The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3159091	3248692	4416938	transposase,tRNA,protease	Pandoravirus(33.33%)	56	NA	NA
WP_087902221.1|3159091_3160353_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003417912.1|3160794_3161784_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_003918607.1|3161780_3163619_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417908.1|3163627_3164518_+	diterpene synthase	NA	NA	NA	NA	NA
WP_031651822.1|3164522_3166028_+	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417903.1|3166066_3166720_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417900.1|3166827_3168255_-	amidase	NA	NA	NA	NA	NA
WP_003417897.1|3168259_3168508_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003900037.1|3168508_3169150_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417895.1|3169228_3169333_-	PE family protein	NA	NA	NA	NA	NA
WP_003417892.1|3169386_3170562_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003900036.1|3170603_3171944_-	diacyglycerol O-acyltransferase	NA	NA	NA	NA	NA
WP_003908228.1|3172135_3175375_+	error-prone DNA polymerase DnaE2	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_003417882.1|3175463_3175898_-	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003417881.1|3175896_3176541_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_009938654.1|3176541_3178317_-	PE family protein	NA	NA	NA	NA	NA
WP_003901617.1|3178683_3179148_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003901616.1|3179383_3182014_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003417776.1|3182010_3182403_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_003417772.1|3182380_3182749_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417769.1|3182729_3183311_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417767.1|3183317_3183869_+	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417765.1|3183865_3184234_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003900033.1|3184350_3185541_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417760.1|3185582_3185840_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003417757.1|3185836_3186112_-	type II toxin-antitoxin system antitoxin RelJ	NA	NA	NA	NA	NA
WP_003417751.1|3186235_3187081_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417749.1|3187077_3187371_+	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417745.1|3187384_3187774_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417741.1|3187888_3188149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157132559.1|3188175_3188394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3188291_3188663_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_003417738.1|3188744_3189539_+	BBE domain-containing protein	NA	NA	NA	NA	NA
WP_009938650.1|3201268_3201556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003911006.1|3201850_3202591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_049961743.1|3202627_3203074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003901612.1|3203699_3213173_+	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3213428_3213686_+	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_049959002.1|3219083_3220064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112668354.1|3220112_3231077_+	PPE family protein	NA	NA	NA	NA	NA
WP_003417461.1|3231085_3231817_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003417458.1|3231813_3232953_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003900028.1|3232964_3234314_-	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417452.1|3234596_3235826_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003905041.1|3235892_3236537_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417440.1|3236809_3237820_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003417435.1|3237840_3238710_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003900026.1|3238743_3239184_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417421.1|3239658_3240504_+|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003417418.1|3240694_3241846_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417416.1|3241842_3243351_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417415.1|3243446_3244664_-	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003902446.1|3244732_3246100_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417413.1|3246108_3247047_+	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902445.1|3246979_3248509_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009937401.1|3248530_3248692_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3817754	3865606	4416938	transposase,integrase,tRNA	Burkholderia_virus(33.33%)	51	3834884:3834902	3855710:3855728
WP_003899508.1|3817754_3819503_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003414522.1|3819503_3819992_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_003414516.1|3819988_3820534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899507.1|3820728_3821280_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003414511.1|3821276_3822320_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003414510.1|3822446_3822746_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003899505.1|3822831_3825534_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
WP_003414508.1|3825533_3826085_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003905944.1|3826059_3827070_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003414506.1|3827076_3828396_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003414505.1|3828482_3829394_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003414504.1|3829390_3830218_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003414501.1|3830220_3831531_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003414499.1|3831523_3832606_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
WP_003902358.1|3832684_3833434_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003414495.1|3833480_3833696_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003414492.1|3833692_3834085_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003414489.1|3834105_3834375_+	DUF2277 family protein	NA	NA	NA	NA	NA
WP_003910939.1|3834371_3834917_+	DUF1802 family protein	NA	NA	NA	NA	NA
3834884:3834902	attL	GGTCGCCGCCCGGGTCCGC	NA	NA	NA	NA
WP_003414414.1|3835221_3836109_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003414409.1|3836111_3836996_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_014584866.1|3837267_3837813_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_003912014.1|3838212_3838935_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_003900580.1|3838931_3841370_+	type III-A CRISPR-associated protein Cas10/Csm1	NA	NA	NA	NA	NA
WP_003414296.1|3841366_3841741_+	type III-A CRISPR-associated protein Csm2	NA	NA	NA	NA	NA
WP_003414292.1|3841750_3842461_+	type III-A CRISPR-associated RAMP protein Csm3	NA	NA	NA	NA	NA
WP_087902221.1|3842824_3844086_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899491.1|3845413_3846226_-	ExeA family protein	NA	NA	NA	NA	NA
WP_003414198.1|3846222_3847632_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003414195.1|3847702_3848311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414190.1|3848730_3849042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899489.1|3849146_3849404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|3849736_3850997_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_112668357.1|3851037_3852150_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003414184.1|3852348_3852540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414181.1|3852536_3852941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003917684.1|3853088_3853343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003911993.1|3853518_3853794_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003414172.1|3853984_3855028_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_003901465.1|3855070_3855301_+	antitoxin MazE	NA	NA	NA	NA	NA
WP_003414166.1|3855284_3855641_+	type II toxin-antitoxin system toxin endoribonuclease MazF9	NA	NA	NA	NA	NA
WP_003899485.1|3855742_3857392_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
3855710:3855728	attR	GGTCGCCGCCCGGGTCCGC	NA	NA	NA	NA
WP_003414158.1|3857410_3858040_-	DUF3558 family protein	NA	NA	NA	NA	NA
WP_003414157.1|3858170_3858497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414155.1|3858500_3860189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900574.1|3860188_3860752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414151.1|3860896_3861871_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003414149.1|3861867_3862551_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_003414147.1|3862547_3863444_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003414146.1|3863645_3864227_+|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
WP_003899482.1|3864226_3865606_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
>prophage 4
NZ_CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3981293	3994039	4416938	capsid,terminase,protease,head,integrase	Mycobacterium_phage(57.14%)	20	3984950:3984977	3994574:3994601
WP_003413845.1|3981293_3982052_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
WP_003899423.1|3982967_3983249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413719.1|3983596_3983851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413717.1|3983861_3984095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900544.1|3984193_3984466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899422.1|3984371_3984761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899421.1|3984757_3984985_+	hypothetical protein	NA	NA	NA	NA	NA
3984950:3984977	attL	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
WP_003899420.1|3985129_3986257_+|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
WP_003900543.1|3986259_3986622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899418.1|3986638_3986899_+	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003899417.1|3986895_3987288_+	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899416.1|3987289_3988717_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899415.1|3988713_3988959_+	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899414.1|3989038_3989362_+	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899413.1|3989393_3990020_+|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899412.1|3990172_3990706_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003901443.1|3990713_3992153_+|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003908028.1|3992323_3992575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900539.1|3992562_3993027_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003900538.1|3993040_3994039_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
3994574:3994601	attR	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
