The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	248206	261509	4695840	integrase,transposase	Acinetobacter_phage(33.33%)	11	236659:236673	262644:262658
236659:236673	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|248206_249049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000169527.1|249519_249819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032247722.1|249815_250682_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_099975594.1|250800_252420_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_112031960.1|252419_253868_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|253908_255465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|255476_256403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|256755_257055_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|257618_259445_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|259613_259964_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000255956.1|260486_261509_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
262644:262658	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
>prophage 2
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	1081439	1094622	4695840		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1081439_1082201_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1082194_1082821_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1082960_1084100_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1084162_1085155_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1085248_1086613_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1086701_1087478_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1087482_1088121_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1088117_1089380_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1089376_1090285_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1090450_1091248_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|1091298_1091955_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1092060_1094622_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	1947318	1973562	4695840	integrase,terminase,holin	Klebsiella_phage(22.58%)	44	1949274:1949293	1973735:1973754
WP_000019585.1|1947318_1948062_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|1948102_1948498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046659708.1|1948550_1949330_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
1949274:1949293	attL	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
WP_046659706.1|1949326_1950586_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
WP_016244760.1|1950628_1950874_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_046659703.1|1951033_1951252_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
WP_046659701.1|1951248_1951449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086625037.1|1951603_1951807_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
WP_086625036.1|1951913_1952297_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
WP_046659679.1|1952296_1952491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269967.1|1952689_1952887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|1952923_1953106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|1953102_1953366_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_046659672.1|1953472_1954069_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	9.5e-57
WP_024194779.1|1954277_1954568_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
WP_029363688.1|1954564_1954927_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
WP_001548467.1|1954923_1955064_+	YlcG family protein	NA	NA	NA	NA	NA
WP_046659669.1|1955060_1955750_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	3.2e-56
WP_122633140.1|1956205_1956505_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.9	1.4e-40
WP_046659668.1|1956501_1957041_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
WP_032412824.1|1957037_1957385_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
WP_046659666.1|1957381_1957657_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
WP_046659665.1|1957607_1957805_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
WP_024623185.1|1957902_1958211_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
WP_046659662.1|1958207_1958474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659660.1|1958643_1959072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|1959418_1959907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659658.1|1959857_1961258_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
WP_001085714.1|1961480_1962932_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
WP_000233062.1|1962987_1963536_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
WP_046659655.1|1963567_1963990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659652.1|1964045_1965248_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.3	2.4e-99
WP_000528476.1|1965251_1965746_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_020804064.1|1965757_1966699_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
WP_000725700.1|1966738_1967020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659650.1|1966988_1967408_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
WP_025269952.1|1967404_1967911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312779.1|1967910_1968297_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|1968391_1968832_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_162403646.1|1968985_1969726_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.2	1.8e-68
WP_025270001.1|1969725_1970607_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_126875314.1|1970858_1972943_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_025270003.1|1972951_1973131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025270004.1|1973244_1973562_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
1973735:1973754	attR	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
>prophage 4
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	2255623	2284226	4695840	integrase,tail,lysis	Escherichia_phage(25.0%)	31	2256688:2256702	2280466:2280480
WP_000041556.1|2255623_2258050_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2256688:2256702	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|2258248_2258554_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2258661_2259372_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2259374_2259935_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2259969_2260311_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2260445_2260772_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2260977_2262192_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2262203_2263223_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2263280_2263391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2263410_2264691_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2264725_2264962_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2265049_2267521_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2267614_2267806_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2267802_2267991_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2268074_2268317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2268297_2269263_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2269303_2269726_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2269855_2270800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2271347_2272697_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2273014_2273617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2273976_2274957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2275476_2275584_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2275628_2275841_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2276056_2276308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2276374_2276653_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|2276654_2277704_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|2277716_2278091_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|2278087_2278909_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|2279654_2281817_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2280466:2280480	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|2282648_2284046_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|2284100_2284226_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 5
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	2685473	2698211	4695840	integrase,transposase	Enterobacteria_phage(33.33%)	13	2683446:2683469	2696914:2696937
2683446:2683469	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2685473_2687429_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2689793_2690333_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2690515_2690827_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2690823_2691504_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2691500_2691659_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2691655_2692720_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2692873_2693092_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2693139_2693379_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2693518_2693755_+	excisionase	NA	NA	NA	NA	NA
WP_000255956.1|2693878_2694901_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|2694900_2695680_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086625063.1|2695722_2696847_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.0e-206
WP_000444487.1|2696960_2698211_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2696914:2696937	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3013364	3022134	4695840	integrase	Salmonella_phage(90.0%)	12	3013034:3013047	3022176:3022189
3013034:3013047	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3013364_3013553_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3013711_3016105_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3016101_3016959_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3016955_3017183_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3017182_3017416_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3017483_3017825_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3017942_3018239_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3018246_3018756_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3018788_3019010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3019155_3020034_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3020045_3020990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3021081_3022134_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3022176:3022189	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3101717	3128921	4695840	lysis,integrase,tail	Enterobacteria_phage(47.06%)	43	3103633:3103647	3128995:3129009
WP_001356070.1|3101717_3103007_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3103065_3103542_+	kinase inhibitor	NA	NA	NA	NA	NA
3103633:3103647	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3104287_3105619_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3105692_3105869_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3106018_3106687_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3107577_3108138_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3108526_3108760_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3108816_3109227_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_112031993.1|3109578_3109731_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.5e-19
WP_001228702.1|3109759_3109966_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3110182_3110680_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3110679_3110895_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3112164_3113124_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3113316_3113841_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3113996_3114374_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3114459_3114600_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3114596_3114959_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3114955_3115246_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3115238_3115409_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3115408_3115864_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3115860_3115962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3116054_3116507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3116503_3117064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3117548_3117842_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3117838_3118540_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3118536_3119466_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|3119552_3120092_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3120161_3120392_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3120430_3121186_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|3121308_3122058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112031994.1|3122054_3122882_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3123390_3123597_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3123672_3123969_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3123974_3124760_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3124756_3125437_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3125433_3125616_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3125588_3125780_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3125790_3126072_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3126170_3126392_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3126602_3127205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3127447_3127615_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3127654_3127873_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3127850_3128921_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3128995:3129009	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3854877	3957141	4695840	terminase,tail,tRNA,lysis,protease,integrase,portal	Enterobacteria_phage(40.0%)	97	3912977:3912996	3957372:3957391
WP_112032005.1|3854877_3857694_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.6e-77
WP_000767329.1|3857736_3858678_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001295417.1|3858685_3858904_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|3859006_3859270_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001300855.1|3863761_3864661_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681360.1|3864726_3865893_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|3866421_3866631_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3866734_3867865_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516131.1|3867953_3869870_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	9.0e-149
WP_000843559.1|3870246_3870651_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|3870676_3871390_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3871538_3872105_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3872139_3872727_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|3872841_3873795_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112597.1|3874073_3875504_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906183.1|3875573_3876350_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738723.1|3876502_3876799_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|3877012_3878299_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|3878299_3879232_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001753208.1|3879233_3881696_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3881776_3881842_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223186.1|3882055_3882742_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3883141_3883282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3883377_3884094_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920307.1|3884152_3885505_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001188666.1|3886985_3887675_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|3887687_3888161_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3888371_3889241_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|3889237_3889885_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001346116.1|3889936_3890449_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3890491_3890818_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3890907_3892845_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3893055_3894723_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3895029_3896262_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3896282_3897665_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|3897713_3898682_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3898787_3899432_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|3899459_3900476_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|3900931_3901651_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3901730_3902954_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|3903005_3904328_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|3904454_3905234_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143253.1|3905491_3907042_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088379.1|3907013_3907877_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|3908191_3908974_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|3908970_3910044_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3910165_3910327_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3910453_3911059_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|3911451_3913038_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
3912977:3912996	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
WP_104698170.1|3913257_3913506_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	7.0e-38
WP_001378647.1|3914023_3914320_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
WP_029402452.1|3914655_3915159_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	99.4	1.5e-90
WP_112032006.1|3915867_3919482_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	86.0	0.0e+00
WP_112032007.1|3919546_3920146_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	97.5	6.3e-109
WP_112032008.1|3920214_3923694_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_162628499.1|3923753_3924362_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	3.1e-103
WP_001506652.1|3924298_3925042_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
WP_001152385.1|3925046_3925745_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|3925754_3926084_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_112032010.1|3926083_3929149_-|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.5	0.0e+00
WP_001161009.1|3929120_3929450_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3929458_3929845_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|3929905_3930649_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|3930660_3931062_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|3931058_3931637_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283147.1|3931648_3931924_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097046.1|3931916_3932240_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_077793154.1|3932326_3934354_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_112032012.1|3934298_3935807_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.6	2.3e-288
WP_001072975.1|3935806_3936019_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_087905443.1|3936015_3938115_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.9	0.0e+00
WP_000421825.1|3938123_3938663_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001139675.1|3939296_3939449_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_112032013.1|3939436_3939874_-|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	97.2	1.6e-69
WP_001135250.1|3939870_3940368_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3940367_3940583_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_112032014.1|3940650_3941703_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	8.8e-207
WP_000917724.1|3941853_3942057_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|3942280_3942706_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_112032015.1|3942986_3943739_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.0e-136
WP_001360050.1|3943752_3944742_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|3944749_3945559_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|3945578_3945968_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210181.1|3945964_3946291_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_001355692.1|3946287_3946941_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_072274261.1|3946940_3947435_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	98.2	1.9e-87
WP_112032016.1|3947431_3948250_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	97.1	4.4e-121
WP_000620696.1|3948246_3948471_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_112032017.1|3948467_3949616_-	peptidase	NA	A5LH69	Enterobacteria_phage	80.9	3.8e-163
WP_112032018.1|3949612_3950164_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.3	5.4e-99
WP_001191669.1|3950156_3950417_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_032193127.1|3950514_3951207_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	3.7e-121
WP_000135680.1|3951909_3952272_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_112032020.1|3952337_3953162_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	5.0e-149
WP_097616747.1|3953289_3953826_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	9.0e-99
WP_112032021.1|3954356_3955712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097616742.1|3955917_3957141_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	2.8e-236
3957372:3957391	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	4033903	4095024	4695840	integrase,transposase,protease,tRNA	Escherichia_phage(14.29%)	54	4054496:4054523	4061810:4061837
WP_000998019.1|4033903_4035289_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|4035527_4036886_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937735.1|4037264_4037456_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|4037618_4037876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|4039162_4039942_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|4039941_4040964_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001283626.1|4041585_4042107_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4042103_4043057_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|4043143_4045468_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001376066.1|4045512_4046415_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4046411_4047410_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4047406_4048363_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4048363_4049131_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4049688_4049946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4050997_4052149_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4052068_4052419_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4052519_4053092_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4053140_4053965_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
4054496:4054523	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_000749342.1|4055002_4055467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145203.1|4055707_4056202_+	membrane protein	NA	NA	NA	NA	NA
WP_000331917.1|4056262_4057108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190110.1|4057121_4057682_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000085626.1|4058011_4058341_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_001261095.1|4059346_4059679_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_023148066.1|4059811_4061722_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000061768.1|4062092_4063112_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
4061810:4061837	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_001376011.1|4063241_4064744_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_086625050.1|4064904_4065987_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4065986_4067087_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4067353_4068865_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4069122_4069566_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|4069565_4072421_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_001680070.1|4072474_4073671_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059398.1|4073863_4074367_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4074412_4074829_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012904.1|4074990_4075995_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000036437.1|4076051_4077647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336307.1|4077769_4078222_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001375985.1|4078366_4078960_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500727.1|4079030_4079744_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4079874_4080270_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4080550_4080685_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4080688_4081624_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4081636_4082098_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4082170_4082557_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|4082762_4085459_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4085599_4085653_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|4085837_4086785_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|4086903_4088325_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001375992.1|4088374_4090030_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4090423_4092562_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|4092721_4093186_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|4093230_4093617_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162184.1|4093671_4095024_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP029365	Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence	89248	0	88835	89248	holin,capsid,transposase,integrase,plate,tail,tRNA,protease,portal	Escherichia_phage(92.39%)	97	46228:46254	66986:67012
WP_112031911.1|137_941_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	98.1	1.0e-114
WP_000243176.1|1033_1492_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
WP_000020026.1|1645_2104_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	99.3	6.1e-88
WP_001350911.1|2120_2312_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	100.0	3.7e-31
WP_089477104.1|2671_4369_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	98.6	0.0e+00
WP_089477103.1|4515_4794_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	94.6	1.9e-39
WP_112031912.1|4861_6520_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	97.6	3.6e-303
WP_000801019.1|6563_7298_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.2	5.0e-124
WP_001112721.1|7365_7938_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
WP_032220995.1|7946_8438_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	98.2	1.1e-87
WP_032220996.1|8490_9042_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.4	8.7e-97
WP_000021878.1|9057_9765_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|10146_10902_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_001025045.1|11290_12112_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	2.9e-157
WP_032220997.1|16227_16602_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	96.8	2.5e-63
WP_112031913.1|16598_18029_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	92.6	5.9e-254
WP_032220999.1|18039_18885_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	94.7	7.7e-153
WP_050438799.1|19276_19426_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	91.8	1.7e-18
WP_112031914.1|19428_22611_+|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	67.6	8.0e-219
WP_075851178.1|22610_23021_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.6e-23
WP_000457140.1|23415_23742_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000526264.1|23741_24188_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_069067330.1|24177_24798_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.0	2.4e-79
WP_000609495.1|24790_26716_+	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	97.2	3.5e-312
WP_000156174.1|26715_27084_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
WP_053919843.1|27178_28564_+	ddrB	NA	A0A222YY44	Escherichia_phage	96.7	1.4e-236
WP_149011351.1|29078_30311_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.8	3.6e-236
WP_032342280.1|30324_31323_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	97.0	4.1e-177
WP_112031916.1|31523_32486_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.4	6.2e-175
WP_112031917.1|32635_33805_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	87.7	4.0e-184
WP_000245715.1|34397_34622_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_001273800.1|35558_36044_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_112031918.1|36195_43035_+	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	93.5	0.0e+00
WP_000209223.1|43071_43506_+	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_001230915.1|43508_43769_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_086252943.1|44103_44400_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_001238268.1|44414_44615_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_001344839.1|44629_44911_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	97.8	2.0e-41
WP_000077919.1|45024_46233_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
46228:46254	attL	AAATAATATGTTAGAAAACTAAAATCA	NA	NA	NA	NA
WP_074470336.1|48610_49438_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	98.5	4.0e-130
WP_000488304.1|50505_50697_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_001130998.1|50903_51089_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000435256.1|51197_51590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031325887.1|51970_52951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000897063.1|52950_54459_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_000888609.1|54486_54726_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_001292231.1|55918_56947_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
WP_000349257.1|57056_57365_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_000861173.1|57361_57838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112031919.1|57834_58329_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	95.7	3.3e-87
WP_089477112.1|58343_59045_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	63.9	2.7e-79
WP_112031920.1|59051_59816_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.8	3.8e-135
WP_112031921.1|59805_60900_+	hypothetical protein	NA	Q71T61	Escherichia_phage	33.1	4.6e-41
WP_112031922.1|60935_61316_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.9	2.7e-57
WP_001190712.1|61315_61537_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506731.1|61609_61999_-	hypothetical protein	NA	A0A077SK24	Escherichia_phage	96.9	7.1e-69
WP_112031923.1|62097_62349_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	92.8	3.9e-36
WP_112031924.1|62663_63494_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	72.0	1.7e-80
WP_000224218.1|63504_63768_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_021517457.1|63769_63961_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	90.3	3.3e-27
WP_112031925.1|64133_64580_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	81.4	3.7e-37
WP_080028522.1|64576_65263_-	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	61.5	2.8e-44
WP_112031926.1|65249_65939_-	hypothetical protein	NA	Q71T76	Escherichia_phage	70.8	2.9e-89
WP_044083693.1|65955_66951_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	99.4	2.1e-197
WP_112031927.1|67049_67742_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	95.2	6.8e-131
66986:67012	attR	AAATAATATGTTAGAAAACTAAAATCA	NA	NA	NA	NA
WP_087758022.1|67738_68050_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	4.5e-58
WP_048256676.1|68046_68271_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	95.9	5.0e-35
WP_112031928.1|68267_68543_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	83.5	3.6e-35
WP_112031929.1|68539_69235_-	ead/Ea22-like family protein	NA	A0A2I6TCG8	Escherichia_phage	97.5	6.5e-41
WP_069067282.1|69231_69555_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	82.4	1.2e-40
WP_069067283.1|69554_70256_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	94.1	3.2e-112
WP_052936027.1|70245_70530_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	1.8e-42
WP_112031930.1|70559_71171_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	89.7	3.2e-100
WP_157209371.1|71170_71326_-	hypothetical protein	NA	A0A222YXL5	Escherichia_phage	71.4	8.5e-10
WP_112031931.1|71442_72018_+	recombinase	NA	A0A222YXV2	Escherichia_phage	90.0	4.4e-67
WP_071998905.1|72640_72820_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	97.5	6.4e-17
WP_001396850.1|72904_73132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776434.1|73317_73926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557715.1|74209_74863_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
WP_112031932.1|75191_75521_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	99.1	2.4e-57
WP_074470350.1|75513_76707_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	99.7	2.6e-202
WP_109157909.1|76740_77469_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	57.1	2.9e-71
WP_001022420.1|77490_77691_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
WP_000806445.1|77747_78086_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|78156_78459_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_112031933.1|78621_79413_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.1	2.4e-148
WP_000203293.1|79409_80177_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000046500.1|80180_81161_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_087503501.1|81157_81811_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
WP_112031934.1|81870_82776_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	99.3	3.6e-164
WP_000812238.1|82759_83440_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_080028512.1|83432_84338_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	99.7	2.2e-174
WP_032220989.1|84386_86048_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.3	0.0e+00
WP_000595051.1|86316_86604_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_000585023.1|86596_87238_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
WP_000076909.1|87526_87865_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_073714505.1|87878_88835_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.4e-179
>prophage 1
NZ_CP029368	Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence	122194	1262	66258	122194	protease,integrase,transposase	Escherichia_phage(35.0%)	56	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2678_3848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4694_4967_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001496335.1|6209_8180_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8186_8978_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|9716_10496_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|12597_12972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|12996_13701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_112031936.1|14027_14504_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_112031957.1|14715_14973_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_112031937.1|16127_16688_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112031938.1|16775_17327_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003863470.1|17417_17753_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_112031939.1|17779_18574_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.4	2.1e-11
WP_112031940.1|18730_19072_-	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	40.0	1.1e-09
WP_112031941.1|19286_20396_+	alkene reductase	NA	NA	NA	NA	NA
WP_112031942.1|20464_21163_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_112031943.1|21504_22410_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112031944.1|22575_22902_+	thioredoxin	NA	A0A2I2L415	Orpheovirus	37.4	6.0e-13
WP_112031945.1|23111_23321_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|23983_24688_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_112031946.1|25968_27444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013263795.1|29367_30087_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	30.0	1.3e-20
WP_000057569.1|30646_30988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|31002_31794_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_016359299.1|31944_33210_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	54.0	4.4e-120
WP_104558120.1|33197_33638_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_000447669.1|34053_34479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|34536_34941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016359300.1|34950_35190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|36074_36371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112031950.1|37054_37843_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014063958.1|37968_38661_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	1.2e-26
WP_112031951.1|38657_39839_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	4.7e-15
WP_112031952.1|39930_41076_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_112031953.1|41072_44132_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_112031954.1|44298_44661_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	46.8	2.8e-19
WP_001067855.1|44672_45377_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|48694_49399_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|49468_49942_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|51155_51860_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|52937_53594_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|54373_55765_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|55801_56374_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|56510_57101_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000844627.1|57218_57461_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|57492_58143_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|58248_59448_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|59479_60364_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|60501_60894_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001262767.1|62863_64636_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|64920_65322_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|65254_65512_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616800.1|65604_66258_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP029368	Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence	122194	83195	91575	122194	transposase	Stx2-converting_phage(50.0%)	13	NA	NA
WP_023149734.1|83195_84767_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|84786_85134_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|85133_85811_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_077779935.1|85787_85955_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
WP_005012601.1|86255_86468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139363.1|86601_87162_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_086625070.1|87216_87993_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_000271685.1|88098_88521_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|88567_88870_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001006251.1|89406_90177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|90221_90656_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|90669_90891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|90891_91575_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
