32105_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|32113_33124_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|33117_33987_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|35195_36176_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|37377_37641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|37655_37919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|38162_38444_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|38478_39048_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|39162_41958_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|41957_42155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|42392_43142_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|43128_44091_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|45933_47280_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP030342	Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence	113639	27785	39877	113639		Escherichia_phage(25.0%)	13	NA	NA
WP_004152355.1|27785_28487_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_014343518.1|28688_28805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|28923_29154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|29214_29886_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|29888_30860_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|31091_31523_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|31522_32794_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|33194_34091_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|34412_35618_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|35614_36589_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|36965_37298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|37522_37738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|37849_39877_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
NZ_CP030342	Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence	113639	44452	68559	113639	integrase,transposase	Burkholderia_virus(12.5%)	26	35238:35255	70002:70019
35238:35255	attL	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152342.1|44452_45721_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|45840_46314_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|46405_46636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|47527_48310_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|48309_48642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|48648_49047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|49072_49402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|49429_49738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|49783_49990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093212.1|50224_50686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|50642_50873_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|50869_51286_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|51359_52070_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|52801_52927_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|52962_53385_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|53436_55131_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|55148_55511_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|55507_55744_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|55779_56448_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|56486_57791_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|58358_59219_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|60962_61667_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|61739_64637_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|64725_65346_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|66511_66871_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|67374_68559_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
70002:70019	attR	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
