The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	10290	50169	2290452	protease,transposase,tRNA,bacteriocin	Bacillus_phage(30.0%)	42	NA	NA
WP_004050249.1|10290_11043_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004050247.1|11194_11638_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004050245.1|11651_12044_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_191981800.1|12234_12948_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.6	5.9e-29
WP_172395775.1|12872_13796_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
WP_112193161.1|14079_15357_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_112193159.1|15370_16153_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_112193156.1|16312_18472_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.4e-43
WP_112193154.1|18861_19113_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193152.1|19362_19590_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112195885.1|19735_20074_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056958175.1|20248_20935_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193150.1|21057_22479_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.2	1.3e-40
WP_112195883.1|22566_23043_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_167397193.1|23991_24231_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_112193148.1|24332_25259_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_112193146.1|25303_26239_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004047940.1|26163_26691_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_112193144.1|26867_28031_-	MFS transporter	NA	NA	NA	NA	NA
WP_112193142.1|28105_29443_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.1e-23
WP_112193140.1|29709_30633_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_112193138.1|30629_31310_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_112193136.1|31309_32407_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_004051243.1|33194_34187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004051241.1|34232_35687_-	APC family permease	NA	NA	NA	NA	NA
WP_112193130.1|35888_38003_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_112193128.1|38057_38687_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	1.2e-30
WP_112193126.1|38910_39426_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.9	7.5e-10
WP_112193124.1|40049_40541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193122.1|40552_41224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286306.1|41409_41736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626384.1|41987_42407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193116.1|42438_44070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004051213.1|44088_44757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004051212.1|44753_45197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089135702.1|45207_45666_+	DUF5085 family protein	NA	NA	NA	NA	NA
WP_004051207.1|45680_45938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004051204.1|46154_46280_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004051193.1|46518_46995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004051191.1|47307_48240_+	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	43.3	1.8e-62
WP_004051189.1|48240_49380_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.1	4.7e-20
WP_112195881.1|49506_50169_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	275335	371172	2290452	transposase,protease,tail,integrase,holin,capsid,tRNA	Lactobacillus_phage(30.19%)	108	305309:305325	337839:337855
WP_112195620.1|275335_276307_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_076150027.1|276510_276942_+	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	46.8	1.6e-29
WP_112195618.1|278572_279178_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010689444.1|279179_279632_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_112195616.1|279858_281595_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.5	1.7e-58
WP_089135379.1|281613_281928_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004048359.1|281948_282548_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_039936044.1|282562_282802_+	YaaL family protein	NA	NA	NA	NA	NA
WP_076150030.1|282926_283559_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.8	9.5e-47
WP_004048354.1|283569_283893_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_112195614.1|284015_285008_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	35.9	5.0e-42
WP_010689434.1|285029_285380_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	37.8	4.2e-12
WP_112195612.1|285379_286261_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	54.3	1.0e-78
WP_112195610.1|286275_287016_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_004048344.1|287075_288053_-	asparaginase	NA	NA	NA	NA	NA
WP_004048342.1|288257_288980_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_112195608.1|288963_289566_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_112286328.1|289544_290576_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	9.0e-63
WP_112195604.1|291116_293075_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	1.4e-48
WP_076150038.1|293244_293874_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_112195602.1|293911_294550_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_112286329.1|294757_295042_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	48.4	5.6e-15
WP_004048330.1|295089_296706_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.0	1.2e-157
WP_112195600.1|296880_298710_+	APC family permease	NA	NA	NA	NA	NA
WP_112195598.1|298873_299968_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_112195596.1|300013_300661_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	49.0	4.7e-49
WP_112286330.1|300814_302161_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	36.7	3.0e-58
WP_112286331.1|302138_302831_+	ComF family protein	NA	NA	NA	NA	NA
WP_004048318.1|302981_303536_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004048315.1|303693_306054_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
305309:305325	attL	TTTCACTTGAAGATGAT	NA	NA	NA	NA
WP_191983786.1|306128_307244_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_112286517.1|307265_307961_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.7	3.2e-27
WP_112286333.1|307941_308829_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_112286334.1|309061_310204_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_191983787.1|310243_310963_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	36.1	1.9e-35
WP_112286335.1|310955_312335_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.9	1.5e-12
WP_004048292.1|312360_312684_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_004048289.1|312685_313042_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_112195574.1|313246_314191_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_112195573.1|314201_315044_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_112286336.1|315117_316044_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	1.5e-85
WP_162626389.1|317271_317442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195569.1|317454_317880_-	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_039936094.1|318517_318907_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_112195971.1|318958_319144_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	44.4	4.4e-05
WP_112195567.1|319642_320782_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.9	1.7e-54
WP_112195565.1|320891_322619_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	57.2	3.8e-191
WP_112195563.1|322743_324744_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_112195561.1|324762_327609_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.4	4.5e-306
WP_004048276.1|327675_328149_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_191981797.1|328312_328975_+	serine dehydratase	NA	NA	NA	NA	NA
WP_112195559.1|328988_329879_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_112195557.1|329988_330876_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.8	7.6e-10
WP_056958089.1|330875_331892_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	59.1	8.0e-104
WP_004048264.1|331904_332858_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.8	1.6e-50
WP_112195555.1|333014_334067_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004048260.1|334128_334719_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	4.0e-55
WP_191981796.1|334879_335242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195967.1|335258_335387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_112195553.1|336109_337198_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	51.5	4.0e-101
WP_112195551.1|337350_338085_-	hypothetical protein	NA	NA	NA	NA	NA
337839:337855	attR	TTTCACTTGAAGATGAT	NA	NA	NA	NA
WP_112195549.1|338143_338554_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_174238768.1|338568_338907_-	helix-turn-helix domain-containing protein	NA	A8ATX5	Listeria_phage	42.1	3.8e-10
WP_112195545.1|339076_339277_+	XRE family transcriptional regulator	NA	Q6SEA0	Lactobacillus_prophage	56.5	4.1e-12
WP_112195543.1|339312_340041_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	46.8	2.4e-46
WP_112195965.1|340062_340404_+	DUF771 domain-containing protein	NA	X2CYF0	Lactobacillus_phage	46.8	5.7e-14
WP_112195541.1|340500_340692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195539.1|340675_340855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195537.1|340933_341254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195535.1|341250_341523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195533.1|341523_342501_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	50.4	2.3e-63
WP_162626456.1|342553_343327_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	56.1	1.7e-77
WP_162626390.1|343336_343480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195529.1|343548_344391_+	helix-turn-helix domain-containing protein	NA	A0A0E3Y6I4	Fusobacterium_phage	56.0	1.0e-27
WP_112195527.1|344394_345249_+	hypothetical protein	NA	A0A0P0I3L9	Lactobacillus_phage	33.6	1.2e-33
WP_112193438.1|345750_347004_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
WP_112286337.1|347614_347944_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_112286338.1|348016_348400_+	helix-turn-helix transcriptional regulator	NA	Q9T1H4	Lactobacillus_phage	45.8	4.3e-10
WP_112286339.1|348564_349119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286340.1|349122_349383_+	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	54.3	1.1e-17
WP_162626391.1|349426_349654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193438.1|349732_350986_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
WP_112286342.1|351182_351878_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	59.9	4.5e-50
WP_112286343.1|351864_352092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626392.1|352203_352782_+	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	35.3	2.0e-19
WP_112195514.1|352793_353669_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	62.5	8.1e-97
WP_112195512.1|353685_354075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195510.1|354068_354434_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	41.6	1.1e-20
WP_112195508.1|354433_354790_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	39.7	2.3e-13
WP_160192574.1|354789_355188_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_112195504.1|355203_355767_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	50.6	2.1e-37
WP_112286345.1|355819_356278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286346.1|356283_356928_+	hypothetical protein	NA	O03936	Lactobacillus_phage	41.0	1.8e-32
WP_112286347.1|356932_357592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193438.1|357636_358890_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
WP_112286519.1|359659_362875_+	transglycosylase SLT domain-containing protein	NA	Q6SE70	Lactobacillus_prophage	46.0	5.2e-56
WP_112286348.1|362861_363581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_182465656.1|363580_365533_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	36.3	1.4e-72
WP_112286349.1|365547_366435_+	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	40.1	1.2e-18
WP_112195493.1|366451_366919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195490.1|366937_367315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195488.1|367316_367448_+	XkdX family protein	NA	NA	NA	NA	NA
WP_112195486.1|367463_367973_+	Ig-like domain-containing protein	NA	A0A1P8BL30	Lactococcus_phage	42.0	7.7e-07
WP_112195484.1|367978_368968_+	hypothetical protein	NA	X2KUF9	Streptococcus_phage	38.5	4.3e-22
WP_112195481.1|369005_369380_+	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	49.6	7.1e-26
WP_112195479.1|369386_369578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195477.1|369568_369916_+|holin	holin	holin	A0A0P0IQR4	Lactobacillus_phage	43.9	5.8e-14
WP_191981793.1|369915_371172_+	LysM peptidoglycan-binding domain-containing protein	NA	V5UQT2	Oenococcus_phage	58.5	1.6e-133
>prophage 3
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	422649	431226	2290452		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_004048171.1|422649_423945_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.2e-18
WP_004048170.1|424293_425013_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	3.1e-38
WP_004048169.1|425012_425261_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_112195413.1|425260_425944_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_112195411.1|425943_428169_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	3.7e-146
WP_112195409.1|428144_429599_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	3.2e-58
WP_112195407.1|429595_430636_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	40.6	3.0e-58
WP_112195405.1|430647_431226_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	35.6	1.9e-22
>prophage 4
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	450217	507678	2290452	transposase,tRNA,integrase	Streptococcus_phage(16.67%)	49	507004:507021	507719:507736
WP_004048114.1|450217_450862_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004048111.1|450938_451256_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004048109.1|451276_451918_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_004048107.1|452066_454229_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.9	5.9e-88
WP_004048104.1|454306_455131_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004048102.1|455403_456150_+	esterase family protein	NA	NA	NA	NA	NA
WP_004048100.1|456169_457342_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004048099.1|457456_458788_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_004048098.1|458870_460601_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	A0A076G4Q2	Staphylococcus_phage	24.1	2.2e-05
WP_004048097.1|460765_461209_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004048096.1|461252_461954_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_112195395.1|462041_463403_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.0e-42
WP_004048093.1|463511_463787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195393.1|464102_467345_+	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_004048088.1|467370_468810_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	27.7	8.5e-27
WP_112286352.1|468806_470330_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.7	7.7e-10
WP_112195387.1|470292_470784_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_112195957.1|470954_471923_+	Abi family protein	NA	NA	NA	NA	NA
WP_004048084.1|472073_472883_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	27.4	1.5e-17
WP_112195389.1|472932_473508_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_162626393.1|473467_474679_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004048078.1|474832_477505_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	31.5	9.6e-40
WP_004048076.1|477524_478355_+	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	29.0	1.5e-28
WP_089135892.1|478351_478957_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_004048072.1|478974_479445_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_112195383.1|479462_480830_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_076150261.1|480846_481776_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	37.4	6.3e-31
WP_112195381.1|482070_484023_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.4	1.0e-107
WP_112286354.1|486079_486337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195377.1|486587_486845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195376.1|487177_487444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626394.1|487692_488475_+	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	37.0	2.0e-38
WP_112195372.1|488599_488845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286355.1|489080_489911_+	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	36.3	8.9e-45
WP_112195368.1|489916_490180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195366.1|490438_490699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193146.1|490978_491914_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004047940.1|491838_492366_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_112286356.1|492530_497249_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	27.0	3.1e-49
WP_112195360.1|498062_498545_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.2	1.6e-06
WP_112195358.1|498859_499114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195356.1|499154_499412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076150269.1|499664_499853_+	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	67.7	3.7e-15
WP_167397199.1|499931_500315_+	type II toxin-antitoxin system HicB family antitoxin	NA	F0PIL2	Enterococcus_phage	53.2	2.8e-33
WP_112195353.1|500810_501248_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_112195351.1|501509_502841_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_112195349.1|502970_504665_+	oleate hydratase	NA	NA	NA	NA	NA
WP_112195347.1|506093_506933_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
507004:507021	attL	AGGCGTCATTTTCAACTT	NA	NA	NA	NA
WP_112195345.1|507081_507678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFL0	Streptococcus_phage	34.6	9.6e-17
WP_112195345.1|507081_507678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFL0	Streptococcus_phage	34.6	9.6e-17
507719:507736	attR	AAGTTGAAAATGACGCCT	NA	NA	NA	NA
>prophage 5
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	516532	590701	2290452	protease,transposase,tRNA,integrase	Lactobacillus_phage(30.0%)	81	569600:569616	597202:597218
WP_004048827.1|516532_517495_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_112286358.1|517545_518394_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_112195326.1|518535_519468_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.7	3.3e-80
WP_112195324.1|519549_520065_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_162626396.1|520458_521700_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_076150067.1|521718_523338_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.3	1.3e-108
WP_112286521.1|523435_523903_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_162626397.1|524293_524815_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_076150286.1|524964_525558_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_112195316.1|525547_528607_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_162626398.1|528629_528803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004048026.1|530135_530501_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004048025.1|530487_530769_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112195314.1|531213_532179_+	ADP-ribosylglycohydrolase family protein	NA	A0A1I9SA26	Rhodococcus_phage	30.3	9.2e-17
WP_112286361.1|532534_535570_+	replication ATP-dependent helicase	NA	NA	NA	NA	NA
WP_112286522.1|535893_536208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286362.1|536200_537730_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056960100.1|537922_538231_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_112195305.1|538252_538579_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_004048016.1|538601_538883_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_112195303.1|539019_539898_-	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	34.4	2.9e-17
WP_004048013.1|540111_540834_+	UMP kinase	NA	NA	NA	NA	NA
WP_004048012.1|540842_541406_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_112195301.1|541511_542288_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	49.6	8.7e-26
WP_112195299.1|542287_543076_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_112195297.1|543109_544384_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_112195295.1|544411_546133_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_112195293.1|546202_550543_+	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	30.2	7.3e-13
WP_112195291.1|550784_552497_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.8e-93
WP_112286363.1|552823_557047_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_112195287.1|557128_557605_+	ParB N-terminal domain-containing protein	NA	L0P6I1	Lactobacillus_phage	47.6	4.1e-34
WP_004047998.1|557819_558290_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_112195285.1|558319_559477_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_010689155.1|559488_559788_+	YlxR family protein	NA	NA	NA	NA	NA
WP_004047992.1|559777_560092_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_112195283.1|560164_562480_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	3.2e-23
WP_004047989.1|562504_562870_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_112195281.1|562955_563861_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_112195279.1|563875_564823_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_112195277.1|564911_565940_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_056960075.1|565969_566545_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_112195275.1|566568_568413_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	48.6	8.7e-141
WP_112195273.1|568541_569669_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	24.6	1.5e-23
569600:569616	attL	TTCAGGTGATGAAGTTG	NA	NA	NA	NA
WP_112195270.1|569961_571059_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	49.2	2.0e-92
WP_112195268.1|571288_572203_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	26.6	7.9e-10
WP_112195266.1|572267_573275_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	44.7	5.0e-74
WP_162626399.1|573607_573781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195264.1|573752_574715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195262.1|574854_575049_+	hypothetical protein	NA	A0A0A7NNT6	Lactobacillus_phage	68.9	9.7e-19
WP_112195260.1|575038_575620_-	TIR domain-containing protein	NA	A0A0S2MYG4	Enterococcus_phage	59.9	4.5e-59
WP_112195258.1|575622_576057_-	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	44.9	2.5e-22
WP_112195256.1|576156_577263_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_112195254.1|577263_577626_-	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	38.9	1.2e-14
WP_153551268.1|577910_578078_+	XRE family transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	39.6	6.8e-05
WP_112195250.1|578081_578402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195248.1|578389_579109_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	55.5	2.0e-69
WP_162626400.1|579129_579480_+	DUF771 domain-containing protein	NA	B8R678	Lactobacillus_phage	41.4	1.2e-14
WP_112195244.1|579620_579830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195242.1|580119_580302_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112195240.1|580308_580488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195238.1|580566_580881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195236.1|580884_581109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195234.1|581105_581318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195232.1|581310_582357_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	57.8	5.4e-71
WP_167397200.1|582412_583183_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	55.7	1.7e-77
WP_162626401.1|583192_583336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195222.1|583402_584350_+	hypothetical protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	47.0	5.8e-32
WP_112195220.1|584346_584613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167397195.1|584770_584914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195951.1|585025_585223_+	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	44.1	3.6e-05
WP_112195218.1|585219_585624_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	43.0	8.2e-28
WP_162626402.1|586008_586164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195216.1|586160_586547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195214.1|586611_587076_+	DUF1492 domain-containing protein	NA	O03925	Lactobacillus_phage	31.4	8.0e-11
WP_162626403.1|587362_587500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167397196.1|587499_587667_+	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	56.9	7.3e-07
WP_112286364.1|587913_588267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076150347.1|588242_588614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195203.1|588867_589080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004048385.1|589139_589853_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.0	3.5e-29
WP_172395775.1|589777_590701_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
597202:597218	attR	TTCAGGTGATGAAGTTG	NA	NA	NA	NA
>prophage 6
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	601649	611108	2290452	tRNA	Tupanvirus(16.67%)	10	NA	NA
WP_076149881.1|601649_603416_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	23.3	3.3e-12
WP_004047945.1|603643_604516_+	YitT family protein	NA	NA	NA	NA	NA
WP_112195173.1|604532_605552_+	sugar transferase	NA	NA	NA	NA	NA
WP_112195171.1|605548_606325_+	glycosyl transferase	NA	A0A1V0SBR5	Catovirus	35.6	2.3e-10
WP_004047942.1|606325_607276_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	29.1	2.1e-05
WP_112195169.1|607291_608194_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	34.6	4.0e-22
WP_004047936.1|608252_609068_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003694124.1|609347_609533_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004047933.1|609554_610001_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	34.8	1.6e-11
WP_112195167.1|610124_611108_+	PhoH family protein	NA	W8D063	Erwinia_phage	48.8	2.1e-48
>prophage 7
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	619160	686482	2290452	protease,transposase,tRNA,integrase	Bacillus_phage(10.0%)	59	622966:622983	672761:672778
WP_004047915.1|619160_620078_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_112195155.1|620077_622156_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_112286365.1|622937_624941_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	34.2	4.6e-95
622966:622983	attL	AAGCTGTAAAACCAAATA	NA	NA	NA	NA
WP_112195151.1|624942_627921_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	29.2	8.6e-90
WP_112195945.1|628200_630048_+	DNA primase	NA	S5M810	Pseudoalteromonas_phage	52.0	1.0e-16
WP_004047907.1|630062_631187_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.2	4.2e-37
WP_112195149.1|631356_632562_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_112195145.1|633011_633248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195143.1|633285_633615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039935990.1|633731_634040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195141.1|634062_634785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004047775.1|635136_635556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004047774.1|635850_636201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195139.1|636217_636628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195137.1|637043_637313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626405.1|637644_637791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193146.1|637819_638755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004047940.1|638679_639207_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_112195135.1|639520_639814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195133.1|639826_640453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112195131.1|640592_641387_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_112195129.1|641448_641976_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	5.3e-11
WP_162626406.1|642037_643219_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_112195125.1|643632_644331_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_112195123.1|644323_645439_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A167RQW5	Powai_lake_megavirus	42.7	3.3e-18
WP_112195121.1|645457_646702_+	peptidase T	NA	NA	NA	NA	NA
WP_112195119.1|646755_649353_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.3	2.9e-126
WP_004047900.1|649388_649586_-	YjzD family protein	NA	NA	NA	NA	NA
WP_112195117.1|649804_653110_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	31.5	1.1e-133
WP_004047896.1|653238_654201_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004047895.1|654314_656075_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_112195115.1|656231_657224_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_112195113.1|657709_659002_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_004047892.1|659047_659758_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_112286367.1|659763_660927_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_112195109.1|660926_661850_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004047889.1|661846_662626_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_112195107.1|662643_663720_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_112195105.1|663802_665062_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_089135322.1|665097_665931_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_112195103.1|666140_667013_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.4	7.9e-52
WP_112195101.1|667295_668507_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.8	9.3e-43
WP_112195099.1|668507_670388_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.4e-53
WP_112195097.1|670436_671393_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.4	2.4e-118
WP_004047871.1|671409_671910_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.2	4.4e-31
WP_112195095.1|671954_672557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112195092.1|672697_673642_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
672761:672778	attR	TATTTGGTTTTACAGCTT	NA	NA	NA	NA
WP_004047868.1|673643_674246_+	YpmS family protein	NA	NA	NA	NA	NA
WP_004047867.1|674260_674482_+	YozE family protein	NA	NA	NA	NA	NA
WP_112195090.1|674482_675937_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.9	3.1e-24
WP_004047865.1|676039_676567_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004047864.1|676619_677474_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_162626458.1|677535_678303_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.1	4.0e-23
WP_004047862.1|678345_679206_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	31.8	1.6e-20
WP_056958384.1|679355_681470_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.9	1.7e-100
WP_004047860.1|681485_682799_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_004047859.1|683027_683927_+	tyrosine recombinase XerC	NA	T2KT84	uncultured_phage	36.7	5.4e-11
WP_004047858.1|683943_684486_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_089135191.1|685057_686482_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	26.4	4.8e-30
>prophage 8
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	925812	935616	2290452	protease,transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_112194781.1|925812_927342_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	27.6	1.5e-21
WP_004048888.1|927341_928028_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	3.6e-31
WP_112286381.1|928402_930058_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.7e-93
WP_112194779.1|930063_931488_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	3.9e-40
WP_112194777.1|931568_932804_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.8	3.3e-136
WP_004048893.1|932973_934260_-	trigger factor	NA	NA	NA	NA	NA
WP_112194775.1|934428_935616_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.7	8.0e-31
>prophage 9
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	1089273	1150226	2290452	transposase,tRNA	Enterococcus_phage(16.67%)	54	NA	NA
WP_112286402.1|1089273_1090209_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004049258.1|1090362_1090686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004049259.1|1091143_1091677_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_004049260.1|1091678_1092281_-	XTP/dITP diphosphatase	NA	A0A0N9Z738	Cassava_brown_streak_virus	26.7	1.1e-07
WP_004049261.1|1092415_1092901_+	YslB family protein	NA	NA	NA	NA	NA
WP_004049262.1|1092996_1093308_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.0	6.1e-15
WP_004049265.1|1093388_1095749_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	49.6	3.6e-22
WP_004049267.1|1095738_1096257_-	CvpA family protein	NA	NA	NA	NA	NA
WP_004049269.1|1096264_1096516_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_004049273.1|1096660_1096951_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_004049275.1|1096970_1097411_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_004049284.1|1098560_1098830_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_004049285.1|1099004_1101650_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.0	1.2e-63
WP_004049287.1|1101923_1103255_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	1.1e-49
WP_004049288.1|1103269_1104220_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_004049289.1|1104283_1105369_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004049290.1|1105443_1106922_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KIX9	Synechococcus_phage	33.0	8.4e-70
WP_004049291.1|1107411_1108191_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_004049294.1|1108180_1109041_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_004049296.1|1109027_1110407_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_039936123.1|1110420_1110840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004049302.1|1110840_1111284_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004049306.1|1112033_1112474_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039936149.1|1112552_1112990_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004048389.1|1113344_1114196_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004048391.1|1114311_1116510_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004048393.1|1116538_1118020_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_004048395.1|1118039_1119203_-	galactokinase	NA	NA	NA	NA	NA
WP_004048396.1|1119449_1120460_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.3	1.1e-12
WP_004047940.1|1120540_1121068_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_112286404.1|1120992_1121928_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_112286405.1|1121993_1123232_-	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	54.0	6.1e-106
WP_112286406.1|1123363_1125292_-	MFS transporter	NA	NA	NA	NA	NA
WP_004048405.1|1125586_1128583_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.0	5.9e-147
WP_004048407.1|1128709_1129624_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004048408.1|1129742_1130090_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004048410.1|1130171_1131317_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	3.8e-86
WP_171970319.1|1131445_1132498_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_004048413.1|1132503_1133511_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.4	1.5e-09
WP_004048414.1|1133530_1134136_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_112286407.1|1134207_1136187_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.1	1.5e-61
WP_004048418.1|1136202_1138815_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.3	7.9e-39
WP_010688568.1|1138979_1139183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089135810.1|1139314_1139764_-	universal stress protein	NA	NA	NA	NA	NA
WP_004048424.1|1139928_1140489_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_112194538.1|1140660_1142352_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.4	3.6e-93
WP_004048425.1|1142318_1143746_-	amino acid permease	NA	NA	NA	NA	NA
WP_004048428.1|1143980_1144313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004048430.1|1144353_1144692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004048431.1|1144723_1145179_-	universal stress protein	NA	NA	NA	NA	NA
WP_112193438.1|1145379_1146633_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
WP_112193438.1|1147009_1148263_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
WP_112286408.1|1148403_1148820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193438.1|1148972_1150226_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
>prophage 10
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	1683512	1737505	2290452	transposase,tRNA,bacteriocin	Streptococcus_phage(16.67%)	50	NA	NA
WP_112193666.1|1683512_1683776_-|bacteriocin	leucocin A/sakacin P family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004050805.1|1684473_1685724_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.8e-58
WP_004049841.1|1686197_1686641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193668.1|1686646_1687402_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193670.1|1687475_1688816_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_112193672.1|1688830_1690426_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_112193674.1|1692511_1692982_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193676.1|1692997_1693705_-	protein jag	NA	NA	NA	NA	NA
WP_112193679.1|1693971_1694823_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.9	9.1e-53
WP_112193681.1|1694843_1696760_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.0	3.2e-69
WP_112193683.1|1696877_1698449_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_112193692.1|1698497_1698980_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_112193694.1|1698969_1699806_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_004049819.1|1699963_1700749_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_112193696.1|1700813_1701485_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_112193698.1|1701522_1703265_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_112193700.1|1703292_1704042_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_112193702.1|1704113_1705712_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_112195899.1|1705875_1707522_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_112193704.1|1707642_1708512_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_112193706.1|1708525_1709485_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_112193708.1|1709507_1710446_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.6e-18
WP_112193710.1|1710438_1711446_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.3e-18
WP_112193712.1|1712109_1713483_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_112193714.1|1713561_1714935_-	amino acid permease	NA	NA	NA	NA	NA
WP_056958365.1|1715363_1715825_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_112193716.1|1715915_1717829_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_112193718.1|1717839_1719231_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004049788.1|1719600_1720020_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193720.1|1720079_1721564_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_112193722.1|1721583_1722138_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_112193724.1|1722344_1724132_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_112193726.1|1724330_1725011_+	VIT family protein	NA	NA	NA	NA	NA
WP_112193728.1|1725017_1725692_+	VIT family protein	NA	NA	NA	NA	NA
WP_112193730.1|1725861_1726173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193732.1|1726184_1726412_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193734.1|1726555_1727332_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_112193736.1|1727337_1728057_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_112193738.1|1728057_1728600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193740.1|1728793_1730161_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_112193743.1|1730173_1732330_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.2e-46
WP_112193745.1|1732463_1732694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162626425.1|1732950_1733769_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162626426.1|1733915_1734650_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162626427.1|1734729_1734909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193753.1|1734956_1735265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193755.1|1735322_1735613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193757.1|1735691_1736204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193759.1|1737088_1737295_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193762.1|1737310_1737505_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	1741467	1811499	2290452	transposase,bacteriocin,integrase	Bacillus_virus(22.22%)	59	1801876:1801928	1804584:1804636
WP_083659256.1|1741467_1741773_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_112193772.1|1741786_1741969_-|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193774.1|1742479_1743958_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_112286467.1|1743970_1745857_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_112193778.1|1745980_1746676_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193780.1|1746792_1747455_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112286468.1|1747529_1748714_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_162626431.1|1748772_1748931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193786.1|1748945_1749716_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_076150147.1|1749712_1750492_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_112193788.1|1750488_1751415_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	5.1e-17
WP_112193790.1|1752054_1754031_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1P8BMM5	Lactococcus_phage	40.3	1.7e-62
WP_112193792.1|1754179_1755958_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_112193794.1|1756256_1757348_-	phosphoesterase	NA	NA	NA	NA	NA
WP_112193796.1|1757476_1758145_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_112193798.1|1758245_1758500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193800.1|1758559_1759795_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_112193802.1|1759920_1761201_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_004049746.1|1761392_1761560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193804.1|1761564_1762881_-	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_112193806.1|1762873_1764391_-	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_112286469.1|1764409_1766764_-	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_162626432.1|1766764_1767658_-	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
WP_112286470.1|1767638_1769168_-	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_112193812.1|1769179_1770706_-	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
WP_162626433.1|1770726_1771956_-	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
WP_148458346.1|1772222_1772465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191981802.1|1772505_1772934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191981803.1|1772958_1773672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191983782.1|1774056_1775664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191983783.1|1778760_1782429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191983784.1|1782587_1784813_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_112193816.1|1785284_1786205_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	44.1	3.2e-51
WP_112193818.1|1786204_1787176_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004049718.1|1787277_1788111_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_004049716.1|1788122_1788479_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003701411.1|1788544_1788679_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_112193820.1|1789196_1790543_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_112193822.1|1790717_1791857_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	26.9	9.7e-34
WP_056958863.1|1792105_1792330_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_112193824.1|1792338_1793556_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_112193826.1|1793576_1795535_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.4	4.0e-144
WP_112193829.1|1795632_1798095_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.8	1.7e-112
WP_004049701.1|1799170_1799461_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_112193831.1|1799497_1800052_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	60.5	8.6e-44
WP_003695889.1|1800073_1800310_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_112193833.1|1800889_1801420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004049696.1|1801580_1801787_+	hypothetical protein	NA	NA	NA	NA	NA
1801876:1801928	attL	CGCAGTTTGTAAAATTAAGTTAGAAAAATAAAAAGCCATTTGTGATAGACTTT	NA	NA	NA	NA
WP_112193836.1|1801985_1802513_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_112193838.1|1802628_1803069_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_112193840.1|1803241_1803517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193842.1|1803584_1804547_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_112193844.1|1804807_1805254_+	hypothetical protein	NA	NA	NA	NA	NA
1804584:1804636	attR	AAAGTCTATCACAAATGGCTTTTTATTTTTCTAACTTAATTTTACAAACTGCG	NA	NA	NA	NA
WP_112193846.1|1805284_1805605_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193848.1|1806960_1809120_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.8	5.2e-44
WP_112193850.1|1809133_1810216_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_112193852.1|1810237_1810996_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_082613054.1|1811172_1811313_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193854.1|1811346_1811499_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 12
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	1997479	2053851	2290452	transposase	Paenibacillus_phage(11.11%)	48	NA	NA
WP_172395775.1|1997479_1998403_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
WP_004048385.1|1998327_1999041_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.0	3.5e-29
WP_112194092.1|1999223_2000879_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.0	2.3e-92
WP_112286483.1|2000884_2001697_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_112194097.1|2001712_2002459_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	3.7e-26
WP_010690249.1|2002472_2003171_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004050903.1|2003378_2003795_+	helix-turn-helix transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	40.0	1.7e-07
WP_191981809.1|2003781_2004624_+	YitT family protein	NA	NA	NA	NA	NA
WP_112194099.1|2005015_2006389_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_004050899.1|2006473_2007202_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	42.9	1.2e-40
WP_112194101.1|2007213_2007738_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_112194103.1|2007759_2008071_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	35.8	3.0e-14
WP_112194105.1|2008152_2009001_+	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_004050895.1|2009130_2009895_-	3-oxoacyl-ACP reductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	34.7	9.8e-06
WP_056958533.1|2009894_2010122_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_056958535.1|2010136_2010625_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.9	6.2e-14
WP_112194107.1|2010823_2013847_+	hypothetical protein	NA	L0P6H6	Lactobacillus_phage	38.7	5.8e-09
WP_162626442.1|2014365_2023089_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_112194111.1|2023172_2023814_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.5	1.2e-25
WP_112194113.1|2023803_2025891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112194115.1|2026162_2026588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162626443.1|2026557_2028003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112194119.1|2028472_2029189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112194121.1|2029504_2030644_+	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	30.8	2.3e-11
WP_112194123.1|2030621_2031347_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.3	3.0e-28
WP_112194125.1|2031546_2032311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_112194127.1|2032354_2032732_-	VOC family protein	NA	NA	NA	NA	NA
WP_112194129.1|2032737_2034060_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004050877.1|2034328_2035201_+	ROK family protein	NA	NA	NA	NA	NA
WP_112194131.1|2035271_2035997_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.2	1.2e-16
WP_162626444.1|2036018_2036816_-	cobalt transport protein	NA	NA	NA	NA	NA
WP_112194135.1|2036805_2037825_-	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_004050872.1|2038211_2039420_+	ammonium transporter	NA	NA	NA	NA	NA
WP_112194137.1|2039466_2039985_+	AmiS/UreI family transporter	NA	NA	NA	NA	NA
WP_004050870.1|2040016_2040319_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_004050869.1|2040339_2040684_+	urease subunit beta	NA	NA	NA	NA	NA
WP_004050868.1|2040700_2042422_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_004050866.1|2042524_2042980_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_004050865.1|2042969_2043683_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_004050864.1|2043695_2044325_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_004050862.1|2044335_2045181_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_004050860.1|2045201_2045585_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	40.5	1.7e-06
WP_004050859.1|2045604_2046000_+	CrcB family protein	NA	NA	NA	NA	NA
WP_004050858.1|2046089_2046545_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	7.3e-33
WP_112194139.1|2046618_2047869_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	3.6e-58
WP_004050853.1|2048130_2048847_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004048827.1|2049798_2050761_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_112194141.1|2052174_2053851_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.8e-92
>prophage 13
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	2127487	2184145	2290452	transposase,tRNA	Escherichia_phage(20.0%)	48	NA	NA
WP_112194236.1|2127487_2128774_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	4.1e-97
WP_112194238.1|2128946_2129567_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_112195921.1|2136003_2136270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112194240.1|2136288_2136504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112194242.1|2136593_2137340_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_004049972.1|2137393_2138410_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.2	2.1e-24
WP_004049975.1|2138587_2139955_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_112194244.1|2140240_2140894_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_004049980.1|2140966_2141281_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.0	2.3e-17
WP_004049982.1|2141299_2142226_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.1	2.0e-85
WP_112194246.1|2142270_2142450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167397198.1|2142726_2144052_+	chloride channel protein	NA	NA	NA	NA	NA
WP_112194248.1|2144226_2145402_-	MFS transporter	NA	NA	NA	NA	NA
WP_112195923.1|2145394_2146807_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.1	8.6e-64
WP_112194250.1|2146806_2147628_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_112194252.1|2147664_2148030_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_112194254.1|2148590_2150252_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_162212764.1|2150261_2150984_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_112194256.1|2151177_2153097_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_112194258.1|2153274_2155191_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_112194260.1|2155357_2156362_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.8	2.9e-05
WP_112194262.1|2156606_2157008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112286485.1|2157354_2157594_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_004048827.1|2157543_2158506_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_112286486.1|2158651_2158996_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_112193343.1|2159164_2160439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626445.1|2160956_2161907_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_112193339.1|2162138_2163440_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	25.9	6.8e-23
WP_112193337.1|2163483_2164971_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_112193335.1|2165094_2165526_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	61.7	3.1e-33
WP_135998878.1|2165553_2166261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193330.1|2166411_2168349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193328.1|2168332_2169199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193326.1|2169188_2169941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193324.1|2170103_2170535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193322.1|2170584_2171757_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	85.2	4.5e-119
WP_112286488.1|2171947_2172475_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	9.1e-11
WP_112286489.1|2172777_2173740_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_112286490.1|2176505_2176685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162626446.1|2176805_2177372_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_112286492.1|2177372_2178677_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_112286493.1|2178792_2179020_+	helix-turn-helix transcriptional regulator	NA	A0A1P8BML9	Lactococcus_phage	64.2	2.1e-17
WP_112286528.1|2179062_2180145_+	DNA (cytosine-5-)-methyltransferase	NA	Q83VT0	Escherichia_phage	48.6	1.1e-87
WP_162626447.1|2180465_2180669_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	56.7	1.8e-07
WP_112286495.1|2180643_2181447_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	33.5	9.6e-28
WP_112286496.1|2181700_2182024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_112286497.1|2182020_2182311_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.2	8.8e-08
WP_112286498.1|2183182_2184145_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP023565	Lactobacillus murinus strain CR147 chromosome, complete genome	2290452	2197824	2239913	2290452	protease,transposase,bacteriocin	Lactobacillus_phage(22.22%)	44	NA	NA
WP_112286508.1|2197824_2198280_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	5.6e-33
WP_112286509.1|2198352_2199603_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.4	4.8e-58
WP_004050465.1|2199806_2200472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112286510.1|2200468_2201869_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_112193284.1|2201868_2202435_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_112286511.1|2202618_2203356_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112193279.1|2203520_2204516_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	38.9	3.4e-51
WP_004050454.1|2204785_2205091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056960308.1|2205412_2206450_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_004050451.1|2206567_2207626_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004050449.1|2207618_2208809_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_004050447.1|2208891_2209578_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004050440.1|2211066_2213115_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.7	8.6e-57
WP_004050438.1|2213134_2213584_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_004050436.1|2213887_2214358_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004048385.1|2214893_2215607_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.0	3.5e-29
WP_172395775.1|2215531_2216455_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.1e-22
WP_112193146.1|2216741_2217677_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004047940.1|2217601_2218129_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
WP_004050430.1|2218622_2218967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004050428.1|2219126_2219516_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004050425.1|2219853_2220150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004050422.1|2220180_2220372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004048827.1|2220568_2221531_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_061773580.1|2221634_2222129_+	MFS transporter	NA	NA	NA	NA	NA
WP_129303359.1|2222187_2222439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004050419.1|2222544_2223591_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_004050417.1|2223671_2223950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193273.1|2224383_2224632_+|bacteriocin	leucocin A/sakacin P family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_112193271.1|2224631_2224955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193269.1|2225257_2225737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193265.1|2226164_2226359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112193263.1|2226330_2226666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162626448.1|2226626_2226782_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_112193261.1|2226883_2227720_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112193259.1|2227883_2229674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112193257.1|2229822_2230119_+	cupin	NA	NA	NA	NA	NA
WP_112193255.1|2230369_2232130_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_112193253.1|2232142_2232583_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_191981811.1|2232582_2233734_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_112193249.1|2233854_2235909_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_112193247.1|2236039_2237857_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	38.1	1.9e-100
WP_112193242.1|2238452_2238923_+	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	61.7	1.1e-52
WP_162626449.1|2239415_2239913_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
