The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	71892	137327	3044973	integrase,transposase,protease	Escherichia_phage(16.67%)	54	134305:134327	138986:139008
WP_112199493.1|71892_74043_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.1e-121
WP_013245899.1|74660_75503_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.1	2.7e-33
WP_016379466.1|75577_76603_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.4	1.5e-70
WP_013245901.1|76605_77178_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.0	4.1e-33
WP_016379465.1|77189_78062_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.2	1.1e-98
WP_016379464.1|78261_79026_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013245904.1|79203_80100_+	LCP family protein	NA	NA	NA	NA	NA
WP_112199494.1|80237_81215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751684.1|81531_82776_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.1e-11
WP_013245908.1|82974_83643_-	sugar transferase	NA	NA	NA	NA	NA
WP_112199495.1|83954_84443_-	acyltransferase	NA	NA	NA	NA	NA
WP_016365202.1|84554_85970_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_162685428.1|86432_87395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016379758.1|87870_89184_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_016379757.1|89188_90238_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_112199498.1|90372_91362_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016379652.1|91382_92738_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_112199499.1|92739_93921_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_016379655.1|94083_94821_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_112199500.1|94846_95770_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_003580147.1|96131_96851_+	acyltransferase	NA	NA	NA	NA	NA
WP_003605622.1|97133_97634_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_060417150.1|97745_98459_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003566696.1|98455_98680_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	34.4	1.0e-08
WP_003566698.1|98964_99276_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566700.1|99535_100174_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003570960.1|100482_101460_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	5.8e-11
WP_003566704.1|101461_102514_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
WP_003566706.1|102525_103524_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566708.1|103523_104447_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566710.1|104621_106244_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016379539.1|106675_108100_-	MFS transporter	NA	NA	NA	NA	NA
WP_003566713.1|108333_108897_-	elongation factor P	NA	NA	NA	NA	NA
WP_060417148.1|109718_110426_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003570969.1|110418_111903_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003570970.1|111899_112682_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003566723.1|113152_113719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591381.1|113971_114307_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003570974.1|115573_115984_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003566730.1|115955_116162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016379325.1|116158_117583_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016379327.1|118385_120608_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_016379328.1|120670_121414_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003595577.1|121690_122437_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_016363665.1|122782_125365_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.4	1.2e-50
WP_003602947.1|125405_125996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566744.1|126421_127027_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_112199501.1|127834_128647_-	sugar kinase	NA	NA	NA	NA	NA
WP_003588359.1|129649_130456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019890870.1|131621_133037_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_112199502.1|134258_135437_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
134305:134327	attL	ACGCTTGGGAAAAGCGTAAGTTG	NA	NA	NA	NA
WP_003571004.1|135518_136445_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	1.1e-78
WP_112199633.1|136492_136963_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003586983.1|137075_137327_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
138986:139008	attR	CAACTTACGCTTTTCCCAAGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	368958	433751	3044973	transposase,bacteriocin,tRNA,protease	Bacillus_phage(16.67%)	60	NA	NA
WP_003659543.1|368958_370365_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	5.7e-52
WP_003580769.1|370605_372000_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003580771.1|372125_372713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576205.1|372712_372904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|373379_374873_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|375020_376001_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003588681.1|376116_376788_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003607196.1|376971_377802_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003588687.1|377947_378787_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003588689.1|378799_379816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|379822_380197_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016363490.1|380361_381543_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_016363491.1|381532_381634_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_003574021.1|382183_383104_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003567248.1|383800_384688_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567252.1|385879_386995_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567254.1|387016_388381_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|388397_388940_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|389160_389451_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|389566_389944_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003588717.1|390188_391508_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	1.2e-59
WP_003576225.1|391830_393177_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003588720.1|393404_394505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676081.1|394501_395698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003588727.1|395760_396636_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003588730.1|396800_398855_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_016365067.1|399011_401642_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	1.9e-88
WP_003576237.1|401803_402427_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_112199507.1|402926_403598_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003599717.1|404108_405230_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|405243_405528_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|405718_406834_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|407021_407228_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|407360_407618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|407688_407895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|408119_408371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199508.1|408783_409929_+	MFS transporter	NA	NA	NA	NA	NA
WP_003576247.1|410007_411264_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
WP_003588744.1|411352_412186_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_003588746.1|412502_412697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588748.1|412950_413487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588750.1|413675_414899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588752.1|415499_416327_-	class C sortase	NA	NA	NA	NA	NA
WP_003588755.1|416333_417893_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003607145.1|417889_419212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199509.1|419213_422219_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_112199510.1|422496_423054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588776.1|423148_424345_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003576275.1|424553_425609_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003588778.1|425859_426489_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003567322.1|426624_426954_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003588780.1|426950_427739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580842.1|427791_428580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|428624_428903_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|428926_429211_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588783.1|429404_429701_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|429802_431158_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|431463_431775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|431847_432198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588791.1|432371_433751_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	438564	451960	3044973	transposase,bacteriocin,protease	Lactobacillus_phage(80.0%)	20	NA	NA
WP_003574021.1|438564_439485_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661762.1|440271_440469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588828.1|441015_441255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586983.1|441488_441740_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|441793_442636_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_112199511.1|442868_443084_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
WP_029327644.1|443143_443986_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_003586983.1|444039_444291_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_003567358.1|444430_444619_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_019890870.1|444810_446226_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003567359.1|446509_446734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003588831.1|447300_448101_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003588833.1|448385_448544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199512.1|448659_448992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588837.1|449243_449435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588839.1|449749_450085_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588841.1|450203_450800_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003659595.1|451070_451379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567374.1|451514_451730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567376.1|451726_451960_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	515190	529623	3044973	transposase	Streptococcus_phage(90.0%)	15	NA	NA
WP_112199519.1|515190_516579_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	61.8	1.8e-151
WP_112199520.1|516568_516844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112199521.1|516846_517704_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_112199522.1|517700_518288_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_112199523.1|518370_518631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112199524.1|518932_520123_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.3	4.3e-93
WP_112199525.1|520112_520439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606383.1|520530_520752_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_112199526.1|520753_521257_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	45.7	2.1e-33
WP_060417077.1|521318_521711_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	70.0	2.5e-45
WP_112199527.1|521694_524160_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.9	0.0e+00
WP_060417075.1|524146_526291_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	52.9	3.6e-146
WP_112199528.1|526287_527283_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	1.9e-110
WP_060417073.1|527810_528734_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	39.3	3.5e-58
WP_112199529.1|528972_529623_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.8	3.4e-60
>prophage 5
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	735970	803971	3044973	transposase,holin	unidentified_phage(28.57%)	60	NA	NA
WP_003576590.1|735970_736090_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003585729.1|736310_737048_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003589110.1|737108_738353_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_003607311.1|738571_739510_+	PTS mannose/fructose/sorbose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003589114.1|739605_740412_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003589116.1|740386_741211_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003589118.1|741386_741704_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003589120.1|741787_742102_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_112199545.1|742094_743525_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003589124.1|743599_744475_-	ROK family protein	NA	NA	NA	NA	NA
WP_003607314.1|744471_745767_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_003589130.1|745763_748403_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_003567894.1|748451_749777_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003567895.1|750001_750727_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003589132.1|751158_751887_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_003567899.1|751883_752120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199546.1|752112_753705_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003576629.1|753736_754057_-	PTS galactitol IIB component	NA	NA	NA	NA	NA
WP_003567906.1|754088_754568_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003589136.1|754773_755571_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003589138.1|755826_756675_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003589140.1|757181_758864_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003589141.1|759324_760074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567918.1|760808_760967_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003581248.1|761334_763623_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_003581251.1|763650_764634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589144.1|764703_766629_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_003577481.1|766567_766915_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003577479.1|766914_767385_-	PTS hyaluronate-oligosaccharide IIA component	NA	NA	NA	NA	NA
WP_003567930.1|767504_768320_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003577476.1|768309_769122_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003658805.1|769274_769775_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003577474.1|769874_771053_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_003577472.1|771049_771880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567939.1|772094_772862_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003589150.1|773123_773969_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_003577468.1|774003_774828_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	3.0e-16
WP_003567945.1|774938_775592_+	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003589153.1|775596_775782_+	2-dehydro-3-deoxyphosphogluconate aldolase / 2-dehydro-3-deoxygluconate kinase	NA	NA	NA	NA	NA
WP_016383326.1|775771_776692_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.0	1.5e-21
WP_003577464.1|777773_778418_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003577462.1|778486_779176_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003577460.1|779333_781298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577458.1|781309_782251_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	38.9	1.0e-49
WP_003577456.1|782252_782924_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003577454.1|782913_783570_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003567961.1|783779_785171_-	HAMP domain-containing histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	21.9	1.5e-07
WP_003577452.1|785186_785888_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	3.5e-34
WP_003577450.1|786171_787557_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_112199547.1|787696_789301_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589184.1|789555_792645_-	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_002816285.1|795303_795555_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_003579895.1|797649_798021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|798312_799233_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003589196.1|799303_799702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579891.1|799744_800257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579889.1|800412_801900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003579887.1|802045_802786_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003607360.1|802869_803355_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003579883.1|803851_803971_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 6
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	1022556	1075248	3044973	transposase,bacteriocin,tRNA,protease	unidentified_phage(33.33%)	50	NA	NA
WP_003586359.1|1022556_1024458_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003568424.1|1024499_1025888_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003572793.1|1026401_1027166_-	protein jag	NA	NA	NA	NA	NA
WP_003586361.1|1027183_1028020_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_016363283.1|1028164_1028521_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568442.1|1028849_1028990_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003568444.1|1029920_1031270_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003568447.1|1031442_1032582_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
WP_003568449.1|1033434_1033647_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003572804.1|1033643_1034759_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003568453.1|1035011_1036973_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.6	4.3e-146
WP_003581640.1|1037034_1039656_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.5	2.9e-113
WP_003568456.1|1039760_1040465_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003568458.1|1040771_1041203_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	1.3e-26
WP_003568460.1|1041330_1041627_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003581643.1|1041657_1042254_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.6	9.2e-52
WP_003568467.1|1042340_1042577_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003574021.1|1042937_1043858_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586368.1|1044073_1045552_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003568540.1|1045544_1046564_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003568474.1|1046590_1046785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003581645.1|1046857_1047451_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_112199557.1|1047844_1048216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1048334_1049255_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003581648.1|1049507_1049810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199558.1|1050088_1050946_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|1051025_1051208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|1051258_1051438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112199538.1|1052003_1053380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003577228.1|1053526_1054762_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003577229.1|1054965_1057539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003577230.1|1057551_1058253_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003568490.1|1058532_1059084_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584074.1|1059127_1059934_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003577233.1|1059938_1060241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112199559.1|1061079_1061583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016363468.1|1061602_1063753_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003577235.1|1064097_1064871_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003577236.1|1065052_1065658_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003572888.1|1065781_1066675_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003586390.1|1066723_1067362_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112199560.1|1067590_1068967_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003577237.1|1069189_1069534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577238.1|1069609_1069969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572892.1|1070209_1071652_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003577239.1|1071846_1072482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577240.1|1072531_1072843_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003577242.1|1073011_1073200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577243.1|1073331_1073943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1074327_1075248_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 7
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	1081046	1134535	3044973	transposase,holin,protease	Streptococcus_phage(25.0%)	50	NA	NA
WP_003562562.1|1081046_1081922_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562571.1|1082267_1082918_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003577277.1|1083314_1084007_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562576.1|1084704_1085025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112199561.1|1085213_1086089_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.2	1.8e-11
WP_003577279.1|1086180_1087773_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	8.6e-12
WP_003577280.1|1088110_1089484_-	MFS transporter	NA	NA	NA	NA	NA
WP_016363309.1|1089660_1089984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577281.1|1090164_1093476_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003562586.1|1093472_1094075_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|1094326_1094587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|1094800_1095463_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|1095462_1096392_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|1096403_1097033_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003577282.1|1097035_1098289_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|1098912_1099566_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011673963.1|1099631_1099853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562602.1|1099976_1100162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577284.1|1100198_1102055_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.4	1.2e-68
WP_003562606.1|1102074_1102302_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003577285.1|1102449_1103034_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003572941.1|1103082_1103742_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003577286.1|1104356_1105151_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003586423.1|1105143_1106364_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003577288.1|1106347_1106947_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_003577289.1|1107098_1107881_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.5	5.8e-38
WP_003577290.1|1107877_1108903_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	6.0e-59
WP_003577291.1|1109742_1110882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363313.1|1111013_1112840_-	MFS transporter	NA	NA	NA	NA	NA
WP_003577293.1|1112998_1113577_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003577294.1|1113698_1114073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577295.1|1114056_1114779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577296.1|1114997_1115507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577297.1|1115574_1115769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365027.1|1115793_1116300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562656.1|1116725_1117493_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003572968.1|1117489_1118395_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003577300.1|1118538_1119690_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003572973.1|1119697_1120402_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003586429.1|1120412_1121759_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003562667.1|1122474_1123854_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003577303.1|1123855_1124863_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003577304.1|1124866_1125925_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003562673.1|1126120_1126498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1126531_1127452_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574021.1|1129072_1129993_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003577315.1|1130199_1130787_+	phospholipase	NA	NA	NA	NA	NA
WP_003577316.1|1130872_1131172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577317.1|1131305_1131953_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019890870.1|1133119_1134535_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	1379728	1417992	3044973	transposase,protease	Lactobacillus_phage(37.5%)	36	NA	NA
WP_003577575.1|1379728_1380418_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003577577.1|1380481_1381168_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_016363601.1|1381250_1381640_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003577580.1|1381671_1382196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586629.1|1382185_1382821_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.7e-24
WP_016363600.1|1382834_1383560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003607510.1|1383559_1384249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1384347_1385268_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003587759.1|1385257_1386073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604280.1|1386675_1388202_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.4e-53
WP_112199572.1|1388472_1390569_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563244.1|1390569_1390881_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563247.1|1391022_1392309_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563248.1|1392325_1392748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|1392769_1393630_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003577611.1|1393743_1394385_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563255.1|1394671_1395502_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|1395494_1396364_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003577615.1|1396403_1397399_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003574021.1|1398457_1399378_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003563273.1|1402256_1402655_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003563277.1|1402767_1403139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573459.1|1405155_1405998_+	serine hydrolase	NA	NA	NA	NA	NA
WP_112199573.1|1406094_1406805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586699.1|1406888_1407872_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003586701.1|1408230_1409055_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586703.1|1409041_1409878_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003586704.1|1409902_1411390_+	arylsulfatase	NA	A0A1V0SA98	Catovirus	22.7	3.2e-08
WP_016363280.1|1411379_1412234_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	28.7	8.4e-14
WP_003586708.1|1412236_1413016_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003586710.1|1413029_1414154_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_003586712.1|1414315_1415119_-	tributyrin esterase	NA	NA	NA	NA	NA
WP_003586715.1|1415129_1415972_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003586718.1|1415975_1416743_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586983.1|1416844_1417096_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|1417149_1417992_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
>prophage 9
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	1542847	1655437	3044973	integrase,transposase	Lactobacillus_phage(38.64%)	112	1540671:1540685	1654552:1655602
1540671:1540685	attL	AAATTGACGGTCACA	NA	NA	NA	NA
WP_003577893.1|1542847_1543777_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
1540671:1540685	attL	AAATTGACGGTCACA	NA	NA	NA	NA
WP_003577895.1|1543966_1544512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569067.1|1544832_1546002_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003606553.1|1546114_1546375_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	3.2e-09
WP_003574021.1|1546405_1547326_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586911.1|1547518_1548139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016365098.1|1548122_1548302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586913.1|1548551_1549259_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|1549417_1549840_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|1549832_1550186_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|1550429_1550678_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|1550719_1550920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586916.1|1550890_1551724_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	38.1	5.6e-47
WP_010493122.1|1551784_1552543_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|1552543_1552723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606636.1|1552715_1552967_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003586919.1|1553032_1553389_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.2e-61
WP_003572201.1|1553473_1553677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|1553659_1554205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|1554385_1554700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586926.1|1554692_1555439_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	1.7e-34
WP_003574014.1|1555453_1556278_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	2.3e-117
WP_003574016.1|1556277_1556796_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|1556842_1557265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|1557266_1558004_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|1558015_1558303_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_003586929.1|1558372_1558705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|1559219_1559663_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_003586931.1|1560175_1560829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573729.1|1562271_1562490_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|1564115_1564451_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|1564612_1564945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|1564974_1565703_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_014951815.1|1565636_1566578_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_099973802.1|1566623_1567487_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_003586951.1|1568168_1568447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566886.1|1568458_1568725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586954.1|1568748_1570332_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003586956.1|1570350_1570827_+	PcfB family protein	NA	NA	NA	NA	NA
WP_003586959.1|1570826_1572728_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_003571730.1|1572745_1572952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606870.1|1572971_1573805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363322.1|1573822_1574194_+	PrgI family protein	NA	NA	NA	NA	NA
WP_049176859.1|1574141_1576598_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003586967.1|1576587_1579065_+	CHAP domain-containing protein	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.5	2.1e-12
1577574:1577588	attR	TGTGACCGTCAATTT	NA	NA	NA	NA
WP_003586970.1|1579078_1579603_+	hypothetical protein	NA	NA	NA	NA	NA
1577574:1577588	attR	TGTGACCGTCAATTT	NA	NA	NA	NA
WP_003586972.1|1579620_1579851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586973.1|1579886_1581032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363319.1|1581049_1582024_+	DNA primase	NA	NA	NA	NA	NA
WP_003589454.1|1582111_1582387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363316.1|1582633_1583035_+	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_003606873.1|1583006_1585214_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003589449.1|1585258_1586650_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_099973803.1|1587040_1587828_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080543852.1|1588102_1588294_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003587165.1|1588481_1589240_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003587163.1|1589357_1591031_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003587161.1|1591043_1591814_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016363706.1|1591828_1592314_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_099973803.1|1592456_1593243_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003587154.1|1593298_1593829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587152.1|1593843_1594803_+	D-2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	30.3	3.3e-27
WP_003587151.1|1594920_1595307_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	31.8	2.4e-08
WP_016363695.1|1595299_1595620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191989233.1|1595612_1596920_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.3	1.2e-80
WP_003606688.1|1597438_1598698_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003587143.1|1598694_1600311_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.3	6.2e-127
WP_112199580.1|1600324_1603492_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003587138.1|1603626_1604541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587134.1|1605055_1606111_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.7	5.5e-39
WP_003587133.1|1606367_1607090_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003587131.1|1607191_1607380_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_003587130.1|1607466_1608051_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.3	2.7e-19
WP_003574021.1|1609055_1609976_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586983.1|1610810_1611062_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|1611115_1611958_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_003587109.1|1612592_1612856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587111.1|1612915_1615738_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_099973805.1|1616046_1616833_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016363761.1|1616830_1616992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586668.1|1617350_1617938_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.7	8.3e-21
WP_003586674.1|1618014_1618293_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003586676.1|1618292_1618667_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_016365202.1|1618936_1620352_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003587210.1|1620760_1621228_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_003587212.1|1621474_1622218_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	2.6e-27
WP_010620835.1|1622195_1623443_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003587215.1|1623447_1624119_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003582473.1|1626669_1627218_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003582479.1|1627227_1627449_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_016363699.1|1627490_1629389_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	2.7e-105
WP_099973806.1|1629934_1630722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003607154.1|1631002_1631434_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003589066.1|1631684_1633952_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.6e-59
WP_003606758.1|1635141_1636674_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003606756.1|1636673_1637612_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.3e-27
WP_003589055.1|1637841_1638903_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003606755.1|1638907_1639579_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	2.6e-26
WP_049169626.1|1639685_1640369_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.2	1.6e-60
WP_003586786.1|1640611_1641040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019890870.1|1642032_1643448_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003607130.1|1643613_1645785_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.1	3.1e-254
WP_003586769.1|1645956_1646946_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	63.5	8.0e-117
WP_003586772.1|1646942_1647428_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_016363783.1|1648159_1648402_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003573774.1|1648394_1648676_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003586983.1|1649057_1649309_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_029327644.1|1649362_1650205_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_003607129.1|1650872_1651982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586782.1|1651983_1653426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1653670_1654591_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586785.1|1654753_1655437_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	8.1e-60
1654552:1655602	attR	CCCAGTTCAAGCAGTGAGCAAGCCTCTTTCTAGGTGGTAACTTTATTATTGCAATCTAGGTTCAGGCAGCTATTAGTTGTTGCAATTCAGTGATTACTGAAAACCCGAAGAGATTGCCACTTCTTCGGGTGGTTCAGGTGCAAATTTTCCTCGCTGACTTGATTTTAGTATACTGGGTGCCAAGAAACGAGGGATTGCGCGCATGAATCACTTTAAGGGACGCCACTTTCAAAAGGACATCATCTTAGTAGCCGTTGGCTACTATTTCAGATTCAGTCTCAGCTATCGTGACATCGTTGAATTGCTTCGGGATCGGGGTATCACTGTTCATCACACCACGGTCATGCGTTGGGTTCATCACTATGGCCCCATCTTTAAGGCTCTATGGCATCGGCATCAAACAGCTCACGCTAAAAGTTGGCGAATCGATGAGACCTATATTCGAGTTAAAGGCCGTTGGGCCTATTTGTATCGCGCTATTGACAGTAACGGTTTGACCATGGATTTTGAGCTACGAAAACACCGCGATTATACCGCATCCTATCACTTTTTGAAGCGTCTCTTGACGACCAATGGTCGGCCTGATCGATTAGTCACTGATCAATATCGGGCAACACTGAAAGCAGTGAAGCACCTGATAAAGCAAGACTATTTGAGCAAATCAGCCCACCAATGTTCCAAATATCGAAATAATTTGATTGAACAGGACCACCGATTCATTAAACGTCATCGTGTCCGCTCAGCAAGCTTTCAAAGCATTCGAACCGCTAGTGCAACGTTGAGCGGTGTGGAAATTGTTCACGCAATACGCAAAAGAACCCGACGAGAGTTAAGTCTCATCGGGTTCTCAGTCGTGGACGAGTTAGAAGCATTGTTAGCTGCATAACCTTCAACATAGGATCAATAGCTGGTTAGATGGTCATCTCTCAGACTGTTTGCACCAGATCCCGGCTAACTTGTTCTTGCAATTTGGGTTGAGATCTTTTTGCGTAATCTGCGTTACTAAATTTGTTCAAGTTATTTCTTGCAATCTGCCGTTTTTTATTGTCCA	NA	NA	NA	NA
>prophage 10
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	1669207	1680179	3044973	transposase	Staphylococcus_phage(40.0%)	13	NA	NA
WP_002816607.1|1669207_1669891_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_112199639.1|1669936_1670131_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_099973807.1|1670898_1671684_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032771275.1|1671671_1671929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567312.1|1672206_1672764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587117.1|1672964_1674293_-	MFS transporter	NA	NA	NA	NA	NA
WP_002816607.1|1674471_1675155_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_003574021.1|1675368_1676289_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003589537.1|1676761_1677244_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_080596909.1|1677304_1677634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014951815.1|1677643_1678585_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_003582147.1|1678518_1679247_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_016379844.1|1679315_1680179_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP029536	Lacticaseibacillus paracasei strain LC355 chromosome, complete genome	3044973	2073049	2127447	3044973	integrase,portal,terminase,head,tRNA,capsid	Staphylococcus_phage(23.53%)	58	2085652:2085668	2130609:2130625
WP_003569677.1|2073049_2073511_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003569679.1|2073960_2074857_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	7.9e-23
WP_003587534.1|2074849_2076109_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569683.1|2076242_2076785_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	4.8e-23
WP_003569685.1|2076796_2077555_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	6.9e-60
WP_016365007.1|2077738_2078608_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003569689.1|2078629_2080738_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003564356.1|2081043_2081583_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003564358.1|2081596_2082685_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.6	9.9e-36
WP_003564360.1|2082784_2083609_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.9	1.3e-11
WP_003569692.1|2083598_2084438_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569694.1|2084421_2085495_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2085652:2085668	attL	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
WP_003564368.1|2085835_2086030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569696.1|2086099_2086294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569698.1|2086512_2089305_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	1.6e-74
WP_003569700.1|2089408_2090053_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003590309.1|2090090_2091230_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003569702.1|2091219_2091954_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	2.5e-27
WP_003564381.1|2092217_2093075_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_003569703.1|2093071_2094157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564385.1|2094178_2095543_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003569704.1|2095858_2097670_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.5	4.4e-89
WP_016383098.1|2097647_2097788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569705.1|2097877_2099683_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_003587541.1|2099757_2100249_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003564397.1|2100319_2101051_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003569709.1|2101176_2102043_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_003587543.1|2102039_2102993_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_003564402.1|2102995_2103319_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003569714.1|2103315_2103756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569715.1|2103800_2104037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569716.1|2103996_2104458_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003569717.1|2104441_2104774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569719.1|2104876_2105887_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003564414.1|2106105_2106564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569722.1|2106702_2108091_+	amino acid permease	NA	NA	NA	NA	NA
WP_003564418.1|2108290_2109055_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003564420.1|2109051_2109891_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003564422.1|2109891_2110848_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003569724.1|2110844_2111714_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003590320.1|2111991_2114283_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_003569727.1|2114553_2114862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016380956.1|2115133_2116282_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	28.9	1.0e-30
WP_016380957.1|2116380_2117082_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE6	Staphylococcus_phage	38.0	4.0e-06
WP_016380958.1|2117229_2117508_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016380959.1|2117575_2117797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380962.1|2118147_2118438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571964.1|2118434_2118623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382146.1|2118606_2119419_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
WP_016380374.1|2119422_2121015_+	phage/plasmid primase P4 family protein	NA	A0A1B1P7L5	Bacillus_phage	27.6	1.0e-25
WP_016380373.1|2121335_2121671_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016380372.1|2121675_2121861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380371.1|2121857_2122280_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.7	8.3e-23
WP_003587574.1|2122396_2122867_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	27.9	4.2e-07
WP_112199596.1|2122863_2124573_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.7	3.4e-115
WP_003587577.1|2124547_2124718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587580.1|2124722_2125901_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.3	4.8e-60
WP_112199597.1|2125890_2127447_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.2	4.0e-38
2130609:2130625	attR	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
