The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	326300	336628	5238870	transposase,integrase	Enterobacteria_phage(22.22%)	10	319892:319905	333955:333968
319892:319905	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_112033803.1|326300_327356_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	7.0e-119
WP_001285288.1|327643_328747_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|328758_330012_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|330367_331582_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|331724_332606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|332803_333001_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|333000_333432_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_112033804.1|333444_333840_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	36.6	2.1e-07
WP_085948178.1|333865_335078_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
333955:333968	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_000942525.1|335557_336628_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	550426	630318	5238870	protease,tRNA,head,tail,capsid,transposase	Escherichia_phage(33.33%)	69	NA	NA
WP_000186631.1|550426_550906_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|551109_551904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|552041_552383_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|552496_555001_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|555262_556195_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|556197_557490_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|557614_558022_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|558022_558481_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|558477_559395_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|559540_560218_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|560204_560987_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|561049_561904_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|561964_562774_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|562763_563387_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|563357_564044_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|564040_566455_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|571076_571337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|572568_573663_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|573731_574658_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|574887_575370_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|575447_576263_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|576352_578134_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|578146_578923_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|579022_579901_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|580069_581524_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|581583_582945_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|583001_584303_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|584324_585470_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|585598_586384_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|586394_587630_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|587651_588701_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|589017_590685_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|590694_591954_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|591964_592780_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|592776_593670_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|593806_594874_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|594870_595380_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|595497_596220_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|596222_596717_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|596890_598276_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|598311_598833_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|598940_599153_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|599154_600021_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|600501_601044_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|601263_601956_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|601986_604596_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|605647_606163_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|606165_606798_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|608008_608341_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|608396_609422_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|609463_609859_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|609870_610170_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|610190_611403_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|611496_612075_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|612071_612467_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|612474_613215_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|613230_613653_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|613634_614069_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|614061_616242_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|616247_617460_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000239881.1|617530_618199_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|618255_618561_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|618744_620229_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|620415_621369_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|621881_622643_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|622825_623716_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|623716_626689_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|626675_628913_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|629181_630318_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	849743	869068	5238870	tail,transposase,integrase,holin	Enterobacteria_phage(52.17%)	28	849656:849670	870395:870409
849656:849670	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000263438.1|849743_850820_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000638251.1|850833_851244_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_000145948.1|852529_852820_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000818841.1|852892_853099_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000344554.1|853116_853479_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000814614.1|853450_853861_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_001254255.1|853857_854034_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386661.1|854036_854396_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950962.1|854395_854572_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286917.1|854564_854777_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002251.1|854769_855060_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001008192.1|855056_855419_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000994516.1|855415_855604_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|855815_856775_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032178163.1|857114_857237_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|857251_857941_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|858125_858869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|858954_859113_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023272.1|859411_861262_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411800.1|861709_861916_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_112033810.1|861915_862104_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.9e-19
WP_085948178.1|862106_863320_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001191368.1|863373_863577_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
WP_000950982.1|863682_864564_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|864787_865618_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|865741_866113_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001002868.1|867331_867712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|867855_869068_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
870395:870409	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 4
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1079722	1122281	5238870	transposase,protease,holin	Escherichia_phage(38.46%)	54	NA	NA
WP_000156528.1|1079722_1081483_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1081668_1082121_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1082196_1083237_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1083593_1084103_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1084375_1084951_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1084913_1087076_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1087085_1087532_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1087654_1089709_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1089740_1090199_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1090294_1090957_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1091129_1091543_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1091587_1091905_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1091962_1093153_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1093247_1093526_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1093522_1093852_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1093942_1094602_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1096002_1096245_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|1097407_1098621_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000048507.1|1098672_1100097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1100189_1100381_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1100377_1100566_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1101097_1101472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1101483_1101636_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1101908_1102625_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1102674_1102890_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1102886_1103312_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1103383_1104454_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1104494_1104917_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1104913_1105210_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1105206_1105668_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1105645_1106002_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1106052_1106265_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1106516_1106780_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1106790_1107660_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1107775_1107880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1108068_1108281_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1108448_1108709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1108728_1109778_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1109790_1110162_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1110151_1110523_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1110674_1111493_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1111779_1111977_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1112114_1112828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1113595_1115446_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1115893_1116100_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1116355_1116628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1116787_1117321_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1117541_1117655_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1117876_1118062_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1118588_1118903_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1118984_1119209_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|1119258_1120472_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|1120558_1121452_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1121897_1122281_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1177817	1245066	5238870	transposase,protease,integrase	Escherichia_phage(23.53%)	58	1170054:1170068	1201280:1201294
1170054:1170068	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_000279869.1|1177817_1179020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1179206_1181024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1182135_1182432_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1182658_1182856_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|1183074_1184508_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1185328_1185892_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1186046_1188407_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998045.1|1189163_1190702_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_085948178.1|1190913_1192126_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000024297.1|1192983_1193343_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591991.1|1193435_1195055_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1195279_1195555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042352357.1|1195935_1196634_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1196724_1197027_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1197035_1197356_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1197348_1199052_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_112033812.1|1199061_1199526_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142973.1|1199526_1200201_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1200212_1200830_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1202041_1202305_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
1201280:1201294	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001135715.1|1202606_1202747_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000435663.1|1206628_1207054_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1207050_1207401_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1207431_1209045_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957251.1|1209987_1210329_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1210315_1210645_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1210905_1211373_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1211390_1212599_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1212609_1213566_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1213565_1214645_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|1214646_1215420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|1215412_1216555_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|1216564_1217623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|1217944_1218526_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|1218525_1219683_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|1219705_1220161_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|1220183_1221224_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|1221272_1221851_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|1221919_1222495_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|1222918_1223305_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|1223818_1225909_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|1227361_1227580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|1228213_1228549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|1229329_1229524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|1229575_1229749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|1229837_1230110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|1230393_1230609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|1230674_1230872_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|1231601_1232726_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|1234079_1234538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|1234995_1235505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|1235593_1236217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|1236312_1236546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|1236598_1236790_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|1237464_1238511_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001304205.1|1239264_1241433_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000502842.1|1243150_1243789_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_085948178.1|1243852_1245066_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1345857	1414540	5238870	holin,tRNA,integrase,head,tail,capsid,terminase,transposase	Stx2-converting_phage(38.46%)	72	1340951:1340965	1347432:1347446
1340951:1340965	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1345857_1346976_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1346944_1347214_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1347275_1349741_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1347432:1347446	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1349833_1350025_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1350021_1350210_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1350549_1350690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1350693_1350912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1350952_1351342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1351637_1351916_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1351917_1352109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1352129_1352501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1352598_1352901_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|1352897_1353323_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1353345_1354308_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_085948178.1|1354802_1356016_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001204666.1|1356530_1357109_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|1357068_1358166_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_085948178.1|1358800_1360014_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|1360051_1360192_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|1360359_1360632_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1360633_1361689_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1361689_1362055_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1362063_1362594_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1362835_1363033_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1363183_1364242_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|1365038_1366889_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000411802.1|1367336_1367543_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1367547_1367892_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1367942_1368476_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1368746_1369316_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1369315_1369462_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1369689_1369875_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1370299_1370527_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1370568_1370934_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1371224_1371788_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1371784_1373446_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|1373509_1375447_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1375491_1375713_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1378401_1378728_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1378737_1379088_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1379084_1379531_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1379527_1379872_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1379938_1380655_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1380660_1381035_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1381130_1381340_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1381391_1384634_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1384626_1384968_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1384967_1385666_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1385682_1386003_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1386110_1386284_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1387331_1388069_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1388014_1388647_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|1388883_1392363_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|1392429_1393029_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|1393093_1394416_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|1394417_1394687_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1394793_1394883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1394902_1397251_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1397841_1401243_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_000145590.1|1401411_1401990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1402012_1402138_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1402217_1402493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1402553_1403915_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1404278_1405142_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1405125_1406262_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359442.1|1406511_1407741_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1407886_1409008_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1409083_1410544_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1410543_1411215_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1411382_1412753_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1412756_1413398_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1413433_1414540_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1515756	1588778	5238870	protease,holin,portal,tail,terminase,transposase	Enterobacteria_phage(43.14%)	78	NA	NA
WP_000268365.1|1515756_1516305_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_085948178.1|1518151_1519364_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075578.1|1519428_1519965_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1519997_1520279_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1520275_1520572_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1520568_1521030_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1521007_1521364_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1521459_1521831_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1521827_1522181_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1522386_1522686_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1522691_1522949_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1523084_1523363_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1523364_1524414_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1524426_1524801_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1524797_1525619_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1525845_1526043_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1526193_1527252_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1527846_1529793_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1529930_1530110_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1530150_1530396_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1530473_1530689_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1530692_1530938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1530963_1532176_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000992150.1|1532599_1533133_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012578895.1|1533651_1533837_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000373407.1|1534312_1534789_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1534785_1536909_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1536905_1537118_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1537117_1538620_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1538564_1540589_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1540676_1541003_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1540995_1541277_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1541279_1541903_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1541915_1542314_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1542321_1543074_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1543087_1543510_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1543536_1543845_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1543888_1546534_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1546530_1546860_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|1547567_1548311_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|1548256_1548889_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_106895295.1|1549125_1552602_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_001230455.1|1552669_1553269_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_112033816.1|1553333_1554647_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1554648_1554918_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000692020.1|1556053_1556644_+	protein kinase	NA	NA	NA	NA	NA
WP_001079509.1|1557680_1558187_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1558232_1558733_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1558818_1558998_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1559378_1560185_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1560184_1561378_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_112033859.1|1561389_1562748_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1562751_1564347_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1564346_1565909_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1566000_1566045_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1566182_1567064_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1567060_1567681_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1567781_1568654_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1568693_1569284_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1569280_1570039_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1570258_1571308_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1571343_1571595_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1571974_1574572_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_000776253.1|1574781_1575756_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1576050_1576215_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001297116.1|1576217_1576385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1576498_1576594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099519.1|1576757_1579433_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1579496_1580087_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256539.1|1580256_1581021_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876286.1|1581169_1581478_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1581484_1582654_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176278.1|1582845_1583583_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001295580.1|1583582_1583909_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000498253.1|1584034_1584253_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088625.1|1584521_1585271_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1585360_1585534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1587564_1588778_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1649162	1744923	5238870	holin,tRNA,integrase,head,tail,terminase,capsid,transposase	Escherichia_phage(42.53%)	114	1707871:1707930	1738616:1739927
WP_000628065.1|1649162_1650395_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1650649_1651633_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1651907_1652081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123745.1|1652110_1653484_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1653612_1654548_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1654599_1655835_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1655836_1656052_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1656151_1656340_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1656377_1656527_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1656582_1657392_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1657384_1659985_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1660086_1660362_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1660436_1660607_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1660606_1660828_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1661269_1661758_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1661754_1661910_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1661920_1662100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1662342_1662762_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1662841_1663096_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1663092_1663515_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1663592_1664381_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1664387_1665134_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1665156_1665918_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1665933_1666356_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1666461_1666674_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1666925_1667189_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1667199_1667361_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1667439_1667685_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1668116_1669268_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1669235_1670225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1670224_1671616_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|1672115_1672715_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1672714_1673005_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1673001_1673556_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1674117_1674549_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143077.1|1675119_1676973_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|1677122_1677338_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1677342_1677687_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1677737_1678271_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|1678544_1679084_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_085948178.1|1679086_1680300_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000285960.1|1680376_1680553_+	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|1680647_1680779_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1681001_1681187_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1681587_1681914_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1682045_1682246_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1682287_1682653_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1682941_1683505_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1683501_1685163_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|1685226_1687164_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|1687208_1687430_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1689794_1690121_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|1690130_1690481_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1690477_1690924_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1690920_1691265_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275480.1|1691333_1692050_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_001030060.1|1692055_1692430_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1692525_1692735_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212770.1|1692786_1696029_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_000807964.1|1696021_1696363_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|1696362_1697061_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|1697071_1697815_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1697760_1698393_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1698583_1699111_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_112033817.1|1699244_1702718_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228290.1|1702785_1703385_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|1703536_1704841_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|1704842_1705112_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|1706226_1706349_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1706455_1707367_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
1707871:1707930	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
WP_085948178.1|1707913_1709127_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303943.1|1710153_1710432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1710859_1711006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1711142_1711790_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|1711973_1712564_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001261191.1|1715069_1715423_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|1715513_1716233_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_112033818.1|1716272_1716671_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1716775_1717315_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|1717344_1718088_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1718444_1719083_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1719128_1720259_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1720236_1720485_-	excisionase	NA	NA	NA	NA	NA
WP_112033819.1|1720549_1723021_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|1723116_1723305_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1723301_1723490_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1723889_1724057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1724050_1724284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1724261_1724669_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|1724691_1724910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1724982_1725282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1725546_1725954_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1726240_1726792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1726763_1727804_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1727715_1728258_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|1728291_1729026_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|1729022_1729187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1729885_1730644_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1730922_1731135_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1731355_1731613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|1731682_1731961_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|1731962_1733018_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1733018_1733384_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1733380_1734070_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|1735597_1737367_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_085948178.1|1737418_1738631_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064764776.1|1738597_1738720_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_001023452.1|1738721_1738991_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1739131_1740007_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1738616:1739927	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTGTGC	NA	NA	NA	NA
WP_001121225.1|1740231_1740882_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1741477_1741792_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1741851_1743135_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1743223_1744684_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1744719_1744923_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1884145	2008083	5238870	protease,holin,portal,head,integrase,tail,capsid,terminase,transposase,lysis	Stx2-converting_phage(39.62%)	119	1965652:1965668	2003313:2003329
WP_000826406.1|1884145_1885354_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|1885880_1886549_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|1886851_1887445_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|1887441_1888434_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|1888625_1889537_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|1889531_1890068_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1890130_1890355_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1890494_1892150_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|1892374_1893718_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|1893934_1894858_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|1894895_1896536_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1896934_1897084_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1897155_1897329_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1897573_1898104_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1898292_1899294_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1900834_1901635_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|1901906_1905809_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1906009_1906615_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1906665_1907982_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|1907971_1909729_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|1909744_1910641_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1910640_1911246_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|1911416_1913723_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|1913786_1914647_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|1914877_1915468_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|1915449_1916400_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1916500_1917814_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|1917840_1919046_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1919045_1919468_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1919457_1920885_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|1920886_1921675_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1921674_1922442_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|1922438_1923509_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1923516_1924014_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1924028_1924775_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1924783_1925071_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1925082_1926012_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|1926296_1928342_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|1928589_1930863_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|1932642_1933548_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|1933719_1934049_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1934053_1934239_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|1934235_1936875_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1937082_1938072_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1938182_1938605_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1938601_1938868_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|1939141_1942666_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|1943032_1944166_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|1944306_1944741_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1945321_1945963_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1946044_1946674_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|1946746_1947322_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|1947434_1947704_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|1947705_1949019_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|1949083_1949683_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_112033822.1|1949753_1953251_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_096860308.1|1953593_1954226_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1954171_1954915_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1954920_1955619_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1955618_1955960_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369428.1|1955952_1957395_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000091308.1|1957413_1957779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1957778_1958966_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001453698.1|1961074_1961284_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030041.1|1961379_1961754_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_112033823.1|1961759_1962476_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	96.6	1.2e-125
WP_000133393.1|1962542_1962887_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1962883_1963330_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1963326_1963677_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1963686_1964013_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_012817878.1|1964015_1966595_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
1965652:1965668	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063099.1|1966540_1966762_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|1966806_1968744_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|1968807_1970469_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1970465_1971029_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|1971318_1971684_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|1971725_1971953_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1972321_1972546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1972631_1972817_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|1973334_1973868_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1973918_1974263_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|1974267_1974474_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000143036.1|1974919_1976770_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|1977217_1977349_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_085948178.1|1977608_1978821_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000705364.1|1979505_1980027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1980010_1980238_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1980315_1980723_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1980915_1981068_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1981079_1981445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1981413_1981701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1982116_1982305_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1982301_1982493_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_112033824.1|1982586_1983030_+	exonuclease VIII	NA	NA	NA	NA	NA
WP_085948178.1|1983069_1984283_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_112033825.1|1984346_1986371_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	2.7e-58
WP_001296941.1|1986458_1986695_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1986729_1988010_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1988029_1988140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1988197_1989217_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1989228_1990443_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1990648_1990975_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1991109_1991451_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1991485_1992046_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1992048_1992759_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1992866_1993172_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1993370_1995797_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1995857_1998281_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1998291_1998909_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1998910_1999765_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1999807_2000422_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|2000580_2001873_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|2001825_2002521_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2002645_2003866_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
2003313:2003329	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|2004000_2004894_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2005000_2006254_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|2006650_2006986_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2007078_2007162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|2007261_2008083_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2131564	2169648	5238870	holin,tRNA,portal,head,tail,capsid,terminase,transposase,plate	Enterobacteria_phage(86.11%)	45	NA	NA
WP_100206497.1|2131564_2131843_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2131853_2132132_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2132143_2132386_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000165075.1|2132450_2133332_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000686506.1|2134904_2135864_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2135868_2136180_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2136544_2136814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2137376_2137901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2137915_2138962_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2138961_2140713_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2140867_2141704_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2141727_2142780_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2142825_2143626_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2143728_2144223_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2144222_2144423_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2144425_2144749_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2144745_2145138_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2145134_2145542_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2145679_2146147_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2146139_2146775_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2146771_2147353_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2147349_2147700_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2147703_2148600_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2148592_2149123_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2149125_2151258_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2151257_2151836_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2151879_2152452_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2152608_2153097_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_112033826.1|2153109_2155917_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.8	0.0e+00
WP_000333503.1|2155903_2156059_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2156067_2156442_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2156497_2157010_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2157009_2158194_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2158351_2159461_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2159686_2161189_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2161432_2161693_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2161883_2162024_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2162330_2162630_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2162634_2165022_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2165036_2166020_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2166303_2166348_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2166470_2166827_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2166879_2167077_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2167173_2167716_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2167719_2169648_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 11
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2389271	2481613	5238870	holin,portal,head,integrase,tail,capsid,terminase,transposase	Escherichia_phage(31.75%)	106	2389230:2389289	2487205:2488518
2389230:2389289	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|2389271_2390485_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_146868618.1|2390490_2391615_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.4	9.8e-188
WP_000879833.1|2393006_2393804_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2393813_2394365_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2394533_2394866_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2395199_2395514_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|2395727_2397386_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2397378_2398374_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2398366_2399053_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|2399052_2400426_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2400444_2400888_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620092.1|2400884_2402012_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2402116_2402581_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2402585_2403590_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2403586_2404000_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2404002_2404368_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2404367_2405105_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2405114_2405384_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2405391_2406177_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2406466_2407090_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2407133_2407376_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2407484_2407712_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2408009_2408825_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2408821_2410516_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|2410686_2410869_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2410947_2411865_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2412037_2412958_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2412946_2413417_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2413397_2414816_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2414882_2415578_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2415617_2415983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2417397_2418611_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000218214.1|2419616_2420468_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2420575_2421934_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2421933_2422605_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|2422737_2423151_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2423259_2424264_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2424264_2424900_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2425156_2425807_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2426149_2426680_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2427914_2428928_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2429333_2429603_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|2429604_2430918_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|2430982_2431582_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2431649_2435126_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2435372_2436005_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2435950_2436694_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2436699_2437398_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2437397_2437727_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|2437723_2440336_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|2440316_2440730_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2440756_2441179_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2441192_2441945_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2441952_2442348_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001204554.1|2442893_2443247_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2443239_2443623_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2443674_2444703_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2444760_2445108_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2445144_2446650_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2446639_2448232_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2448228_2448435_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2448418_2450347_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2450318_2450825_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2451251_2451476_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2451557_2451872_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2452397_2452583_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2453100_2453634_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000638258.1|2453676_2454081_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
WP_085948178.1|2454064_2455278_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000284516.1|2455509_2455725_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2455801_2456074_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2456114_2456294_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_024222300.1|2456431_2458369_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2458847_2459279_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2459366_2459792_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_112033831.1|2459788_2460139_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
WP_000080194.1|2460169_2461783_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2462268_2462982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2463116_2463314_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2463537_2464092_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2464100_2464460_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2464472_2465522_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2465523_2465796_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2465917_2466262_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2466381_2466594_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2466827_2467385_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2467386_2467605_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2467732_2468044_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2468036_2468264_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2468260_2468542_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2468574_2469291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2469312_2470059_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2470065_2471136_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2471207_2471633_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2471616_2471898_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2471997_2472417_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2472682_2472835_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2472846_2473485_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2473485_2473695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2474265_2474454_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2474450_2474642_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_112033832.1|2474734_2475730_+	exonuclease	NA	NA	NA	NA	NA
WP_000091308.1|2475764_2476130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|2476129_2477317_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001300307.1|2479185_2479983_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2480338_2481613_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2487205:2488518	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGACATTATTATAACAATCCACTAATACCCTGGCTTTATCTTCCCCTTTTGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTGAATTTTTGCTATTAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAATTAAGCGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCTCACTTAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAAATGCCCATGTCATGGGTACGGGAGCCCGGAGATTCTGATCCATCCGGGACGCGTTCTTGCACAAAGGGGAGTAGCACTTCATGGTTAAATCAACAACCTGAAAATTCGTTTTTGCTTTCAACTGACTGATAAATATCATCGTTTTCAGGTTCTTTTTACGCATCGCCTCTATACAAAGATCCGGCGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTGCGTGATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTTTTCAAGTTTAAGTGCATTAAACACTTCTAAATTAATTGTCGACGTAACAATTAAAAGATGCTTAATTTTATGCAATTCAAGCGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGGTCGGGAATATGGATGACAACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAAATGCAATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTATAATACAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTATGTTTCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCCTGCGCTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAAACATTTGCAGATGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAGTTACCTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACGCTCATCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCGTTAGGCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACCGCCGCACTGGTGTTTA	NA	NA	NA	NA
>prophage 12
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2706670	2775556	5238870	protease,holin,integrase,capsid,terminase,transposase,lysis	Enterobacteria_phage(20.0%)	64	2744610:2744645	2776496:2776531
WP_000101907.1|2706670_2707912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2708408_2708615_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2708569_2710378_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2710593_2710833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2710805_2711039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2711031_2711265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2711270_2711570_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2711566_2712967_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2713168_2713414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2713544_2713739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2713742_2713904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2714031_2714520_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2714682_2715606_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2718980_2719628_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2719662_2720715_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2720711_2721269_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2721265_2723209_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|2723205_2723685_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2723681_2723891_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2723887_2724625_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2724666_2725329_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2725325_2725943_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2725961_2726564_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2726573_2727023_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2727019_2727883_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2727869_2728565_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2728571_2731058_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2731054_2731318_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2731307_2731802_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2732210_2732699_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2732847_2734494_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2734711_2736355_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2736430_2737081_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2737080_2738145_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2738218_2739274_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2739385_2740477_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2741215_2743888_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2743904_2744555_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2744610:2744645	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2744754_2747604_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2747878_2748655_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2748659_2750309_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_162630518.1|2750309_2754704_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2755505_2756828_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2757521_2758160_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_085948178.1|2758197_2759410_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000881316.1|2759450_2759975_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2760124_2760562_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2760558_2761056_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2761055_2761271_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2761413_2761812_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2761892_2762051_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2763143_2763767_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2763763_2764429_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2764425_2765028_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2765002_2765569_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2766116_2767049_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2767087_2767915_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2768418_2768601_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2768757_2769102_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2769207_2769426_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2769403_2770474_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2770468_2771095_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2771091_2772780_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2772928_2775556_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2776496:2776531	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 13
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	3125282	3209907	5238870	protease,tRNA,portal,integrase,tail,terminase,transposase	Enterobacteria_phage(68.52%)	86	3193264:3193279	3216711:3216726
WP_001298974.1|3125282_3126020_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3126151_3127486_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3127695_3128577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3128680_3129268_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3129323_3129707_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3130010_3130700_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3130747_3131785_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3131991_3132411_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3132479_3133178_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3133209_3135870_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3135983_3137339_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3137363_3137708_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3137704_3139003_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3144855_3147429_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3147558_3148290_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3148286_3149267_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3149401_3150139_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3150409_3150751_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3150854_3150902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3151000_3152161_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3152203_3153325_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3153335_3154406_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3154615_3154981_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3155130_3155649_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3155638_3156865_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3156880_3157363_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3157439_3157787_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3157828_3158596_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3158626_3159175_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3159193_3159442_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3159690_3161052_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189267.1|3161143_3162010_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3162030_3163317_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3163371_3163965_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3164087_3164966_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3165051_3166713_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3166861_3167203_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3167264_3167555_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3167544_3168021_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3168152_3168635_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3169483_3169732_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3170099_3170369_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000279058.1|3170370_3171693_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001230455.1|3171757_3172357_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|3172424_3175901_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|3176147_3176780_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3176725_3177469_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3177474_3178173_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3178172_3178502_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_085948178.1|3181050_3182263_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|3182266_3182413_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_000974958.1|3182425_3183049_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|3183051_3183333_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3183325_3183652_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3183739_3185764_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3185708_3187211_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|3187210_3187423_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3187419_3189543_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|3189539_3190016_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3190490_3190676_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|3191679_3191949_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_112033838.1|3191958_3192906_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	1.6e-170
3193264:3193279	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001204849.1|3193412_3193847_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3193839_3194034_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3194030_3194636_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000211413.1|3195433_3196138_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001254256.1|3196412_3196595_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3196591_3197119_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3197115_3197562_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3197518_3197755_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3197765_3197981_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3198113_3198392_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|3198461_3198731_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131492.1|3198730_3200167_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3200156_3201056_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3201048_3201195_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_001177653.1|3201229_3201508_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_085948178.1|3201600_3202813_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000532424.1|3203044_3203557_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_001111331.1|3203570_3203864_+	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_001214463.1|3203874_3204042_+	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001289947.1|3204038_3204638_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_112033839.1|3204639_3205911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	7.0e-182
WP_000448925.1|3205949_3206366_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3206438_3208187_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3208188_3209907_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
3216711:3216726	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 14
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	3281435	3288575	5238870		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3281435_3283997_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3284102_3284759_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272549.1|3284809_3285607_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3285772_3286681_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3286677_3287940_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3287936_3288575_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	3537677	3593653	5238870	tRNA,transposase,protease	Escherichia_phage(40.0%)	50	NA	NA
WP_001297457.1|3537677_3538436_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|3538491_3539235_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000193113.1|3539221_3540331_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160333632.1|3540334_3541195_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|3541191_3541941_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|3541966_3542452_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|3542462_3542891_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252647.1|3543009_3545808_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|3546066_3546987_-	agmatinase	NA	NA	NA	NA	NA
WP_000758903.1|3547122_3547854_-	membrane protein	NA	NA	NA	NA	NA
WP_001344776.1|3547999_3549976_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001338822.1|3549984_3550116_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3550251_3550467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3550770_3551925_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3552360_3553755_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3553831_3554329_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3554423_3555131_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3555210_3555942_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3555954_3556905_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3556941_3557577_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3557576_3557993_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055633.1|3558168_3559149_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3559166_3559871_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3559888_3560455_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3560451_3560742_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3560749_3561343_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239919.1|3561335_3562472_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3562785_3563772_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|3563816_3564320_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378946.1|3564319_3565621_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745216.1|3565676_3566684_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394117.1|3566800_3567847_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3568022_3568742_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3568925_3569252_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3569251_3569971_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3570131_3571184_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3571211_3571487_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3571551_3572631_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3572832_3574089_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839773.1|3574138_3576274_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234516.1|3576671_3577379_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3578774_3579988_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085948178.1|3580773_3581986_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001121747.1|3584025_3585675_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000953028.1|3586283_3587273_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
WP_000609741.1|3587321_3587996_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000823907.1|3589912_3590731_-	YjiK family protein	NA	NA	NA	NA	NA
WP_001358534.1|3590858_3592004_-	type III secretion system LEE effector EspG	NA	NA	NA	NA	NA
WP_000878223.1|3592490_3593357_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.9e-51
WP_000169527.1|3593353_3593653_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	4833787	4868778	5238870	holin,tRNA,head,tail,capsid,terminase	Stx2-converting_phage(48.28%)	33	NA	NA
WP_001047110.1|4833787_4834540_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4834849_4835002_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4835819_4837670_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|4838118_4838325_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4838324_4838822_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4839038_4839224_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4839751_4840066_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958398.1|4840966_4841530_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4841526_4843188_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4843251_4845189_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4845233_4845455_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4847818_4848145_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4848154_4848505_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4848501_4848948_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4848944_4849289_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4849355_4850072_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4850077_4850452_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4850547_4850757_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4850808_4854051_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4854043_4854385_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4854384_4855083_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4855093_4855837_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4855782_4856415_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_112033856.1|4856650_4860127_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
WP_001216290.1|4860195_4860819_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4860883_4862197_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4862198_4862468_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4862628_4863051_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4863181_4864240_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4864318_4864969_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4865151_4865742_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4866243_4866492_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4867740_4868778_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	4952366	4998901	5238870	transposase,protease	Escherichia_phage(25.0%)	37	NA	NA
WP_085948178.1|4952366_4953579_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001239084.1|4953948_4963620_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|4965493_4966168_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953030.1|4966216_4967206_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
WP_085948178.1|4969903_4971117_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072098057.1|4972544_4973159_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
WP_001345309.1|4973598_4974393_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4974463_4974913_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4974954_4975182_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4975186_4975501_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4975507_4975903_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4976229_4976505_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4976633_4977320_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4977319_4978174_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4978183_4978834_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|4978847_4979312_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|4979321_4979627_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|4979642_4981040_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4981394_4982459_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4982566_4983322_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569730.1|4983318_4984068_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|4984249_4984579_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4984727_4985003_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4985119_4986745_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|4986828_4987992_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|4987994_4988633_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4988642_4989041_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|4989058_4989718_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4989768_4990467_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4990485_4990887_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|4991013_4991745_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|4991924_4994285_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|4994323_4994749_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4994953_4996252_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4996355_4996553_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4996634_4997639_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4997641_4998901_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 1
NZ_CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	0	8849	117123	transposase	Salmonella_phage(50.0%)	8	NA	NA
WP_001293471.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
WP_085948178.1|1402_2615_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_162630519.1|2581_2920_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.4e-06
WP_085948178.1|4049_5262_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_112033863.1|5611_6652_-	regulator	NA	J9Q7Z3	Salmonella_phage	89.9	4.9e-117
WP_001090697.1|6769_7201_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_001240351.1|7740_8304_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_000066497.1|8633_8849_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
>prophage 2
NZ_CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	20286	78973	117123	portal,tail,tRNA,transposase,terminase	Salmonella_phage(84.38%)	71	NA	NA
WP_000122502.1|20286_21429_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011861.1|21506_22376_+	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_162630522.1|22547_23651_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	8.4e-192
WP_001348729.1|23652_24066_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
WP_160378288.1|24068_24539_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_000386469.1|24538_25183_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_001718079.1|25244_25664_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_016607532.1|25673_26231_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_053902537.1|26389_27199_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
WP_000559568.1|27382_27976_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_032203380.1|28161_28392_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_162630521.1|28922_29570_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.3	1.1e-98
WP_021533181.1|29715_30210_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	8.8e-24
WP_021533180.1|30219_30417_+	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
WP_021533179.1|30510_30936_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
WP_014962273.1|30935_31094_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001718087.1|31233_31803_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_021533177.1|31858_32140_+	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
WP_000467662.1|32142_32757_+	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_001090447.1|32860_34546_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
WP_052988679.1|34607_35312_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
WP_053271998.1|35311_35692_+	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
WP_053271999.1|35830_36286_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	60.2	1.2e-19
WP_053272000.1|36282_36849_+	ead/Ea22-like family protein	NA	A0A222YWM9	Escherichia_phage	59.5	1.7e-42
WP_053272001.1|36823_37009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112033872.1|37008_37926_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	44.2	2.3e-46
WP_000108705.1|38302_38929_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	3.3e-07
WP_000506720.1|39730_40120_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000004356.1|40157_41258_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_021547919.1|41415_43449_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_001717178.1|43688_43910_+	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
WP_000910476.1|43946_44132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520100.1|44294_44855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089568284.1|46385_46715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|46868_47180_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_047659410.1|47306_47702_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_086118731.1|48546_48828_+	ABC transporter	NA	J9Q753	Salmonella_phage	77.4	1.1e-36
WP_001009193.1|49032_49515_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_059277742.1|50124_50352_-	hypothetical protein	NA	A0A1S6KV93	Providencia_phage	41.3	2.5e-05
WP_000255469.1|50372_50576_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_029305755.1|50625_51276_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_023145147.1|51571_52093_-	repressor of phase-1 flagellin	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_061158056.1|52195_52996_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.3	6.0e-06
WP_061158055.1|53381_53981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291061.1|54013_54292_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_061158054.1|54294_55854_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.3e-278
WP_000382660.1|55936_56617_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_000161986.1|56616_57285_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_061158053.1|57281_57947_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000129633.1|57943_58834_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_000176292.1|58843_59110_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_048958825.1|59308_59941_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.3	1.2e-89
WP_001007299.1|59940_61197_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000422361.1|61223_62798_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	2.4e-285
WP_061158052.1|62819_63707_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.1e-130
WP_061158051.1|63732_64608_+	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	1.5e-154
WP_061158050.1|64681_65602_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	1.3e-132
WP_061158049.1|65646_66081_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
WP_061158048.1|66080_66914_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
WP_001027663.1|66993_67338_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|67328_67802_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_061158047.1|67803_68187_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_048958837.1|68261_69008_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
WP_000163861.1|69063_69381_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000952686.1|69506_69731_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_089568136.1|69738_74298_+	tape measure protein	NA	J9Q712	Salmonella_phage	80.0	0.0e+00
WP_053900116.1|74340_74676_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.8e-52
WP_000511445.1|74758_75457_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_089568137.1|75449_76247_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.2	1.9e-153
WP_024171470.1|76234_76828_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
WP_085948178.1|77760_78973_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 3
NZ_CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	84341	104640	117123	tail,transposase	Salmonella_phage(88.24%)	22	NA	NA
WP_112033869.1|84341_87005_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	39.2	2.2e-68
WP_000064175.1|87207_87531_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_012640731.1|87544_88237_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
WP_000901559.1|88238_88490_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_112033868.1|88658_89180_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001351987.1|89187_89457_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|89699_90913_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000161228.1|91088_91757_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160378290.1|91762_92116_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000342417.1|92168_92936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717320.1|93218_93959_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_032203361.1|94002_95343_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.3	9.8e-235
WP_162630520.1|95490_96606_+	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.1e-204
WP_059244885.1|96597_97743_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000038288.1|97973_98387_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
WP_104772315.1|98512_99295_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
WP_112033866.1|99575_99833_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	56.6	5.6e-14
WP_104772314.1|99829_101152_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	3.4e-240
WP_000636536.1|101148_101364_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_000067985.1|101509_101800_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_001755525.1|103312_104221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072328049.1|104394_104640_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	3.5e-13
>prophage 1
NZ_CP028431	Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence	76698	2288	61638	76698	transposase	Escherichia_phage(23.08%)	53	NA	NA
WP_000937595.1|2288_3476_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|3475_3841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997720.1|3979_4234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034091.1|4740_8706_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_085952195.1|9025_10239_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_000445936.1|10878_11274_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921961.1|11273_12233_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_077629034.1|12505_13408_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086162.1|13792_14164_+	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_000937595.1|14270_15458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|15457_15823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072106536.1|16195_16498_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271680.1|16544_16967_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|16963_17155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|18192_18423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170683.1|18474_19836_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_071600428.1|20596_20857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175643.1|20907_21102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290792.1|21329_21857_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
WP_000006004.1|21912_22146_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145472.1|22204_24163_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
WP_000845949.1|24217_24652_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|24648_25368_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|25379_25568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|25647_25806_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032351767.1|26306_26495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|26727_27015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|27135_27957_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_001151524.1|29176_29560_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283394.1|29746_30436_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001309237.1|30534_30930_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994781.1|30962_31322_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012104.1|31336_31648_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399800.1|31669_32236_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|32246_32951_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146670.1|32950_34378_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002783.1|34367_34958_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001369729.1|34944_35067_+	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|36848_38062_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000628099.1|39778_40288_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850424.1|40301_41033_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001369365.1|41285_43439_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000986985.1|43438_48709_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205714.1|48728_49475_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
WP_000704529.1|49533_50394_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139321.1|50496_51057_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001171554.1|51206_51587_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000998093.1|51981_53520_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
WP_001302181.1|53823_54822_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550555.1|54895_56617_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|56710_57817_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|57816_58638_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000937595.1|60450_61638_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
