The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP019611	Mycobacterium tuberculosis strain H83 chromosome, complete genome	4413214	3721475	3759747	4413214	terminase,integrase,head,capsid,tRNA,protease	Mycobacterium_phage(30.0%)	47	3750276:3750303	3759900:3759927
WP_003413486.1|3721475_3723554_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|3723662_3723890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|3723886_3725272_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|3725616_3726117_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|3726133_3726574_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|3726720_3727398_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|3727382_3727736_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|3727748_3728174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|3728170_3728845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|3728922_3729744_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|3729879_3730773_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|3730775_3731594_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|3731608_3732790_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|3732848_3733280_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|3733793_3735035_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|3735344_3735707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|3736053_3737178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|3737179_3737719_+	archease	NA	NA	NA	NA	NA
WP_010924557.1|3737858_3739157_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|3739195_3739477_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|3739621_3740107_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|3740133_3740388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|3740391_3742728_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|3742756_3742999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|3742999_3743677_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|3743872_3744529_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|3744691_3745138_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|3745312_3745645_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|3745764_3746124_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|3746225_3746684_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|3746819_3747200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|3747196_3748693_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|3748927_3749119_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
3750276:3750303	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|3750409_3750841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|3750837_3751836_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|3751849_3752314_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|3752301_3752553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|3752723_3754163_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|3754170_3754704_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|3754856_3755483_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|3755514_3755838_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|3755917_3756163_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_112704285.1|3756159_3757587_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|3757588_3757981_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|3757977_3758238_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|3758254_3758617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|3758619_3759747_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
3759900:3759927	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP019611	Mycobacterium tuberculosis strain H83 chromosome, complete genome	4413214	3879339	3902394	4413214	tRNA,integrase,transposase	Burkholderia_virus(50.0%)	25	3874581:3874594	3897484:3897497
3874581:3874594	attL	CATCGCCGACCGCC	NA	NA	NA	NA
WP_003899482.1|3879339_3880719_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3880718_3881300_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
WP_003414147.1|3881501_3882398_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003414149.1|3882394_3883078_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_003414151.1|3883074_3884049_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003900574.1|3884193_3884757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414155.1|3884756_3886445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414157.1|3886448_3886775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414158.1|3886905_3887535_+	DUF3558 family protein	NA	NA	NA	NA	NA
WP_003900576.1|3887553_3889203_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_003414166.1|3889304_3889661_-	type II toxin-antitoxin system toxin endoribonuclease MazF9	NA	NA	NA	NA	NA
WP_003901465.1|3889644_3889875_-	antitoxin MazE	NA	NA	NA	NA	NA
WP_003414172.1|3889917_3890961_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_003911993.1|3891151_3891427_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003917684.1|3891602_3891857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938577.1|3892004_3892409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414184.1|3892405_3892597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899488.1|3892795_3893950_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003899489.1|3894183_3894441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414190.1|3894545_3894857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414195.1|3895276_3895885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414198.1|3895955_3897365_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003899491.1|3897361_3898174_+	ExeA family protein	NA	NA	NA	NA	NA
3897484:3897497	attR	CATCGCCGACCGCC	NA	NA	NA	NA
WP_112704288.1|3899278_3900540_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_087902221.1|3901132_3902394_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
