The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030093	Mycobacterium tuberculosis strain RUS_B0 chromosome, complete genome	4418559	2715646	2753918	4418559	integrase,terminase,tRNA,head,protease,capsid	Mycobacterium_phage(30.0%)	47	2744447:2744474	2754071:2754098
WP_003413486.1|2715646_2717725_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2717833_2718061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112668318.1|2718057_2719443_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2719787_2720288_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2720304_2720745_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2720891_2721569_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2721553_2721907_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2721919_2722345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2722341_2723016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2723093_2723915_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2724050_2724944_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2724946_2725765_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2725779_2726961_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2727019_2727451_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2727964_2729206_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2729515_2729878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2730224_2731349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2731350_2731890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2732029_2733328_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2733366_2733648_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2733792_2734278_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2734304_2734562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2734562_2736899_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2736927_2737170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2737170_2737848_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2738043_2738700_+	DedA family protein	NA	NA	NA	NA	NA
WP_003910926.1|2738862_2739309_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2739483_2739816_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2739935_2740295_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2740396_2740855_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2740990_2741371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2741367_2742864_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2743098_2743290_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2744447:2744474	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2744580_2745012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2745008_2746007_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2746020_2746485_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2746472_2746724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2746894_2748334_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2748341_2748875_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2749027_2749654_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2749685_2750009_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2750088_2750334_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2750330_2751758_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2751759_2752152_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2752148_2752409_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2752425_2752788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2752790_2753918_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2754071:2754098	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
