The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	0	14433	4847638	tRNA	Bacillus_virus(50.0%)	18	NA	NA
WP_022650816.1|124_625_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_044596273.1|1034_2366_+	MFS transporter	NA	NA	NA	NA	NA
WP_023315858.1|2381_4418_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857881.1|4524_4971_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_022650813.1|4954_5746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022650812.1|5845_7033_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_022650811.1|7064_7772_-	CTP synthase	NA	NA	NA	NA	NA
WP_003857886.1|7922_8267_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|8267_8573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170970032.1|8653_8917_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_023315855.1|9220_10249_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
WP_015570793.1|10294_10393_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|10393_10468_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|10521_10770_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|11140_11233_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_045345722.1|11357_12857_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_022650806.1|12861_13107_-	YmjA family protein	NA	NA	NA	NA	NA
WP_003857898.1|13182_14433_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
>prophage 2
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	17515	18886	4847638		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_058673099.1|17515_18886_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	8.5e-109
>prophage 3
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	24662	34775	4847638		Bacillus_virus(20.0%)	10	NA	NA
WP_166726884.1|24662_25811_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	6.6e-30
WP_112777650.1|25794_26652_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.8	2.7e-12
WP_112777651.1|26648_27440_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_022650796.1|27436_28471_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003857915.1|28505_29327_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	1.2e-22
WP_047653650.1|29341_30253_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003857918.1|30307_31552_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_015570809.1|31551_32253_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.3	4.4e-37
WP_017384712.1|32245_33445_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_023315820.1|33701_34775_+	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	25.9	1.1e-07
>prophage 4
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	39554	39812	4847638		Erwinia_phage(100.0%)	1	NA	NA
WP_045345718.1|39554_39812_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.3e-06
>prophage 5
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	52056	53699	4847638		Erwinia_phage(50.0%)	2	NA	NA
WP_003857944.1|52056_53061_-	DNA polymerase III subunit delta'	NA	A0A2H4IBD4	Erwinia_phage	28.4	2.0e-06
WP_045336685.1|53057_53699_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	39.6	1.1e-29
>prophage 6
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	56976	58102	4847638		Ralstonia_phage(50.0%)	2	NA	NA
WP_003857954.1|56976_57213_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	3.4e-10
WP_045345715.1|57367_58102_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	8.5e-15
>prophage 7
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	72364	73318	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_017384732.1|72364_73318_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A160LKR7	Bacillus_phage	38.0	2.8e-10
>prophage 8
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	88418	88664	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003858011.1|88418_88664_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	4.5e-13
>prophage 9
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	93267	94194	4847638		Morganella_phage(100.0%)	1	NA	NA
WP_003858019.1|93267_94194_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	3.1e-54
>prophage 10
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	101855	102392	4847638		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_045345703.1|101855_102392_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	41.9	4.6e-26
>prophage 11
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	106543	107377	4847638		Pelagibacter_phage(100.0%)	1	NA	NA
WP_003858055.1|106543_107377_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.9	2.3e-40
>prophage 12
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	114418	115207	4847638		Erwinia_phage(100.0%)	1	NA	NA
WP_003858070.1|114418_115207_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	69.5	1.0e-90
>prophage 13
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	131821	134978	4847638		Enterobacteria_phage(100.0%)	4	NA	NA
WP_003858102.1|131821_132316_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	83.3	1.6e-41
WP_039268798.1|132337_133660_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	89.0	5.7e-211
WP_003858106.1|133770_134691_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001273664.1|134807_134978_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 14
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	143203	147844	4847638	protease	uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_112777655.1|143203_144235_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.2	1.0e-13
WP_023324419.1|144231_144993_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	5.4e-12
WP_045345693.1|145285_146914_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003858127.1|147184_147844_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	2.0e-47
>prophage 15
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	152074	154129	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_045345690.1|152074_154129_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.8	6.7e-17
>prophage 16
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	166618	171855	4847638		Tupanvirus(50.0%)	3	NA	NA
WP_006809352.1|166618_168526_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	3.3e-50
WP_003858171.1|168538_170647_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_003858174.1|170745_171855_+	YcbX family protein	NA	A0A0E3FP00	Synechococcus_phage	35.1	4.1e-05
>prophage 17
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	177290	183803	4847638	tRNA	Bacillus_virus(25.0%)	4	NA	NA
WP_003858186.1|177290_178061_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	7.5e-30
WP_022650731.1|178164_180777_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	2.0e-18
WP_003858188.1|181031_182234_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	5.8e-45
WP_003858191.1|182402_183803_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	37.3	8.5e-80
>prophage 18
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	202664	207212	4847638		Bacillus_phage(100.0%)	3	NA	NA
WP_003858227.1|202664_204413_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	6.7e-58
WP_045347159.1|204449_206714_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003858233.1|206924_207212_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 19
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	211388	212477	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_003858240.1|211388_212477_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-81
>prophage 20
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	216534	246284	4847638	tRNA,protease	Tetraselmis_virus(14.29%)	22	NA	NA
WP_003858247.1|216534_218817_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.1e-161
WP_058673083.1|219020_219761_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.1	1.8e-20
WP_022650721.1|219797_220319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858254.1|220442_221591_-	MFS transporter	NA	NA	NA	NA	NA
WP_003858256.1|221865_222729_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003858259.1|222730_223348_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
WP_032657928.1|223358_225803_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	8.9e-218
WP_003858266.1|226014_227307_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	4.7e-93
WP_032608957.1|227399_228743_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.3	1.6e-80
WP_003858270.1|228752_229367_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_058672677.1|229494_233160_-	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.2	2.6e-88
WP_000228469.1|233295_233790_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_112777748.1|234333_235302_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.7	7.9e-61
WP_045347134.1|235416_237183_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	1.6e-11
WP_045347133.1|237182_238904_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.0e-18
WP_032608953.1|238949_239654_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|239938_240157_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_045347136.1|240228_240681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650716.1|241156_243436_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.4e-164
WP_006174393.1|243463_243784_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
WP_006809408.1|244051_244273_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_032608952.1|244343_246284_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	3.8e-38
>prophage 21
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	263116	265819	4847638		Orgyia_leucostigma_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_045347125.1|263116_265819_-	PKD domain-containing protein	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	59.6	2.6e-186
>prophage 22
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	282224	282953	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_006809439.1|282224_282953_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.8e-28
>prophage 23
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	286073	297293	4847638		Bacillus_phage(33.33%)	12	NA	NA
WP_022650691.1|286073_287543_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	3.1e-24
WP_023324382.1|287526_288234_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	8.4e-36
WP_045347176.1|288355_289483_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.2	2.5e-29
WP_086527936.1|289523_290021_-	YbjO family protein	NA	NA	NA	NA	NA
WP_003858378.1|290063_290909_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_017384875.1|290905_291859_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_017693732.1|291868_293002_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_022650689.1|293145_294258_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003858385.1|294608_295085_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_045347178.1|295148_296051_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	2.2e-36
WP_003858388.1|296115_296838_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_006809455.1|297023_297293_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	7.9e-27
>prophage 24
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	303650	305745	4847638		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_038415737.1|303650_303971_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	4.1e-22
WP_045347186.1|304011_305301_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.7	1.8e-169
WP_045347188.1|305313_305745_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	9.0e-49
>prophage 25
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	311753	313804	4847638		Escherichia_phage(50.0%)	2	NA	NA
WP_022650678.1|311753_312512_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	26.1	1.8e-12
WP_022650677.1|312598_313804_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.2	1.6e-98
>prophage 26
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	321289	323161	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_023324373.1|321289_323161_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	4.5e-12
>prophage 27
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	326376	330503	4847638		Synechococcus_phage(50.0%)	3	NA	NA
WP_032624911.1|326376_327039_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	32.7	2.8e-25
WP_008501194.1|327166_328066_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_058672686.1|328070_330503_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	49.1	1.0e-08
>prophage 28
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	338078	339674	4847638		Tupanvirus(100.0%)	1	NA	NA
WP_003858434.1|338078_339674_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	9.4e-59
>prophage 29
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	344997	345366	4847638		Campylobacter_virus(100.0%)	1	NA	NA
WP_032628178.1|344997_345366_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	31.7	4.0e-05
>prophage 30
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	353677	358817	4847638		Enterobacteria_phage(33.33%)	6	NA	NA
WP_003858450.1|353677_354196_-	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
WP_022650655.1|354550_355438_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100801.1|355736_356240_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.4	9.3e-05
WP_003858455.1|356601_357345_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003858462.1|357438_358098_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003858465.1|358094_358817_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	4.7e-34
>prophage 31
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	362345	362999	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003858470.1|362345_362609_+	DUF1471 domain-containing protein	NA	A0A142IIN6	Enterobacteria_phage	43.8	1.3e-05
WP_003858472.1|362732_362999_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	50.6	4.9e-13
>prophage 32
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	370210	377474	4847638		Bacillus_phage(33.33%)	5	NA	NA
WP_023324351.1|370210_372388_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.4e-43
WP_003858487.1|372485_373868_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	3.7e-51
WP_003858489.1|374072_374750_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_023324350.1|374746_375742_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_032608898.1|375734_377474_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.5	7.2e-20
>prophage 33
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	387092	388001	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_023299636.1|387092_388001_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.3	1.3e-25
>prophage 34
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	395225	398644	4847638		Klosneuvirus(50.0%)	3	NA	NA
WP_052686873.1|395225_396533_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.2	2.0e-19
WP_003858531.1|396580_397057_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_045346785.1|397123_398644_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	3.6e-84
>prophage 35
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	406912	413441	4847638		Planktothrix_phage(33.33%)	7	NA	NA
WP_112777577.1|406912_407971_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.3	3.1e-18
WP_003858545.1|407970_408663_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_058672691.1|408659_409436_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003858549.1|409614_409767_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_112777578.1|409894_410683_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_045346790.1|410750_412223_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	2.3e-11
WP_023299622.1|412424_413441_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	5.2e-79
>prophage 36
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	417764	421234	4847638		Edwardsiella_phage(33.33%)	4	NA	NA
WP_003858564.1|417764_418817_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_003858566.1|419120_419480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777579.1|419579_420518_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	4.4e-24
WP_022650623.1|420514_421234_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	36.4	6.8e-25
>prophage 37
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	449887	450679	4847638		Kaumoebavirus(100.0%)	1	NA	NA
WP_003858627.1|449887_450679_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.1	2.0e-09
>prophage 38
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	453775	460139	4847638		Hokovirus(50.0%)	5	NA	NA
WP_022650613.1|453775_455188_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.1	8.9e-61
WP_003858637.1|455786_455993_-	YbfA family protein	NA	NA	NA	NA	NA
WP_003858638.1|456303_456393_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_112777581.1|456392_458072_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_045345757.1|458090_460139_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	8.4e-28
>prophage 39
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	463411	464089	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_003858643.1|463411_464089_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	29.7	2.0e-26
>prophage 40
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	475656	479443	4847638	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_023315634.1|475656_477324_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.0	0.0e+00
WP_003858662.1|477493_479443_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.9e-08
>prophage 41
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	484050	485715	4847638		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003858669.1|484050_485715_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	1.6e-85
>prophage 42
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	489641	490688	4847638		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003858674.1|489641_490688_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 43
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	496518	497244	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_006809622.1|496518_497244_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.1e-30
>prophage 44
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	500844	503427	4847638	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_045345767.1|500844_503427_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	1.7e-182
>prophage 45
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	509818	512275	4847638		Synechococcus_phage(50.0%)	2	NA	NA
WP_032608855.1|509818_510925_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.8e-08
WP_003858714.1|511063_512275_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.4	2.0e-101
>prophage 46
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	517065	517878	4847638		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017382474.1|517065_517449_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	1.4e-24
WP_002439184.1|517668_517878_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 47
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	537982	544346	4847638		Morganella_phage(25.0%)	5	NA	NA
WP_022650588.1|537982_538411_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.4	5.3e-17
WP_045345781.1|538470_540036_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	5.4e-43
WP_003858764.1|540278_540842_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_045345782.1|542511_543735_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.6e-61
WP_022650584.1|543719_544346_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.2e-55
>prophage 48
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	553720	558137	4847638		Staphylococcus_phage(50.0%)	5	NA	NA
WP_045345791.1|553720_555223_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.4e-17
WP_058659392.1|555382_556471_+	oxidoreductase	NA	NA	NA	NA	NA
WP_045345794.1|556528_557272_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_022647393.1|557455_557758_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023324295.1|557732_558137_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.0e-06
>prophage 49
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	570066	574781	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_022650565.1|570066_570867_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HQ77	Paramecium_bursaria_Chlorella_virus	23.2	8.4e-08
WP_058672697.1|570923_574781_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.7	7.1e-60
>prophage 50
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	581055	589324	4847638	holin	Brazilian_cedratvirus(33.33%)	7	NA	NA
WP_022650559.1|581055_581862_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	1.1e-12
WP_003858820.1|581864_582776_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_032652913.1|582987_583272_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022650556.1|583410_585444_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.6	3.4e-21
WP_003858827.1|585572_586160_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_045345798.1|586173_587646_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045345799.1|587659_589324_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	5.2e-60
>prophage 51
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	593804	595332	4847638		Planktothrix_phage(100.0%)	2	NA	NA
WP_003858843.1|593804_594641_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.1e-13
WP_045332421.1|594627_595332_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.2e-21
>prophage 52
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	610452	613161	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_045335869.1|610452_613161_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.9	1.7e-68
>prophage 53
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	621254	621542	4847638		Shigella_phage(100.0%)	1	NA	NA
WP_003858885.1|621254_621542_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	38.1	6.9e-05
>prophage 54
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	625541	626513	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_023315563.1|625541_626513_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.6	1.9e-25
>prophage 55
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	636897	637287	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045345808.1|636897_637287_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	65.6	6.4e-46
>prophage 56
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	641550	680562	4847638	integrase,terminase,capsid,plate	Erwinia_phage(43.64%)	67	636728:636774	680576:680622
636728:636774	attL	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_112777588.1|641550_642192_-	hypothetical protein	NA	E5AGC6	Erwinia_phage	45.8	9.3e-42
WP_112777589.1|642191_642428_-	phosphoglycolate phosphatase	NA	E5AGC5	Erwinia_phage	81.6	3.3e-29
WP_112777590.1|642436_643207_-	hypothetical protein	NA	E5AGC4	Erwinia_phage	76.2	9.3e-105
WP_111962787.1|643184_644603_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	77.8	4.1e-207
WP_112777605.1|644668_645010_-	hypothetical protein	NA	E5AGC2	Erwinia_phage	74.3	1.3e-45
WP_112777591.1|645077_645314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063451575.1|645323_645998_-	hypothetical protein	NA	E5AGC1	Erwinia_phage	83.5	3.3e-106
WP_063451576.1|645997_646933_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	89.3	4.1e-155
WP_006809747.1|646907_647249_-	hypothetical protein	NA	E5AGB9	Erwinia_phage	80.5	2.4e-52
WP_112777592.1|647245_647962_-	hypothetical protein	NA	E5AGB8	Erwinia_phage	73.0	8.4e-92
WP_112777593.1|647963_649535_-	tape measure protein	NA	E5AGB7	Erwinia_phage	50.3	3.4e-146
WP_112777594.1|649696_650134_-	hypothetical protein	NA	E5AGB6	Erwinia_phage	67.8	1.0e-47
WP_006809752.1|650168_650615_-	DUF3277 family protein	NA	E5AGB5	Erwinia_phage	75.0	1.3e-58
WP_112777595.1|650617_651958_-	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	77.1	6.4e-194
WP_112777596.1|651977_652517_-	hypothetical protein	NA	E5AGB3	Erwinia_phage	69.3	6.4e-68
WP_006809755.1|652509_652857_-	hypothetical protein	NA	E5AGB2	Erwinia_phage	82.3	7.2e-49
WP_112777606.1|652853_653315_-	hypothetical protein	NA	E5AGB1	Erwinia_phage	64.7	1.1e-49
WP_112777597.1|653305_653713_-	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	75.4	4.4e-53
WP_006809758.1|653712_653916_-	hypothetical protein	NA	E5AGA9	Erwinia_phage	73.1	2.9e-18
WP_112777598.1|653948_654887_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	75.0	2.4e-131
WP_112777599.1|654896_655406_-	hypothetical protein	NA	E5AGA7	Erwinia_phage	71.8	4.8e-57
WP_112777600.1|655405_656578_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	59.9	1.5e-122
WP_112777601.1|656590_657397_-|capsid	minor capsid protein	capsid	E5AGA5	Erwinia_phage	63.5	4.8e-96
WP_112777602.1|657389_658646_-	DUF1073 domain-containing protein	NA	E5AGA4	Erwinia_phage	62.7	9.1e-150
WP_112777603.1|658654_660214_-|terminase	phage terminase large subunit	terminase	E5AGA3	Erwinia_phage	94.2	1.7e-294
WP_045259831.1|660210_660540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112778006.1|660805_661327_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	97.7	2.1e-92
WP_045347033.1|661750_662128_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	39.6	2.8e-14
WP_045347032.1|662124_662613_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	92.6	3.7e-83
WP_045347031.1|662612_662885_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	98.9	2.0e-41
WP_045347030.1|663108_663630_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	64.7	7.0e-56
WP_045347029.1|664220_664739_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	89.5	2.5e-85
WP_045347028.1|664738_664921_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	50.0	3.2e-08
WP_045347027.1|664908_665175_-	hypothetical protein	NA	G0ZNC5	Cronobacter_phage	72.6	2.7e-27
WP_023216141.1|665171_665567_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	94.7	6.1e-68
WP_112777667.1|665822_666005_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	66.0	7.2e-16
WP_112777668.1|665997_666372_-	DUF2591 family protein	NA	A0A192Y677	Salmonella_phage	36.2	3.4e-12
WP_112777669.1|666373_666589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777670.1|666591_666768_-	NinE family protein	NA	C6ZR57	Salmonella_phage	74.1	2.3e-19
WP_112777671.1|666764_667175_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	86.8	3.6e-63
WP_176691847.1|667146_667350_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_176691845.1|667352_667658_-	hypothetical protein	NA	E7C9R6	Salmonella_phage	53.4	1.6e-20
WP_176691848.1|667904_668072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176691849.1|668068_668236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777674.1|668539_668806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777675.1|668802_670173_-	AAA family ATPase	NA	Q9MCP7	Enterobacteria_phage	75.3	1.5e-193
WP_112777676.1|670169_670976_-	replication protein	NA	Q76H52	Enterobacteria_phage	80.5	3.2e-116
WP_088130987.1|670968_671115_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	93.8	8.0e-18
WP_045259811.1|671149_671428_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	82.4	1.1e-34
WP_045347010.1|671536_671722_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	95.1	7.8e-26
WP_045347008.1|671805_672456_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	93.1	2.9e-115
WP_176691850.1|673059_673230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116484368.1|673414_673639_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_176691851.1|673845_674016_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	60.7	6.5e-11
WP_176691852.1|674012_674177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777678.1|674258_674567_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	52.9	8.4e-25
WP_112777679.1|674563_675454_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	78.3	7.4e-130
WP_112777680.1|675453_675936_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	84.4	4.3e-68
WP_112777681.1|675945_676224_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	55.6	1.1e-15
WP_112777682.1|676220_676394_+	DUF2737 family protein	NA	A0A2H4FUQ1	Salmonella_phage	70.2	1.2e-17
WP_112778007.1|676390_676879_+	hypothetical protein	NA	B1GS42	Salmonella_phage	41.3	8.7e-16
WP_112777684.1|676875_677076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777685.1|677072_677408_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_112777694.1|677555_678119_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	53.8	1.9e-43
WP_112777695.1|678326_678527_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	50.0	5.0e-10
WP_112777686.1|678539_679169_+	Eac protein	NA	A0A220NQT7	Salmonella_phage	85.2	6.0e-102
WP_112777688.1|679398_680562_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	91.5	2.9e-211
680576:680622	attR	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 57
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	690170	691037	4847638		Enterococcus_phage(100.0%)	1	NA	NA
WP_006809817.1|690170_691037_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	5.0e-30
>prophage 58
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	694775	696161	4847638	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_045337209.1|694775_696161_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
>prophage 59
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	704268	704955	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_023315548.1|704268_704955_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-32
>prophage 60
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	708087	708759	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_015571235.1|708087_708759_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.3	2.7e-23
>prophage 61
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	711789	714288	4847638		uncultured_virus(100.0%)	1	NA	NA
WP_112777689.1|711789_714288_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.2	5.9e-108
>prophage 62
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	724265	729810	4847638		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_023324248.1|724265_726140_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.1	8.6e-112
WP_006809843.1|726250_726856_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003858972.1|726855_727188_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_112777691.1|727241_729170_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	7.9e-44
WP_000127359.1|729258_729810_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
>prophage 63
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	736579	743633	4847638		Leptospira_phage(50.0%)	6	NA	NA
WP_022650497.1|736579_739726_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	3.4e-52
WP_006809850.1|740236_740611_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_015571250.1|740638_740857_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_022650496.1|741065_741617_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_022650495.1|741733_742201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608667.1|742172_743633_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.8	2.0e-15
>prophage 64
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	746672	750936	4847638		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_045346370.1|746672_749762_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	66.1	0.0e+00
WP_112777692.1|749865_750936_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	53.4	2.2e-88
>prophage 65
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	758084	761613	4847638		Bacillus_phage(100.0%)	2	NA	NA
WP_045346367.1|758084_759866_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	4.0e-42
WP_022650483.1|759858_761613_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.7e-48
>prophage 66
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	765991	767357	4847638		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_015571271.1|765991_766687_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	9.3e-88
WP_022650480.1|766690_767020_-	addiction module antidote protein	NA	NA	NA	NA	NA
WP_045346366.1|767006_767357_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	47.6	1.0e-13
>prophage 67
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	770513	775561	4847638	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|770513_770786_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_006809878.1|770996_773351_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	5.5e-225
WP_006809879.1|773535_774810_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	1.3e-132
WP_006809880.1|774937_775561_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.2e-64
>prophage 68
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	796439	798101	4847638		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003859098.1|796439_796910_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.0e-29
WP_022650459.1|796997_798101_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.7	2.9e-51
>prophage 69
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	801712	806052	4847638	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_003859105.1|801712_802684_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.2	2.5e-46
WP_045346363.1|802694_804542_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003859109.1|804569_804902_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003859110.1|804924_806052_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.2e-89
>prophage 70
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	817869	826856	4847638		Bacillus_phage(60.0%)	6	NA	NA
WP_023315505.1|817869_819165_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	2.2e-26
WP_003859122.1|819186_819876_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	9.7e-37
WP_058673161.1|820063_821269_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	1.5e-08
WP_045346357.1|821265_824397_+	exonuclease subunit SbcC	NA	M1U9H5	Synechococcus_phage	30.1	2.3e-08
WP_003859127.1|824912_825818_-	fructokinase	NA	NA	NA	NA	NA
WP_003859129.1|825941_826856_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.4	2.2e-100
>prophage 71
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	830463	831567	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_045347337.1|830463_831567_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	31.4	9.5e-18
>prophage 72
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	839480	840641	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003859164.1|839480_840641_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.9	6.7e-06
>prophage 73
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	849154	849922	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_003863171.1|849154_849922_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.0	4.7e-24
>prophage 74
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	854769	856554	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_032608617.1|854769_856554_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	6.9e-18
>prophage 75
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	860767	916198	4847638	holin,coat,tail,integrase,lysis,transposase,terminase	Escherichia_phage(43.28%)	83	863907:863952	912285:912330
WP_112778008.1|860767_861966_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	88.8	5.1e-166
WP_071785715.1|861958_862150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608610.1|862172_862529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608608.1|862531_863074_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_023315491.1|863179_863338_-	hypothetical protein	NA	NA	NA	NA	NA
863907:863952	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_112777927.1|864092_864416_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	4.9e-23
WP_154818950.1|864403_864643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112778009.1|864737_866039_-|tail	phage tail protein	tail	G8C7R8	Escherichia_phage	55.5	1.7e-119
WP_112777844.1|866098_867064_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	1.3e-58
WP_112777843.1|867065_870965_-|tail	phage tail protein	tail	G8C7R4	Escherichia_phage	76.3	0.0e+00
WP_022651619.1|871020_871620_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	95.0	3.1e-100
WP_023295179.1|871607_872339_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	96.7	5.3e-150
WP_176691853.1|872351_873122_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.5	3.0e-143
WP_112777841.1|873121_873472_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	91.4	7.5e-54
WP_127341916.1|873557_873944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777840.1|874000_877174_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	83.6	0.0e+00
WP_016247126.1|877173_877461_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_023330244.1|877478_877817_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	9.5e-54
WP_112777839.1|877884_878793_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	66.5	7.0e-51
WP_106105980.1|878936_879869_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	99.0	7.9e-167
WP_112777838.1|879915_880365_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	4.6e-72
WP_048218122.1|880354_880954_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.9	2.3e-98
WP_022651630.1|880956_881310_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.5	5.4e-52
WP_048218125.1|881311_881794_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.6	4.3e-84
WP_112777837.1|881796_882054_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.9	9.5e-14
WP_044704670.1|882093_883230_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.3	1.1e-194
WP_112777836.1|883246_883999_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	96.0	4.8e-130
WP_022651635.1|884106_884316_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_109963102.1|884319_885426_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	89.4	2.0e-185
WP_109963103.1|885427_886831_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.7	6.8e-255
WP_109963104.1|886835_888320_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.3	2.0e-252
WP_059287857.1|888319_888835_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	62.2	6.7e-51
WP_105322456.1|888838_889045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058673082.1|889374_889893_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.8	2.1e-92
WP_058672914.1|890179_890662_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	57.2	2.7e-38
WP_112777895.1|890658_891135_-	lysozyme	NA	K7PKX1	Enterobacterial_phage	90.3	6.0e-78
WP_001514184.1|891138_891414_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|891410_891812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777894.1|892308_892998_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.9	1.4e-56
WP_112777893.1|893107_893713_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	69.8	2.2e-40
WP_112777892.1|893705_893870_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	6.1e-14
WP_112777891.1|893862_894300_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	59.2	6.8e-44
WP_112777890.1|894484_894766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777889.1|894910_895096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777888.1|895095_895377_-	hypothetical protein	NA	A0A2D2W302	Escherichia_phage	40.8	1.6e-06
WP_112777887.1|895376_896108_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	36.8	1.9e-14
WP_112777886.1|896315_896702_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	46.2	6.7e-11
WP_112777885.1|896714_897134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777884.1|897130_897631_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	37.6	2.0e-07
WP_112777883.1|897627_897909_-	hypothetical protein	NA	S4TW48	Salmonella_phage	55.3	3.2e-15
WP_112777882.1|897991_898336_-	transcriptional regulator	NA	G8C7U7	Escherichia_phage	73.0	4.2e-41
WP_112777881.1|898332_899034_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	70.8	3.7e-92
WP_112777880.1|899030_899963_-	replication protein	NA	A5VW95	Enterobacteria_phage	79.4	1.5e-53
WP_112777879.1|900148_900691_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	92.2	3.3e-88
WP_001514164.1|900721_900973_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_112777878.1|901100_901793_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.9	1.8e-59
WP_112777877.1|901828_902305_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	64.7	1.1e-50
WP_112777876.1|903166_903358_+	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	57.8	8.3e-15
WP_112777875.1|903403_903664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777874.1|903805_904003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176691846.1|903999_904161_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	96.2	5.9e-22
WP_006809788.1|904157_904367_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_058659112.1|904413_904923_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	44.7	1.3e-35
WP_045892125.1|904919_905204_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	2.2e-48
WP_112777873.1|905222_905969_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_112777872.1|905965_906583_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	60.2	6.2e-59
WP_063945346.1|906579_907008_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.0	4.9e-71
WP_165592604.1|907004_907172_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	94.5	5.6e-23
WP_058672877.1|907168_907720_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	5.2e-57
WP_032652770.1|907716_907935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080399866.1|907931_908204_+	DUF5405 family protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
WP_047716558.1|908200_908401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058672879.1|908397_908934_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.0	9.2e-35
WP_112777776.1|909000_909222_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	61.1	1.0e-16
WP_112777777.1|909417_909657_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	5.4e-27
WP_062932837.1|909666_909852_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	52.0	1.1e-06
WP_112777778.1|910043_910244_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	84.8	2.2e-26
WP_112777779.1|910254_910584_+	hypothetical protein	NA	G9L655	Escherichia_phage	52.1	3.5e-21
WP_176691854.1|910620_910785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777780.1|911109_912270_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	92.7	3.1e-213
WP_045347085.1|912471_913725_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	1.2e-96
912285:912330	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_045347084.1|913736_914840_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.3e-59
WP_003863199.1|915145_916198_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
>prophage 76
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	929401	929980	4847638		Caulobacter_phage(100.0%)	1	NA	NA
WP_003863232.1|929401_929980_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	1.5e-14
>prophage 77
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	935739	937989	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_023315468.1|935739_937989_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	5.2e-23
>prophage 78
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	947235	947943	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_045347081.1|947235_947943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.5e-32
>prophage 79
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	957715	961588	4847638		Moraxella_phage(100.0%)	1	NA	NA
WP_112777781.1|957715_961588_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.5	4.3e-25
>prophage 80
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	981525	985730	4847638		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_006810012.1|981525_982266_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	5.0e-39
WP_160840538.1|982210_982789_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	6.4e-50
WP_048209360.1|982789_983506_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_022650425.1|983538_984297_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_022650424.1|984365_985730_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
>prophage 81
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	989786	990590	4847638		Indivirus(100.0%)	1	NA	NA
WP_023315437.1|989786_990590_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
>prophage 82
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	997256	998288	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_003856124.1|997256_998288_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 83
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1010252	1014370	4847638		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_112777536.1|1010252_1013735_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	7.7e-207
WP_003856158.1|1013773_1014370_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	4.6e-27
>prophage 84
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1023196	1023955	4847638		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003856176.1|1023196_1023955_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
>prophage 85
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1035313	1036747	4847638	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003856219.1|1035313_1036747_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
>prophage 86
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1040682	1041027	4847638		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003856230.1|1040682_1041027_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 87
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1046933	1047731	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_003856242.1|1046933_1047731_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 88
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1052899	1059673	4847638	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_045346806.1|1052899_1055329_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	5.3e-37
WP_003856249.1|1055402_1055957_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_003856251.1|1055946_1056651_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155232.1|1056827_1057283_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_023324171.1|1057342_1058233_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_086527962.1|1058248_1059673_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.5	1.6e-25
>prophage 89
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1072244	1078785	4847638		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003856300.1|1072244_1073171_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
WP_003856301.1|1073278_1073941_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003856303.1|1074005_1074542_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
WP_045346602.1|1074748_1077139_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_045346601.1|1077225_1078785_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	57.6	3.2e-19
>prophage 90
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1087026	1088451	4847638		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003856313.1|1087026_1088451_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.5e-41
>prophage 91
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1099391	1099955	4847638		Sphingobium_phage(100.0%)	1	NA	NA
WP_059291335.1|1099391_1099955_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	33.1	6.7e-12
>prophage 92
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1104146	1105190	4847638		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_017383777.1|1104146_1105190_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.6	1.1e-103
>prophage 93
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1131141	1132866	4847638		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003856373.1|1131141_1132866_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.7	4.9e-37
>prophage 94
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1145651	1146353	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_032608486.1|1145651_1146353_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	34.5	1.1e-22
>prophage 95
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1152626	1158018	4847638		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_023324143.1|1152626_1154984_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.7	1.4e-29
WP_045346581.1|1155111_1158018_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	4.9e-21
>prophage 96
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1165656	1167024	4847638		Pseudomonas_phage(50.0%)	2	NA	NA
WP_023324139.1|1165656_1166505_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A0A0YWI7	Pseudomonas_phage	42.3	4.9e-06
WP_032608478.1|1166544_1167024_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.5	1.2e-28
>prophage 97
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1176560	1177709	4847638		Halovirus(100.0%)	1	NA	NA
WP_045346579.1|1176560_1177709_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	5.4e-48
>prophage 98
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1181208	1195036	4847638	tRNA	Megavirus(20.0%)	11	NA	NA
WP_045347306.1|1181208_1184025_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.5	3.8e-79
WP_003856456.1|1184070_1184997_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_003856458.1|1185325_1185589_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_045347307.1|1185647_1186547_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_023315366.1|1186605_1187781_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	4.7e-84
WP_008502040.1|1187954_1189100_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.3	4.1e-24
WP_045347309.1|1189187_1191101_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	3.8e-147
WP_003856474.1|1191396_1191963_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_045347310.1|1191939_1193262_-	MFS transporter	NA	NA	NA	NA	NA
WP_003856479.1|1193384_1193972_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003856481.1|1194082_1195036_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	5.7e-11
>prophage 99
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1208436	1215699	4847638		Bacillus_phage(33.33%)	5	NA	NA
WP_045347322.1|1208436_1210374_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	3.6e-12
WP_003856515.1|1210600_1212268_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
WP_022650376.1|1212359_1213259_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045344267.1|1213367_1214369_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003856522.1|1214466_1215699_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.4	4.4e-88
>prophage 100
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1224646	1225969	4847638		Geobacillus_virus(100.0%)	1	NA	NA
WP_112777528.1|1224646_1225969_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.2e-78
>prophage 101
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1231428	1234227	4847638		Salmonella_phage(50.0%)	3	NA	NA
WP_003856556.1|1231428_1231590_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
WP_003856559.1|1231715_1232333_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856562.1|1232637_1234227_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.0	7.0e-30
>prophage 102
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1237965	1239030	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_112777527.1|1237965_1239030_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	3.4e-20
>prophage 103
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1246294	1247574	4847638		Salmonella_phage(50.0%)	2	NA	NA
WP_003856579.1|1246294_1246840_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	56.4	4.4e-24
WP_003856580.1|1246836_1247574_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	48.1	7.1e-62
>prophage 104
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1251305	1252970	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003856589.1|1251305_1252970_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	2.5e-14
>prophage 105
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1292121	1299234	4847638	protease	Bacillus_virus(50.0%)	3	NA	NA
WP_003863062.1|1292121_1292727_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	39.8	7.2e-28
WP_003863061.1|1293027_1293645_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_045345970.1|1293648_1299234_-	AAA family ATPase	NA	Q67624	IC4_retrovirus	33.3	3.4e-07
>prophage 106
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1305019	1307925	4847638		Mycobacterium_phage(50.0%)	2	NA	NA
WP_045345967.1|1305019_1305841_+	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	28.4	4.3e-15
WP_022650329.1|1305972_1307925_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	30.2	2.6e-26
>prophage 107
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1320875	1322171	4847638		Pseudomonas_phage(50.0%)	2	NA	NA
WP_112777524.1|1320875_1321319_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.1	5.1e-15
WP_112777523.1|1321349_1322171_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	8.8e-45
>prophage 108
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1329780	1332243	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_112777517.1|1329780_1332243_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	35.7	7.9e-73
>prophage 109
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1337053	1344699	4847638	integrase	Liberibacter_phage(33.33%)	6	1323586:1323599	1346052:1346065
1323586:1323599	attL	GAACGCTTCGCCGC	NA	NA	NA	NA
WP_112777513.1|1337053_1340149_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.5	4.2e-55
WP_112777512.1|1340148_1340862_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_112777511.1|1340907_1342389_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	33.1	5.6e-58
WP_102014686.1|1342381_1342984_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001003202.1|1343000_1343189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102014685.1|1343451_1344699_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.5	2.1e-82
1346052:1346065	attR	GCGGCGAAGCGTTC	NA	NA	NA	NA
>prophage 110
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1363071	1373248	4847638		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_003863368.1|1363071_1364004_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.3e-52
WP_003863370.1|1364016_1364478_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003863373.1|1364551_1364938_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_045345904.1|1365076_1366525_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.1	1.1e-21
WP_045345903.1|1366619_1369004_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_112777537.1|1369204_1371913_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.1	2.6e-37
WP_023315291.1|1372300_1373248_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	22.1	1.2e-13
>prophage 111
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1378455	1381199	4847638		Vibrio_phage(50.0%)	2	NA	NA
WP_003863406.1|1378455_1380594_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	1.7e-268
WP_003856093.1|1380734_1381199_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.2	2.3e-50
>prophage 112
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1394609	1402766	4847638		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003856070.1|1394609_1395608_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.0	3.7e-69
WP_044704215.1|1395648_1397217_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	7.4e-08
WP_023302976.1|1397310_1398312_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_161353898.1|1398298_1399324_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017383923.1|1399334_1400837_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.0e-10
WP_017383924.1|1400969_1401926_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_006810347.1|1402235_1402766_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.6e-55
>prophage 113
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1419375	1421025	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003856047.1|1419375_1421025_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	1.7e-10
>prophage 114
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1437031	1438963	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_058672828.1|1437031_1438963_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.6e-10
>prophage 115
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1442938	1455924	4847638	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_023315260.1|1442938_1445380_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.2	8.4e-67
WP_003855998.1|1445418_1445844_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003855997.1|1446036_1447335_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	6.4e-66
WP_003855996.1|1447439_1447637_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_003855994.1|1447708_1448713_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003855992.1|1448715_1449975_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_003855991.1|1450031_1451312_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003855990.1|1451386_1451698_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_058672827.1|1451783_1452734_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_022650252.1|1452726_1454571_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	2.2e-59
WP_023315257.1|1454580_1455924_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	2.6e-17
>prophage 116
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1459840	1460386	4847638		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_045347143.1|1459840_1460386_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	1.5e-29
>prophage 117
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1467669	1468647	4847638		Tupanvirus(100.0%)	1	NA	NA
WP_003855960.1|1467669_1468647_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	5.8e-27
>prophage 118
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1474592	1475123	4847638		Morganella_phage(100.0%)	1	NA	NA
WP_003855945.1|1474592_1475123_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	51.6	3.3e-45
>prophage 119
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1481413	1483394	4847638		Vibrio_phage(50.0%)	2	NA	NA
WP_003855930.1|1481413_1483060_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	6.9e-190
WP_003855929.1|1483100_1483394_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 120
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1500231	1501734	4847638		Burkholderia_virus(100.0%)	1	NA	NA
WP_003860199.1|1500231_1501734_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	5.9e-55
>prophage 121
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1508250	1509039	4847638		Pithovirus(100.0%)	1	NA	NA
WP_003860210.1|1508250_1509039_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.7	5.9e-14
>prophage 122
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1514589	1516035	4847638		Bacillus_virus(50.0%)	2	NA	NA
WP_003860225.1|1514589_1515345_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.1e-16
WP_003860227.1|1515354_1516035_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	3.5e-07
>prophage 123
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1521818	1523333	4847638		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003860238.1|1521818_1523333_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.0	7.2e-08
>prophage 124
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1527908	1531044	4847638		Bacillus_phage(50.0%)	2	NA	NA
WP_003860246.1|1527908_1528640_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.7	4.8e-26
WP_080339333.1|1528896_1531044_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.2	3.2e-30
>prophage 125
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1534134	1536093	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045346543.1|1534134_1536093_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	3.0e-91
>prophage 126
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1542111	1543461	4847638		Moraxella_phage(100.0%)	1	NA	NA
WP_003860271.1|1542111_1543461_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	72.0	3.0e-159
>prophage 127
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1549648	1553247	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003860284.1|1549648_1550173_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.3	5.1e-54
WP_045346547.1|1550424_1553247_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	0.0e+00
>prophage 128
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1556411	1558920	4847638		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_032608247.1|1556411_1557491_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	1.6e-30
WP_003860298.1|1557507_1558920_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	8.2e-200
>prophage 129
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1565980	1566589	4847638		Lactococcus_phage(100.0%)	1	NA	NA
WP_045346553.1|1565980_1566589_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	2.7e-14
>prophage 130
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1573688	1574798	4847638		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003860329.1|1573688_1574798_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 131
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1589546	1595571	4847638		Brucella_phage(66.67%)	4	NA	NA
WP_023315213.1|1589546_1589849_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.8	2.9e-22
WP_022650216.1|1589855_1590143_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	44.3	1.2e-12
WP_003860350.1|1590139_1591771_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_045346557.1|1591887_1595571_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	2.2e-26
>prophage 132
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1608173	1613585	4847638		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_045347373.1|1608173_1609763_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	1.4e-67
WP_022650211.1|1609778_1611071_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_045347371.1|1611118_1611811_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002445246.1|1611822_1612095_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_003862310.1|1612281_1612872_-	YjaG family protein	NA	NA	NA	NA	NA
WP_003862312.1|1612913_1613585_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	1.3e-22
>prophage 133
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1622005	1632738	4847638		Bacillus_phage(33.33%)	5	NA	NA
WP_058672882.1|1622005_1623547_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	8.3e-12
WP_010425948.1|1623727_1624036_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003862327.1|1624035_1624353_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_022650200.1|1624409_1628633_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	4.5e-68
WP_008503453.1|1628709_1632738_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	3.6e-22
>prophage 134
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1636727	1641776	4847638		Tupanvirus(25.0%)	4	NA	NA
WP_023323999.1|1636727_1637912_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_015569977.1|1638789_1639740_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_022650198.1|1639782_1640796_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	4.3e-17
WP_022650197.1|1640792_1641776_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.3e-14
>prophage 135
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1651322	1653692	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_045345998.1|1651322_1653692_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.2	2.4e-71
>prophage 136
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1658870	1663346	4847638		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_023315194.1|1658870_1659845_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.7	2.8e-21
WP_003860775.1|1659903_1660116_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_017383576.1|1660359_1661070_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003860776.1|1661400_1661688_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_045345999.1|1661726_1663346_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	26.1	4.0e-25
>prophage 137
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1667281	1670572	4847638		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_112777618.1|1667281_1668052_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.3	1.9e-25
WP_112777617.1|1668054_1668597_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003860787.1|1668600_1668855_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_022650180.1|1668931_1670572_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.4	1.7e-42
>prophage 138
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1682917	1684747	4847638		Catovirus(100.0%)	1	NA	NA
WP_003860800.1|1682917_1684747_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	1.3e-83
>prophage 139
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1688673	1692534	4847638		Bacillus_phage(50.0%)	3	NA	NA
WP_017383586.1|1688673_1690836_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	2.5e-115
WP_003860811.1|1690915_1691632_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_015570006.1|1691631_1692534_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	2.0e-18
>prophage 140
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1710283	1714482	4847638		uncultured_marine_virus(33.33%)	4	NA	NA
WP_032608214.1|1710283_1711414_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	33.5	5.1e-19
WP_022650165.1|1711418_1712096_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_022650164.1|1712092_1713355_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.4	1.5e-22
WP_006812390.1|1713351_1714482_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.2	1.4e-27
>prophage 141
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1718545	1730471	4847638		Indivirus(20.0%)	12	NA	NA
WP_006812392.1|1718545_1718875_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
WP_003860827.1|1719019_1720288_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	2.2e-42
WP_032661064.1|1720294_1721779_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003860830.1|1721829_1723854_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	5.8e-114
WP_006812396.1|1723939_1724221_+	peptidylprolyl isomerase PpiC	NA	NA	NA	NA	NA
WP_022646641.1|1724275_1725097_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006812398.1|1725172_1726192_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003860835.1|1726191_1726659_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_112777616.1|1726690_1726942_-	glutaredoxin 3	NA	A0A141ZMK2	Faustovirus	38.2	3.8e-07
WP_003860840.1|1726953_1727385_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_045346009.1|1727633_1729178_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_045346010.1|1729187_1730471_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.4	4.6e-08
>prophage 142
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1734587	1737968	4847638		Vibrio_phage(33.33%)	3	NA	NA
WP_017383610.1|1734587_1735616_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_045346016.1|1735625_1736822_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.8	4.6e-34
WP_045332960.1|1737035_1737968_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.9e-36
>prophage 143
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1747660	1755259	4847638		Catovirus(20.0%)	10	NA	NA
WP_058659935.1|1747660_1748650_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.3	7.2e-09
WP_003860874.1|1748716_1749991_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003860875.1|1749990_1750761_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023315165.1|1750764_1751244_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	2.4e-26
WP_003860879.1|1751246_1752056_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.6	1.2e-25
WP_003024094.1|1752128_1752296_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|1752318_1752555_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_006812419.1|1752772_1753438_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_086532025.1|1753611_1754823_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.6	5.1e-41
WP_015570042.1|1754800_1755259_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	1.2e-48
>prophage 144
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1767725	1772734	4847638		uncultured_virus(33.33%)	4	NA	NA
WP_058673178.1|1767725_1769396_-	NAD-dependent DNA ligase LigB	NA	A0A218MKC8	uncultured_virus	23.3	1.1e-20
WP_006177710.1|1769646_1770270_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	9.7e-20
WP_000135058.1|1770324_1770600_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003860921.1|1770619_1772734_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 145
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1776944	1778336	4847638		environmental_Halophage(100.0%)	1	NA	NA
WP_015570053.1|1776944_1778336_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.3e-69
>prophage 146
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1784500	1793657	4847638	integrase	uncultured_Caudovirales_phage(60.0%)	8	1776281:1776294	1786526:1786539
1776281:1776294	attL	GCTTGCTCCACGCC	NA	NA	NA	NA
WP_044599767.1|1784500_1785724_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.4	5.5e-160
WP_044599768.1|1785819_1787445_-	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	21.9	1.1e-09
1786526:1786539	attR	GCTTGCTCCACGCC	NA	NA	NA	NA
WP_112777615.1|1787446_1789147_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_039272869.1|1789352_1789703_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.8e-23
WP_044599769.1|1789750_1790113_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_046377360.1|1790130_1791882_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_044599770.1|1791929_1793219_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	1.6e-170
WP_044599771.1|1793231_1793657_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	73.6	1.0e-52
>prophage 147
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1797122	1800369	4847638		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_023305188.1|1797122_1797836_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.6	9.5e-96
WP_044599782.1|1797837_1798161_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_108454447.1|1798291_1798687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044599776.1|1798795_1799815_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_023315141.1|1800165_1800369_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	41.1	7.5e-06
>prophage 148
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1804256	1805078	4847638		Yersinia_phage(100.0%)	1	NA	NA
WP_044599778.1|1804256_1805078_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	1.8e-45
>prophage 149
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1809265	1810294	4847638		Wolbachia_phage(100.0%)	1	NA	NA
WP_072021525.1|1809265_1810294_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	44.0	8.7e-74
>prophage 150
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1821792	1825967	4847638		Morganella_phage(33.33%)	5	NA	NA
WP_003860954.1|1821792_1822317_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.9	9.9e-50
WP_023323942.1|1822434_1823160_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.7	5.2e-41
WP_045346043.1|1823259_1823670_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_022650125.1|1823772_1824732_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_006812462.1|1824878_1825967_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	62.2	3.9e-125
>prophage 151
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1831260	1833357	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_017383654.1|1831260_1833357_-	peptidase domain-containing ABC transporter	NA	F2Y1V5	Organic_Lake_phycodnavirus	23.9	3.9e-12
>prophage 152
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1859747	1860905	4847638		Salmonella_phage(100.0%)	1	NA	NA
WP_045346062.1|1859747_1860905_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.6	1.3e-28
>prophage 153
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1871872	1872877	4847638		Tupanvirus(100.0%)	1	NA	NA
WP_023315093.1|1871872_1872877_-	alpha/beta hydrolase	NA	A0A2K9KZN8	Tupanvirus	28.4	2.6e-06
>prophage 154
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1878334	1880023	4847638		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003861056.1|1878334_1880023_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.5	2.6e-59
>prophage 155
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1883263	1884448	4847638		Salmonella_phage(100.0%)	1	NA	NA
WP_003861070.1|1883263_1884448_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.6	1.6e-15
>prophage 156
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1895834	1896810	4847638		Synechococcus_phage(50.0%)	2	NA	NA
WP_003861091.1|1895834_1896263_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	1.1e-14
WP_003861094.1|1896399_1896810_-	heat shock chaperone IbpA	NA	A0A218MKI2	uncultured_virus	39.2	5.4e-19
>prophage 157
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1900254	1901403	4847638		Oenococcus_phage(100.0%)	1	NA	NA
WP_003861103.1|1900254_1901403_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.1	9.4e-53
>prophage 158
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1906825	1914213	4847638		Bacillus_virus(33.33%)	7	NA	NA
WP_003861119.1|1906825_1909237_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	3.1e-114
WP_112778010.1|1909265_1910339_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003861122.1|1910338_1911439_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.5e-52
WP_003861124.1|1911443_1912838_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|1913475_1913616_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003861126.1|1913632_1913992_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|1913955_1914213_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 159
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1921081	1927935	4847638		Moraxella_phage(33.33%)	7	NA	NA
WP_139156836.1|1921081_1922419_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.6	4.3e-65
WP_003861151.1|1922584_1923250_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003861153.1|1923344_1924070_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003861154.1|1924096_1924870_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003861156.1|1924917_1925808_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003861158.1|1925807_1926767_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_022652104.1|1926894_1927935_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.7	1.3e-48
>prophage 160
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1933567	1937008	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_023323908.1|1933567_1935397_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.2e-131
WP_022652099.1|1935637_1937008_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	33.2	2.9e-32
>prophage 161
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1948791	1949784	4847638		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003862385.1|1948791_1949784_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	3.5e-48
>prophage 162
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1952948	1960897	4847638		Enterobacteria_phage(50.0%)	7	NA	NA
WP_003862390.1|1952948_1954817_+	low affinity potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	29.7	2.3e-64
WP_003862392.1|1955042_1955462_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003862393.1|1955469_1956975_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	7.6e-18
WP_003862395.1|1956979_1957945_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003862397.1|1957972_1958863_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	3.3e-05
WP_003862399.1|1958971_1959901_+	ribokinase	NA	NA	NA	NA	NA
WP_003862402.1|1959904_1960897_+	ribose operon transcriptional repressor RbsR	NA	C6ZCU4	Enterobacteria_phage	33.7	1.1e-36
>prophage 163
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1973032	1975825	4847638		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_045346518.1|1973032_1975825_+	DNA polymerase I	NA	A0A1B1IWN2	uncultured_Mediterranean_phage	27.6	8.4e-55
>prophage 164
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1979696	1982170	4847638		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003861919.1|1979696_1981109_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	1.1e-05
WP_003861923.1|1981120_1982170_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
>prophage 165
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1993875	1996653	4847638		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003861941.1|1993875_1994766_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	2.1e-63
WP_045346523.1|1994921_1995818_+	sugar kinase	NA	NA	NA	NA	NA
WP_003861944.1|1995852_1996653_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.1e-23
>prophage 166
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2017757	2019260	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_003861985.1|2017757_2019260_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.1e-11
>prophage 167
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2027440	2030923	4847638		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_003861999.1|2027440_2028061_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	2.2e-64
WP_003862001.1|2028127_2028802_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_015569937.1|2028854_2030228_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_058672770.1|2030224_2030923_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
>prophage 168
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2042780	2047244	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_003862030.1|2042780_2043626_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	7.5e-15
WP_003862031.1|2044025_2044265_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_003862032.1|2044345_2044831_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_086531981.1|2044923_2045850_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003862035.1|2045912_2047244_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.7	1.9e-44
>prophage 169
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2062576	2065755	4847638		Synechococcus_phage(50.0%)	2	NA	NA
WP_023315033.1|2062576_2063239_-	fructose-6-phosphate aldolase	NA	A0A0E3FJJ0	Synechococcus_phage	34.6	2.2e-30
WP_045346529.1|2063253_2065755_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	3.9e-11
>prophage 170
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2084738	2086589	4847638		Acinetobacter_phage(100.0%)	1	NA	NA
WP_045346533.1|2084738_2086589_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.4	1.0e-11
>prophage 171
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2096669	2098316	4847638		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_045346812.1|2096669_2098316_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	31.9	1.5e-64
>prophage 172
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2124118	2125957	4847638		Tupanvirus(100.0%)	1	NA	NA
WP_023315017.1|2124118_2125957_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	6.9e-13
>prophage 173
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2149218	2150760	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015572746.1|2149218_2150760_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.8e-15
>prophage 174
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2155085	2156081	4847638		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_045346826.1|2155085_2156081_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	1.8e-12
>prophage 175
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2164808	2165423	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_023323863.1|2164808_2165423_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.0	6.2e-19
>prophage 176
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2211792	2213835	4847638		Indivirus(100.0%)	1	NA	NA
WP_032608085.1|2211792_2213835_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	5.2e-46
>prophage 177
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2218811	2219837	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_015571505.1|2218811_2219837_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.7	2.1e-75
>prophage 178
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2239027	2240105	4847638		Vibrio_phage(50.0%)	2	NA	NA
WP_003861274.1|2239027_2239693_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	3.3e-58
WP_000130627.1|2239862_2240105_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	80.6	6.0e-10
>prophage 179
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2243219	2246094	4847638		Streptococcus_phage(50.0%)	2	NA	NA
WP_023323839.1|2243219_2245391_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.3	9.9e-120
WP_003861515.1|2245467_2246094_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	2.9e-32
>prophage 180
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2249098	2253322	4847638		Staphylococcus_phage(33.33%)	4	NA	NA
WP_003861525.1|2249098_2249770_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.9e-14
WP_003861527.1|2249756_2250812_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000159624.1|2251062_2251920_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	9.2e-45
WP_023323836.1|2252056_2253322_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.7e-26
>prophage 181
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2258898	2260378	4847638		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_003861544.1|2258898_2259663_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	2.8e-13
WP_022651964.1|2259664_2260378_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.2	1.1e-14
>prophage 182
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2263779	2265587	4847638		Planktothrix_phage(50.0%)	2	NA	NA
WP_003861554.1|2263779_2264850_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	5.2e-21
WP_022651961.1|2264846_2265587_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.1	9.2e-09
>prophage 183
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2282707	2285155	4847638		Dickeya_phage(100.0%)	1	NA	NA
WP_045345656.1|2282707_2285155_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.2e-33
>prophage 184
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2288232	2288991	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_003861593.1|2288232_2288991_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	2.8e-21
>prophage 185
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2292331	2294725	4847638		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_058659682.1|2292331_2294725_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	4.7e-14
>prophage 186
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2299877	2300660	4847638		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003861604.1|2299877_2300660_+	pimeloyl-ACP methyl ester esterase BioH	NA	A0A0M3UKI8	Mycobacterium_phage	32.0	3.1e-07
>prophage 187
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2306897	2310677	4847638		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2306897_2307617_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_003861615.1|2307613_2308960_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	2.5e-12
WP_003861616.1|2309057_2310677_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	5.5e-139
>prophage 188
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2327459	2328272	4847638		Vibrio_phage(100.0%)	1	NA	NA
WP_003861633.1|2327459_2328272_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.2	2.7e-70
>prophage 189
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2338520	2345066	4847638		Acinetobacter_phage(33.33%)	7	NA	NA
WP_003861654.1|2338520_2339084_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	5.1e-60
WP_003861656.1|2339171_2340392_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_045345633.1|2340388_2342476_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	84.8	2.0e-64
WP_000242758.1|2342533_2343166_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_045345632.1|2343476_2343881_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003861663.1|2343947_2344817_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_014171926.1|2344847_2345066_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	39.1	1.1e-05
>prophage 190
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2350884	2356252	4847638		Salmonella_phage(50.0%)	5	NA	NA
WP_023314938.1|2350884_2351844_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	93.5	9.9e-56
WP_003861679.1|2351846_2352464_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_003861680.1|2352463_2353360_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_112777665.1|2353399_2354332_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003861684.1|2354347_2356252_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	5.9e-76
>prophage 191
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2364059	2367428	4847638		Streptococcus_phage(50.0%)	2	NA	NA
WP_022651946.1|2364059_2366174_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	1.8e-57
WP_022651945.1|2366243_2367428_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 192
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2387314	2391639	4847638	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_045344242.1|2387314_2388262_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.5	8.4e-07
WP_006812188.1|2388286_2388796_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
WP_045347425.1|2388923_2390048_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460665.1|2390019_2390493_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_022651940.1|2390519_2391074_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_003863353.1|2391066_2391639_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	25.7	1.9e-09
>prophage 193
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2405052	2407137	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_003860371.1|2405052_2407137_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	7.0e-22
>prophage 194
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2420391	2421435	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2420391_2421435_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 195
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2440292	2441660	4847638	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003860431.1|2440292_2441660_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	5.1e-21
>prophage 196
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2445623	2449625	4847638	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_026080566.1|2445623_2446121_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	3.8e-27
WP_022651924.1|2446223_2447006_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_022651923.1|2447128_2448022_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_022651922.1|2448134_2449625_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.3	1.4e-08
>prophage 197
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2457615	2484105	4847638	tRNA	Staphylococcus_phage(18.18%)	25	NA	NA
WP_112777629.1|2457615_2458557_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.6	1.5e-16
WP_045346567.1|2458536_2460039_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.4	4.8e-81
WP_045346566.1|2460176_2461823_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003861889.1|2461970_2462990_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	5.4e-44
WP_003861887.1|2463073_2463577_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017382726.1|2463700_2466556_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	1.6e-141
WP_003861884.1|2466555_2466999_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003861882.1|2467067_2468579_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	1.2e-47
WP_003861881.1|2468844_2469945_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001147540.1|2469944_2471027_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000809803.1|2471164_2473498_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.7	8.4e-40
WP_003861876.1|2473730_2474384_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003861874.1|2474380_2475106_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003861872.1|2475145_2475418_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003861870.1|2475414_2476269_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003861869.1|2476314_2476806_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003861866.1|2476888_2477176_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_112777628.1|2477198_2478632_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003861862.1|2478679_2479405_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.1e-22
WP_003861860.1|2479411_2479966_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003861858.1|2479934_2480510_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003861856.1|2480506_2481073_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.6	8.5e-55
WP_003861853.1|2481087_2482074_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	1.1e-38
WP_022651914.1|2482087_2483065_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003861850.1|2483292_2484105_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	2.4e-18
>prophage 198
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2488149	2489637	4847638		Vibrio_phage(50.0%)	2	NA	NA
WP_017382732.1|2488149_2488437_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	1.0e-16
WP_023314908.1|2488665_2489637_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	3.5e-08
>prophage 199
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2492768	2494471	4847638		Bacillus_phage(100.0%)	2	NA	NA
WP_045346564.1|2492768_2493812_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	23.0	1.6e-11
WP_003861819.1|2493808_2494471_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	38.1	9.0e-32
>prophage 200
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2497913	2509575	4847638	protease	Micromonas_pusilla_virus(25.0%)	8	NA	NA
WP_003861810.1|2497913_2499848_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	2.0e-116
WP_045346561.1|2499946_2500795_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.0	7.5e-23
WP_003861804.1|2500787_2502125_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003861803.1|2502347_2502680_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_022649518.1|2502962_2504309_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	9.6e-65
WP_014833432.1|2504879_2505332_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003861798.1|2505360_2506863_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003861796.1|2506887_2509575_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	27.0	1.9e-27
>prophage 201
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2515016	2516912	4847638		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_045347163.1|2515016_2516912_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.5	5.4e-53
>prophage 202
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2522597	2530389	4847638		Invertebrate_iridovirus(25.0%)	10	NA	NA
WP_003861768.1|2522597_2522927_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	46.8	8.8e-12
WP_003861766.1|2522941_2523376_+	YhbP family protein	NA	NA	NA	NA	NA
WP_015571965.1|2523355_2523874_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.3	1.8e-11
WP_023304489.1|2524002_2524647_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_058691683.1|2524687_2525725_+	permease	NA	NA	NA	NA	NA
WP_003861756.1|2525775_2526351_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003861754.1|2526360_2526951_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	4.1e-12
WP_003861751.1|2526972_2527368_-	YraN family protein	NA	NA	NA	NA	NA
WP_045347167.1|2527325_2529464_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003861747.1|2529525_2530389_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.2	3.3e-50
>prophage 203
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2547768	2548914	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_003862672.1|2547768_2548914_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.0	4.1e-48
>prophage 204
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2554598	2556893	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032660421.1|2554598_2556893_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
>prophage 205
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2574080	2575046	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_003862625.1|2574080_2575046_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.4	5.2e-36
>prophage 206
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2583058	2584546	4847638		Pithovirus(100.0%)	1	NA	NA
WP_045345575.1|2583058_2584546_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	28.6	4.9e-09
>prophage 207
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2590258	2595381	4847638		Klosneuvirus(33.33%)	3	NA	NA
WP_022651884.1|2590258_2591638_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.4	3.8e-32
WP_045345578.1|2592060_2593581_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	37.1	1.1e-32
WP_022651882.1|2593821_2595381_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	1.9e-08
>prophage 208
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2598977	2604301	4847638	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_006812010.1|2598977_2600822_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_112777625.1|2600974_2602720_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.9e-76
WP_001144069.1|2602835_2603051_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_022651877.1|2603287_2604301_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
>prophage 209
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2613620	2614862	4847638		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_003862543.1|2613620_2614862_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	6.1e-90
>prophage 210
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2619999	2622834	4847638		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_003862540.1|2619999_2621430_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	1.5e-39
WP_003862539.1|2621507_2621804_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003862538.1|2622180_2622834_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.5	5.4e-45
>prophage 211
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2629818	2637928	4847638		Ralstonia_phage(25.0%)	8	NA	NA
WP_023314866.1|2629818_2630979_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	5.9e-87
WP_045332893.1|2630981_2631647_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.5	1.2e-39
WP_112777623.1|2631837_2633316_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_003862517.1|2633519_2634152_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.2	1.5e-20
WP_003862516.1|2634148_2634571_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_023314864.1|2634598_2635426_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_023314863.1|2635425_2636007_+	esterase YqiA	NA	NA	NA	NA	NA
WP_003862513.1|2636035_2637928_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	3.8e-91
>prophage 212
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2647707	2656079	4847638		Stx_converting_phage(25.0%)	6	NA	NA
WP_112777620.1|2647707_2648109_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	44.4	2.8e-20
WP_022651867.1|2648227_2650486_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	2.2e-85
WP_003862497.1|2650648_2651386_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_003862496.1|2651447_2652860_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_162184624.1|2652927_2655165_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.7	3.2e-105
WP_045345600.1|2655251_2656079_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.9e-63
>prophage 213
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2665190	2672294	4847638		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_058673060.1|2665190_2666738_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_023314843.1|2666740_2667490_-	L-fucose operon activator	NA	NA	NA	NA	NA
WP_023314842.1|2667566_2668433_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_003862464.1|2668616_2670479_+	bifunctional glutathionylspermidine amidase/synthase	NA	Q56ES0	Aeromonas_virus	23.8	5.9e-20
WP_003862463.1|2670531_2670966_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_023314840.1|2670962_2672294_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	34.8	8.5e-05
>prophage 214
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2682240	2684025	4847638		Tupanvirus(100.0%)	1	NA	NA
WP_045345607.1|2682240_2684025_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.3	1.8e-13
>prophage 215
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2725582	2726737	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003860037.1|2725582_2726737_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
>prophage 216
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2739507	2741056	4847638		Mycobacterium_phage(50.0%)	2	NA	NA
WP_045345619.1|2739507_2740278_+	alpha/beta hydrolase	NA	A0A249XTU1	Mycobacterium_phage	35.7	1.6e-08
WP_045345620.1|2740261_2741056_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.5	1.3e-05
>prophage 217
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2756430	2757663	4847638		Catovirus(100.0%)	1	NA	NA
WP_017692705.1|2756430_2757663_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 218
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2765451	2768325	4847638		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_032667305.1|2765451_2768325_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	4.1e-262
>prophage 219
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2772777	2774211	4847638		Pandoravirus(100.0%)	1	NA	NA
WP_003863430.1|2772777_2774211_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	5.7e-31
>prophage 220
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2778627	2786216	4847638	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
WP_003863442.1|2778627_2779524_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.3	1.5e-29
WP_003863443.1|2779552_2780266_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_045346666.1|2780271_2782005_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	9.2e-60
WP_096147815.1|2782095_2783193_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_003863452.1|2783203_2784721_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
WP_003863454.1|2784769_2785312_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_022651807.1|2785475_2786216_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	35.7	2.2e-10
>prophage 221
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2792928	2795829	4847638		Tetraselmis_virus(50.0%)	2	NA	NA
WP_045346660.1|2792928_2794911_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	1.6e-153
WP_022651800.1|2794944_2795829_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.3	4.5e-79
>prophage 222
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2813879	2818879	4847638		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_003862835.1|2813879_2814641_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.5e-19
WP_045346654.1|2814953_2816369_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.5	7.1e-26
WP_003862832.1|2816451_2817738_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045332840.1|2817751_2818879_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	8.8e-11
>prophage 223
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2825816	2826854	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003862814.1|2825816_2826854_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.8e-27
>prophage 224
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2832832	2834992	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045346649.1|2832832_2834992_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.5	2.9e-18
>prophage 225
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2839710	2843861	4847638		Hokovirus(50.0%)	3	NA	NA
WP_003862789.1|2839710_2841957_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.9	5.4e-12
WP_003862787.1|2842184_2843060_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003862785.1|2843066_2843861_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	2.0e-118
>prophage 226
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2849290	2864740	4847638	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_023314767.1|2849290_2852173_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.1e-60
WP_045346645.1|2852169_2855712_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.0	3.3e-11
WP_045346644.1|2855708_2857529_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	27.1	3.3e-23
WP_003862767.1|2857562_2858894_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003862766.1|2859121_2860375_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	1.4e-12
WP_003862765.1|2861118_2862216_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_006811804.1|2862291_2863098_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	1.1e-15
WP_045332272.1|2863088_2863535_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_022651789.1|2863534_2864740_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	38.0	3.5e-74
>prophage 227
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2868012	2868768	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_003862753.1|2868012_2868768_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.1	2.7e-08
>prophage 228
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2873585	2874428	4847638		Vibrio_phage(100.0%)	1	NA	NA
WP_023323687.1|2873585_2874428_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.4	1.8e-40
>prophage 229
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2878914	2886997	4847638		Oenococcus_phage(25.0%)	5	NA	NA
WP_003862733.1|2878914_2880255_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.0	4.5e-06
WP_003862731.1|2880270_2881608_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_045346846.1|2881685_2882831_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.8	3.3e-50
WP_003862726.1|2882881_2885641_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.7	1.3e-55
WP_003862724.1|2885698_2886997_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	2.0e-38
>prophage 230
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2890362	2893381	4847638		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_003862718.1|2890362_2892000_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	2.7e-154
WP_006811784.1|2892082_2893381_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	2.4e-129
>prophage 231
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2896745	2897417	4847638		Vibrio_phage(100.0%)	1	NA	NA
WP_006811780.1|2896745_2897417_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	31.4	1.1e-11
>prophage 232
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2911586	2913616	4847638		Hokovirus(50.0%)	2	NA	NA
WP_045346842.1|2911586_2913011_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.4	1.0e-35
WP_023314740.1|2913010_2913616_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.6	5.0e-29
>prophage 233
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2916627	2920302	4847638		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_017382816.1|2916627_2917389_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	3.9e-55
WP_015571709.1|2917382_2918009_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	5.7e-36
WP_022651772.1|2918125_2919250_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.1	3.8e-06
WP_013098493.1|2919309_2920302_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 234
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2925845	2931270	4847638	integrase	Cafeteria_roenbergensis_virus(33.33%)	4	2923371:2923383	2930977:2930989
2923371:2923383	attL	TCTTGGGCTGAAT	NA	NA	NA	NA
WP_112777547.1|2925845_2928413_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.1	4.9e-33
WP_042937604.1|2928572_2930027_+|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.3	5.8e-23
WP_042937603.1|2930038_2930614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777548.1|2930703_2931270_-	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	44.4	4.7e-37
2930977:2930989	attR	ATTCAGCCCAAGA	NA	NA	NA	NA
>prophage 235
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2940792	2946852	4847638		Liberibacter_phage(50.0%)	3	NA	NA
WP_112777557.1|2940792_2944032_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.4	5.2e-64
WP_112016344.1|2944090_2945308_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_112777558.1|2945304_2946852_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.2	2.5e-48
>prophage 236
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2950215	2951937	4847638		Bdellovibrio_phage(100.0%)	1	NA	NA
WP_112777570.1|2950215_2951937_+	ATP-dependent helicase	NA	H9C0J4	Bdellovibrio_phage	24.9	1.3e-08
>prophage 237
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2956474	2957236	4847638		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_022651751.1|2956474_2957236_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.8	3.7e-13
>prophage 238
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2976357	2977371	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045346949.1|2976357_2977371_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	5.4e-28
>prophage 239
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2985698	2986664	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015571677.1|2985698_2986664_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.8	2.0e-35
>prophage 240
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2992227	3000162	4847638	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_022651726.1|2992227_2992881_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	4.0e-08
WP_015571669.1|2992877_2993738_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_058662885.1|2993752_2994631_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003862172.1|2994761_2995259_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.1	9.1e-29
WP_015571667.1|2995348_2996407_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	1.5e-113
WP_017382782.1|2996475_2996976_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_022651724.1|2997107_2999735_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
WP_000906486.1|2999976_3000162_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 241
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3014414	3019684	4847638		Bacillus_virus(20.0%)	5	NA	NA
WP_022651720.1|3014414_3015617_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
WP_032660089.1|3015951_3016911_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	1.3e-135
WP_022651719.1|3016920_3019065_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	7.8e-202
WP_003862188.1|3019037_3019448_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
WP_017382770.1|3019444_3019684_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.9	3.7e-12
>prophage 242
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3024542	3025148	4847638		Canarypox_virus(100.0%)	1	NA	NA
WP_022651715.1|3024542_3025148_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	1.6e-06
>prophage 243
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3040934	3045215	4847638		Escherichia_phage(66.67%)	4	NA	NA
WP_045346164.1|3040934_3041282_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	63.3	1.6e-32
WP_015571638.1|3041292_3041592_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	61.7	6.1e-28
WP_100154277.1|3041842_3043003_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058672812.1|3043022_3045215_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	1.6e-32
>prophage 244
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3060030	3066117	4847638		Tetraselmis_virus(50.0%)	3	NA	NA
WP_003862234.1|3060030_3060753_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	27.1	2.0e-08
WP_045346155.1|3061253_3063452_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_045346154.1|3063420_3066117_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.4	2.3e-65
>prophage 245
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3093130	3097456	4847638		Salmonella_phage(50.0%)	3	NA	NA
WP_080399865.1|3093130_3093730_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	36.5	4.4e-09
WP_045346140.1|3093947_3095303_-	McrC family protein	NA	NA	NA	NA	NA
WP_112777563.1|3095299_3097456_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	41.7	5.2e-36
>prophage 246
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3103685	3105194	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045346132.1|3103685_3105194_-	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	46.3	2.3e-51
>prophage 247
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3111382	3111658	4847638		Vibrio_phage(100.0%)	1	NA	NA
WP_045346125.1|3111382_3111658_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	62.5	1.4e-18
>prophage 248
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3114827	3125141	4847638	integrase	Staphylococcus_phage(50.0%)	6	3115068:3115080	3130785:3130797
WP_058672802.1|3114827_3116897_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.8	1.5e-72
3115068:3115080	attL	CACCATATTCAGC	NA	NA	NA	NA
WP_045346118.1|3116932_3117148_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_058672803.1|3117510_3121983_-	ATP-binding protein	NA	A0A2H4PQT3	Staphylococcus_phage	27.0	7.4e-69
WP_045346115.1|3122145_3122790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672804.1|3122791_3124039_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.0	8.5e-140
WP_003863115.1|3124658_3125141_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
3130785:3130797	attR	CACCATATTCAGC	NA	NA	NA	NA
>prophage 249
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3138126	3141687	4847638		Pseudomonas_phage(50.0%)	4	NA	NA
WP_023323614.1|3138126_3139347_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_023323613.1|3139339_3139876_-	YfiR family protein	NA	NA	NA	NA	NA
WP_003863151.1|3140029_3140404_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_006811632.1|3140616_3141687_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
>prophage 250
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3148485	3151059	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003863168.1|3148485_3151059_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 251
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3156704	3157157	4847638		Cyanophage(100.0%)	1	NA	NA
WP_006811623.1|3156704_3157157_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
>prophage 252
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3163914	3180974	4847638	tRNA	Achromobacter_phage(12.5%)	19	NA	NA
WP_003860733.1|3163914_3164334_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_022651671.1|3164538_3165624_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|3165663_3166353_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|3166668_3167052_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860725.1|3167104_3168433_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860724.1|3168565_3169303_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860722.1|3169287_3170907_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_006176728.1|3171334_3171910_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_003860719.1|3171941_3172592_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003860717.1|3172591_3173545_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003860716.1|3173541_3174018_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_112777492.1|3174203_3176009_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	2.5e-23
WP_003860712.1|3176024_3176999_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003860711.1|3177222_3177903_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860709.1|3177899_3178805_+	GTPase Era	NA	NA	NA	NA	NA
WP_003860708.1|3178822_3179530_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_023314662.1|3179605_3180337_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860706.1|3180336_3180717_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860704.1|3180713_3180974_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
>prophage 253
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3187176	3198357	4847638		Bacillus_phage(50.0%)	7	NA	NA
WP_112777493.1|3187176_3191064_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
WP_032610263.1|3191596_3193030_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	27.9	6.8e-16
WP_003860689.1|3193026_3193779_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_045345466.1|3193775_3195113_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	8.8e-10
WP_003860685.1|3195193_3195532_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_023325074.1|3195608_3196799_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003860678.1|3197103_3198357_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 254
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3205706	3212012	4847638		Faustovirus(20.0%)	8	NA	NA
WP_003860663.1|3205706_3206921_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_003860661.1|3206945_3207332_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.2e-52
WP_003860659.1|3207345_3207669_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.5e-21
WP_003860657.1|3207745_3208261_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003860654.1|3208275_3210126_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	2.0e-105
WP_003860652.1|3210127_3210463_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003860650.1|3210464_3210665_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003860647.1|3210725_3212012_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.4	4.9e-34
>prophage 255
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3225143	3230374	4847638		Escherichia_phage(66.67%)	4	NA	NA
WP_086531987.1|3225143_3227549_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.1	9.0e-138
WP_045345478.1|3227545_3228175_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.4	3.0e-61
WP_045345479.1|3228167_3228947_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003860625.1|3229942_3230374_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	7.4e-19
>prophage 256
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3239196	3245442	4847638		Acinetobacter_phage(33.33%)	6	NA	NA
WP_023314644.1|3239196_3240738_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	4.4e-162
WP_003860607.1|3240796_3241018_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003860606.1|3241014_3241365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023325046.1|3241364_3242384_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_045345481.1|3242442_3243816_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.0	1.9e-39
WP_003860601.1|3243975_3245442_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
>prophage 257
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3259672	3259843	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_017383512.1|3259672_3259843_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	75.9	3.6e-17
>prophage 258
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3266287	3274178	4847638		Prochlorococcus_phage(50.0%)	7	NA	NA
WP_006811493.1|3266287_3266929_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	2.6e-28
WP_003860563.1|3266925_3267963_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.1	7.4e-73
WP_003860562.1|3268229_3269660_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003860560.1|3269876_3270503_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003860558.1|3270585_3271875_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	4.1e-65
WP_071524135.1|3271956_3272673_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_045345534.1|3272759_3274178_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.8	2.3e-40
>prophage 259
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3283908	3284622	4847638		Cyanophage(100.0%)	1	NA	NA
WP_001171626.1|3283908_3284622_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.2	9.1e-38
>prophage 260
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3306115	3325886	4847638		Streptococcus_phage(25.0%)	21	NA	NA
WP_045345542.1|3306115_3306991_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	26.9	1.6e-12
WP_003861292.1|3307203_3307629_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_112777497.1|3307615_3308065_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_045345545.1|3308128_3308704_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_112777498.1|3308796_3309696_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_045349827.1|3309871_3310885_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045330438.1|3310884_3311718_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003861305.1|3311717_3312593_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_032659702.1|3312582_3313677_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-30
WP_045345549.1|3313744_3314656_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.0	2.7e-55
WP_003861313.1|3314661_3315498_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_003861316.1|3315542_3316052_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_112777499.1|3316092_3317820_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_000487600.1|3317865_3318123_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003861321.1|3318440_3319412_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	5.1e-76
WP_003861323.1|3319575_3320337_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_003861325.1|3320566_3321562_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_045337258.1|3321630_3323646_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	9.1e-152
WP_045337259.1|3323647_3323863_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_003861330.1|3323859_3324855_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003861331.1|3324944_3325886_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.9	1.1e-06
>prophage 261
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3340628	3341360	4847638		Clostridioides_phage(100.0%)	1	NA	NA
WP_023325009.1|3340628_3341360_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.5	2.2e-15
>prophage 262
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3345182	3348841	4847638		Morganella_phage(33.33%)	3	NA	NA
WP_086527955.1|3345182_3346103_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.7	4.9e-76
WP_003861362.1|3346371_3347751_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-15
WP_003861364.1|3347911_3348841_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.9	4.4e-141
>prophage 263
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3358010	3359096	4847638		Pandoravirus(100.0%)	1	NA	NA
WP_023314595.1|3358010_3359096_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	1.5e-87
>prophage 264
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3367451	3368588	4847638		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_023314591.1|3367451_3368588_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	3.0e-19
>prophage 265
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3375018	3376536	4847638		Mollivirus(100.0%)	1	NA	NA
WP_008502595.1|3375018_3376536_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	5.4e-88
>prophage 266
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3380771	3381545	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003861426.1|3380771_3381545_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	3.6e-08
>prophage 267
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3386229	3387249	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003861441.1|3386229_3387249_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	5.5e-20
>prophage 268
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3396385	3399606	4847638		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_003861463.1|3396385_3397045_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	26.6	1.7e-06
WP_045345833.1|3397120_3398953_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_003861468.1|3399006_3399606_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	1.5e-06
>prophage 269
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3418548	3419553	4847638		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003859465.1|3418548_3419553_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.5	7.5e-30
>prophage 270
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3441325	3453022	4847638		Pseudomonas_phage(33.33%)	7	NA	NA
WP_023324988.1|3441325_3442378_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
WP_003859419.1|3442401_3442656_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	66.7	2.6e-27
WP_023314567.1|3442655_3443786_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.0e-176
WP_003859415.1|3443894_3446180_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.3	3.8e-287
WP_003859413.1|3446528_3447257_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_058672963.1|3447403_3450040_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	9.6e-93
WP_022651523.1|3450175_3453022_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	8.9e-44
>prophage 271
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3457216	3465818	4847638		Tupanvirus(40.0%)	7	NA	NA
WP_003859401.1|3457216_3458311_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	5.2e-117
WP_023314564.1|3458425_3459481_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_045345848.1|3459553_3460612_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2K9L698	Tupanvirus	48.0	3.7e-19
WP_023324984.1|3460611_3461262_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.4	4.9e-06
WP_017383408.1|3461338_3462982_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	8.3e-10
WP_006811337.1|3463123_3464560_+	magnesium transporter	NA	NA	NA	NA	NA
WP_052686851.1|3464522_3465818_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	3.5e-80
>prophage 272
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3471120	3478638	4847638		Vibrio_phage(50.0%)	7	NA	NA
WP_017383403.1|3471120_3472128_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	1.0e-82
WP_003859376.1|3472179_3472464_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_045345853.1|3472589_3474350_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_023314557.1|3474501_3475209_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003859373.1|3475224_3476424_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.0	9.9e-21
WP_003859372.1|3476700_3477045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045345854.1|3477048_3478638_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.1e-18
>prophage 273
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3484330	3488639	4847638		Bacillus_phage(50.0%)	4	NA	NA
WP_003859364.1|3484330_3484900_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	36.8	1.8e-12
WP_003859363.1|3485315_3486029_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_045331129.1|3486062_3487049_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_045345859.1|3487172_3488639_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	28.6	1.7e-38
>prophage 274
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3496495	3497353	4847638		Catovirus(100.0%)	1	NA	NA
WP_045345861.1|3496495_3497353_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	4.8e-25
>prophage 275
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3501122	3506261	4847638		Acinetobacter_phage(50.0%)	4	NA	NA
WP_003859334.1|3501122_3503108_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.9	2.2e-09
WP_045345862.1|3503376_3504204_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_045337658.1|3504341_3505490_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_003859328.1|3505592_3506261_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 276
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3509988	3511509	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003859320.1|3509988_3511509_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 277
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3523655	3524210	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003859289.1|3523655_3524210_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	7.3e-19
>prophage 278
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3530773	3538620	4847638	tRNA	Enterobacteria_phage(60.0%)	8	NA	NA
WP_039270368.1|3530773_3531724_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.0	5.9e-08
WP_045345868.1|3531707_3532445_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022648678.1|3532419_3532533_-	protein YohO	NA	NA	NA	NA	NA
WP_003859273.1|3532602_3533343_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	82.9	4.6e-93
WP_003859271.1|3533561_3535247_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.2	5.3e-270
WP_022648676.1|3535240_3535960_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003859267.1|3536006_3536477_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.7	9.8e-65
WP_023324959.1|3536586_3538620_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.2	2.1e-55
>prophage 279
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3546515	3549461	4847638		Klosneuvirus(50.0%)	3	NA	NA
WP_015572345.1|3546515_3547892_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	1.1e-26
WP_045345872.1|3548203_3548647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176691859.1|3548831_3549461_-	YadA-like family protein	NA	S4TRP0	Salmonella_phage	32.1	7.3e-07
>prophage 280
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3560948	3565039	4847638	tRNA	Bacillus_phage(66.67%)	3	NA	NA
WP_022651495.1|3560948_3562310_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.0	4.7e-200
WP_045346758.1|3562916_3563639_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	3.2e-30
WP_006811258.1|3563635_3565039_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	2.5e-31
>prophage 281
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3580062	3589393	4847638		Catovirus(25.0%)	7	NA	NA
WP_000130320.1|3580062_3580704_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
WP_013097886.1|3580795_3581377_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	1.4e-33
WP_045346752.1|3581400_3583251_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_023314474.1|3583364_3584948_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.2e-39
WP_003862079.1|3585641_3586778_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_003862078.1|3586784_3587228_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_015572374.1|3587230_3589393_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	29.8	3.2e-17
>prophage 282
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3594639	3601351	4847638		Synechococcus_phage(25.0%)	6	NA	NA
WP_003863514.1|3594639_3595761_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.3	2.4e-133
WP_015572377.1|3595763_3596729_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	1.4e-86
WP_003863519.1|3596731_3597211_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_003863520.1|3597207_3598431_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_003863522.1|3598434_3599871_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.6	1.4e-53
WP_022648631.1|3599980_3601351_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.5e-33
>prophage 283
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3606872	3610567	4847638		Klebsiella_phage(33.33%)	3	NA	NA
WP_045346743.1|3606872_3608264_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.2	4.4e-20
WP_058671405.1|3608453_3609449_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	1.1e-09
WP_045346740.1|3609664_3610567_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	1.8e-43
>prophage 284
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3615082	3625426	4847638		Catovirus(22.22%)	10	NA	NA
WP_045346734.1|3615082_3615769_+	hypothetical protein	NA	A0A1V0SBR5	Catovirus	36.0	1.6e-10
WP_072050855.1|3615770_3616784_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	1.2e-83
WP_045346733.1|3616797_3617544_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.8	1.2e-11
WP_006811221.1|3617680_3619087_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_045346732.1|3619176_3620262_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.9	9.7e-100
WP_017693099.1|3620262_3621144_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_045346730.1|3621383_3622550_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	3.1e-112
WP_112777507.1|3622598_3623603_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	28.7	1.9e-33
WP_045346728.1|3623794_3624775_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859480.1|3624814_3625426_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
>prophage 285
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3630936	3631836	4847638		Cellulophaga_phage(100.0%)	1	NA	NA
WP_045346717.1|3630936_3631836_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 286
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3637379	3638552	4847638		Stx2-converting_phage(100.0%)	1	NA	NA
WP_139156834.1|3637379_3638552_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	85.9	1.6e-196
>prophage 287
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3647595	3655388	4847638		Leptospira_phage(50.0%)	4	NA	NA
WP_045346634.1|3647595_3650658_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.6	4.2e-23
WP_045346633.1|3650657_3651743_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003859525.1|3652215_3652647_+	universal stress protein	NA	NA	NA	NA	NA
WP_045346632.1|3652694_3655388_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.5	1.5e-69
>prophage 288
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3671210	3672512	4847638		Burkholderia_virus(100.0%)	1	NA	NA
WP_045346625.1|3671210_3672512_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	7.4e-62
>prophage 289
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3678876	3681657	4847638		Lactobacillus_phage(100.0%)	1	NA	NA
WP_112777709.1|3678876_3681657_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	29.1	1.1e-65
>prophage 290
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3686062	3694185	4847638		Burkholderia_phage(40.0%)	8	NA	NA
WP_032659241.1|3686062_3687229_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.3	3.0e-115
WP_023324909.1|3687513_3688215_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.5	1.1e-06
WP_057979973.1|3688258_3689692_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	1.2e-102
WP_023324908.1|3689672_3690164_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.0e-32
WP_003859569.1|3690135_3691050_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_169803262.1|3691225_3692140_+	DUF808 family protein	NA	NA	NA	NA	NA
WP_003859574.1|3692217_3692400_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_045346619.1|3692484_3694185_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	32.8	2.1e-16
>prophage 291
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3718849	3719602	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_003859634.1|3718849_3719602_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	2.2e-26
>prophage 292
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3727219	3727936	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_017384431.1|3727219_3727936_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
>prophage 293
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3743813	3745328	4847638		Cedratvirus(100.0%)	1	NA	NA
WP_003859688.1|3743813_3745328_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	3.1e-11
>prophage 294
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3757056	3834510	4847638	tRNA,holin,coat,portal,head,tail,capsid,protease,terminase	Enterobacteria_phage(30.0%)	90	NA	NA
WP_003859701.1|3757056_3757629_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_112777712.1|3757636_3758185_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_112777713.1|3758201_3758963_+	molecular chaperone	NA	NA	NA	NA	NA
WP_112777714.1|3758938_3761323_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_022651452.1|3761319_3762282_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_022651451.1|3762367_3764035_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_022651450.1|3764079_3765681_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_003859714.1|3765700_3766567_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003859716.1|3766563_3767613_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_000763862.1|3767630_3768020_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_045347101.1|3768030_3768675_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_045347100.1|3768823_3769972_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859723.1|3769964_3772043_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_003859725.1|3772042_3772435_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_023324881.1|3772696_3774280_+	MFS transporter	NA	NA	NA	NA	NA
WP_045347114.1|3774284_3775424_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_058672945.1|3775458_3777192_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.0	4.0e-87
WP_032609525.1|3777430_3777991_+	VOC family protein	NA	NA	NA	NA	NA
WP_023324878.1|3778069_3778813_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003859733.1|3779073_3780045_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003859735.1|3780041_3780785_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_003859737.1|3780825_3781221_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_058659449.1|3781272_3782046_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	8.6e-58
WP_112777715.1|3782024_3783338_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	86.2	1.1e-222
WP_023294930.1|3783393_3783630_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	85.9	4.8e-36
WP_157845143.1|3783637_3783787_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	5.7e-19
WP_072050225.1|3783783_3783981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777716.1|3784013_3784283_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	73.0	2.6e-30
WP_112777717.1|3784343_3784628_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	48.3	1.8e-21
WP_112777718.1|3784627_3785464_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	34.4	1.4e-26
WP_112778013.1|3785460_3786288_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	85.9	8.1e-123
WP_112778026.1|3786287_3786701_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	1.4e-54
WP_065131662.1|3786971_3787196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176691856.1|3787711_3788371_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	2.9e-75
WP_016530206.1|3788463_3788661_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_112777911.1|3788686_3789157_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	94.9	1.2e-75
WP_072044687.1|3789397_3789583_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
WP_112778014.1|3789566_3790520_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	93.7	1.4e-171
WP_059443610.1|3790516_3791011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777908.1|3791353_3792010_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	52.7	3.4e-55
WP_112778015.1|3792006_3792996_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	83.6	8.7e-164
WP_053504488.1|3793008_3793839_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	3.9e-56
WP_017145563.1|3794038_3794434_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_049019334.1|3794420_3794702_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	95.7	1.9e-44
WP_112778016.1|3794701_3795331_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	3.0e-101
WP_112777914.1|3795548_3795821_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.9	1.1e-07
WP_045347727.1|3795830_3796451_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	42.7	9.6e-44
WP_112777916.1|3796491_3796683_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.3	1.4e-17
WP_045345419.1|3796712_3796937_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	56.8	8.6e-19
WP_023303625.1|3797031_3797193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058685152.1|3797175_3797640_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_072201968.1|3798148_3798796_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	74.8	2.0e-60
WP_112777829.1|3798807_3800265_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	92.2	1.2e-273
WP_112777830.1|3800308_3800827_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.2	5.0e-46
WP_112777831.1|3800807_3801398_+	hypothetical protein	NA	S4TR53	Salmonella_phage	90.3	4.6e-104
WP_032659098.1|3801397_3801748_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	1.0e-50
WP_045332660.1|3801905_3802379_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
WP_063137109.1|3802378_3804115_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.8	0.0e+00
WP_063137110.1|3804114_3805419_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.1	1.9e-211
WP_063137111.1|3805427_3806279_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	63.5	1.1e-90
WP_063137112.1|3806288_3807497_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	74.6	2.0e-162
WP_032667407.1|3807540_3807867_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	88.0	9.5e-51
WP_063137113.1|3807875_3808214_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	2.1e-40
WP_063855693.1|3808210_3808660_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	5.8e-75
WP_022650851.1|3808656_3809004_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	82.6	1.6e-48
WP_022650852.1|3809063_3809507_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	6.0e-72
WP_022650853.1|3809515_3809899_+|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	92.9	1.7e-62
WP_032645834.1|3809907_3810186_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	93.4	9.9e-41
WP_022650855.1|3810206_3810626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777832.1|3810712_3814177_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.8	0.0e+00
WP_022648882.1|3814179_3814518_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_016240208.1|3814514_3815273_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_022650858.1|3815275_3815986_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.4	8.6e-97
WP_059509693.1|3815985_3816570_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	4.3e-54
WP_112777833.1|3816623_3820505_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	61.0	0.0e+00
WP_112777834.1|3820506_3821472_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.6	6.3e-58
WP_112778017.1|3821532_3822810_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	53.9	4.5e-120
WP_045347766.1|3823133_3823511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063137103.1|3823850_3824114_-	DinI family protein	NA	K7P797	Enterobacteria_phage	92.0	2.2e-37
WP_032609519.1|3824478_3825045_-	hydrolase	NA	NA	NA	NA	NA
WP_003859743.1|3825307_3827080_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003859745.1|3827081_3827525_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003859747.1|3827552_3828293_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859749.1|3828327_3828849_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859751.1|3828929_3829544_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859753.1|3829552_3830563_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_003859755.1|3830615_3831401_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003859757.1|3831397_3832153_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	2.3e-15
WP_032610246.1|3832230_3833175_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003859762.1|3833190_3834510_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 295
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3838425	3839901	4847638		Cyanophage(100.0%)	1	NA	NA
WP_003859771.1|3838425_3839901_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
>prophage 296
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3842960	3851146	4847638		Ralstonia_phage(85.71%)	7	NA	NA
WP_058672917.1|3842960_3845474_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	2.2e-14
WP_058659732.1|3845470_3847585_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.5	3.9e-20
WP_088567057.1|3847609_3848302_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	58.1	3.4e-05
WP_039264793.1|3848305_3849013_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.7	3.5e-05
WP_039264792.1|3849016_3849724_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.7	5.9e-05
WP_039267600.1|3849727_3850435_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	31.1	1.1e-06
WP_032659013.1|3850438_3851146_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	31.1	1.8e-06
>prophage 297
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3858455	3908579	4847638	holin,head,tail,integrase,terminase	Salmonella_phage(24.14%)	76	3857386:3857400	3870386:3870400
3857386:3857400	attL	TCGCCGGGCATCTCC	NA	NA	NA	NA
WP_112777795.1|3858455_3858686_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.0e-15
WP_023314337.1|3858823_3859195_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_112777796.1|3859196_3860066_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003859787.1|3860082_3860421_+	YebY family protein	NA	NA	NA	NA	NA
WP_023300431.1|3860743_3861829_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.6e-147
WP_023300430.1|3861797_3862070_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
WP_058672881.1|3862258_3862915_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	49.1	8.0e-57
WP_058672880.1|3862946_3863165_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.6	2.3e-16
WP_058672879.1|3863231_3863768_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.0	9.2e-35
WP_047716558.1|3863764_3863965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080399866.1|3863961_3864234_-	DUF5405 family protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
WP_032652770.1|3864230_3864449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672877.1|3864445_3864997_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	5.2e-57
WP_165592604.1|3864993_3865161_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	94.5	5.6e-23
WP_058672876.1|3865157_3865586_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.7	2.2e-71
WP_058672875.1|3865582_3866206_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	49.5	7.2e-47
WP_162184608.1|3866202_3866511_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	33.3	3.8e-09
WP_058672874.1|3866717_3867002_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	1.9e-47
WP_058672873.1|3867136_3867451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023622534.1|3867455_3867659_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.6	4.4e-22
WP_058672872.1|3867655_3867820_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	67.9	3.6e-14
WP_058672871.1|3867816_3868086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269180.1|3868249_3868687_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
WP_045344955.1|3869478_3870231_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.0	7.0e-73
WP_000102594.1|3870272_3870506_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
3870386:3870400	attR	TCGCCGGGCATCTCC	NA	NA	NA	NA
WP_045340889.1|3870523_3871066_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	78.9	4.6e-74
WP_015571544.1|3871155_3871302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777896.1|3871294_3872191_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	60.1	2.6e-98
WP_176691860.1|3872195_3873608_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	62.6	7.5e-169
WP_058688299.1|3873607_3873952_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	94.7	1.9e-54
WP_058672867.1|3874816_3875098_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	79.3	2.7e-30
WP_058672866.1|3875101_3875764_+	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	47.3	9.4e-21
WP_058672865.1|3875763_3876009_+	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	51.4	7.0e-14
WP_058672864.1|3876114_3876345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058672863.1|3876518_3876968_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	45.1	4.7e-32
WP_058672862.1|3876960_3877131_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	78.6	7.2e-18
WP_045142307.1|3877123_3877762_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	75.5	8.0e-86
WP_058672860.1|3877871_3878561_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	1.1e-56
WP_072204427.1|3878633_3878921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048961198.1|3879234_3879606_+|holin	phage holin family protein	holin	A0A2D1GNJ3	Pseudomonas_phage	32.4	1.3e-06
WP_058673080.1|3879589_3880234_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	43.3	1.5e-36
WP_058673081.1|3880221_3880698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058673082.1|3881151_3881670_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.8	2.1e-92
WP_063137118.1|3881999_3882218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058673028.1|3882283_3882508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058673027.1|3882530_3883103_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.6	2.2e-71
WP_058673026.1|3883089_3884568_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.6	1.5e-257
WP_058673025.1|3884583_3885933_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	7.8e-232
WP_058673024.1|3885892_3886819_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	4.0e-163
WP_112778018.1|3886821_3888090_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.9	2.2e-220
WP_020838514.1|3888102_3888564_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
WP_022651010.1|3888576_3889674_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.4	8.7e-181
WP_020838516.1|3889684_3889969_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	75.3	1.7e-32
WP_112777871.1|3890031_3890433_+	hypothetical protein	NA	I6S619	Salmonella_phage	75.9	2.7e-55
WP_020838521.1|3890432_3890612_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
WP_112777870.1|3890604_3890967_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	92.5	2.7e-62
WP_023205067.1|3890956_3891448_-	HNH endonuclease	NA	J7HXG5	Pseudomonas_phage	57.1	1.6e-46
WP_063153212.1|3891569_3891965_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	96.2	1.5e-66
WP_047720618.1|3891961_3892348_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	94.5	2.1e-65
WP_047720620.1|3892365_3893100_+	immunoglobulin domain-containing protein	NA	H6WRU1	Salmonella_phage	85.6	2.1e-114
WP_063216497.1|3893137_3893791_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.2	7.9e-113
WP_000735926.1|3894404_3894680_+	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	72.5	1.8e-26
WP_042889550.1|3894797_3895202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777869.1|3895266_3898671_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.4	5.6e-186
WP_047653432.1|3898699_3898927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672788.1|3899002_3899350_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.0	5.9e-59
WP_158606049.1|3899371_3899527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651024.1|3899505_3899703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296451.1|3899868_3900573_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	99.1	1.9e-136
WP_048982705.1|3900572_3901292_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	82.7	6.0e-122
WP_048982701.1|3901234_3901768_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.6	4.0e-54
WP_112777868.1|3901777_3905605_+	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	60.5	0.0e+00
WP_063251055.1|3905606_3906572_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	3.3e-59
WP_112778019.1|3906632_3907934_+|tail	phage tail protein	tail	G8C7R8	Escherichia_phage	56.2	5.4e-121
WP_154232874.1|3908028_3908268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672784.1|3908255_3908579_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	2.2e-23
>prophage 298
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3917451	3919446	4847638		Bacillus_phage(50.0%)	2	NA	NA
WP_003857557.1|3917451_3918750_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	3.6e-16
WP_003857554.1|3919074_3919446_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	38.9	2.5e-15
>prophage 299
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3931086	3931602	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_003857532.1|3931086_3931602_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	56.9	3.2e-24
>prophage 300
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3937963	3946769	4847638		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_045346502.1|3937963_3939625_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.3	1.4e-09
WP_045142525.1|3939770_3940637_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_003857516.1|3940683_3940884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003857514.1|3941209_3941629_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	6.7e-33
WP_032609077.1|3941976_3944406_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_045346503.1|3944492_3946769_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2P1EIE5	Megavirus	26.6	5.0e-05
>prophage 301
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3951249	3952515	4847638		Salmonella_phage(100.0%)	1	NA	NA
WP_045346507.1|3951249_3952515_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.5	5.3e-206
>prophage 302
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3966358	3967507	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_003857446.1|3966358_3967507_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	32.6	8.3e-25
>prophage 303
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3971835	3975242	4847638		Escherichia_phage(100.0%)	5	NA	NA
WP_045351135.1|3971835_3972513_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	63.1	4.2e-77
WP_003857437.1|3972688_3973000_-	YebG family protein	NA	NA	NA	NA	NA
WP_015570619.1|3973109_3973724_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	1.9e-28
WP_032609102.1|3973768_3974623_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	34.6	7.6e-23
WP_017384545.1|3974624_3975242_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
>prophage 304
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3982840	4001765	4847638		Escherichia_phage(10.0%)	21	NA	NA
WP_112777744.1|3982840_3984310_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.5	7.2e-122
WP_003857424.1|3984440_3984746_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003857421.1|3984848_3985703_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
WP_003857419.1|3985895_3986606_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_003857416.1|3986623_3987184_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_003857414.1|3987183_3987522_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003857412.1|3987672_3987999_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	7.1e-22
WP_003857410.1|3988110_3989325_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	3.3e-48
WP_003857408.1|3989339_3990359_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045346320.1|3990432_3991812_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_112777743.1|3992035_3993499_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	2.2e-46
WP_003857405.1|3993543_3993747_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_045333004.1|3994034_3994466_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	34.5	4.5e-16
WP_003857403.1|3994501_3995188_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045346319.1|3995278_3996025_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_045346318.1|3996168_3998202_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.1	1.3e-20
WP_032645704.1|3998328_3999120_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_039268873.1|3999229_4000033_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857394.1|4000141_4000633_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_003857392.1|4000692_4001376_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	1.4e-80
WP_003857390.1|4001525_4001765_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	5.0e-33
>prophage 305
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4009458	4010448	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003857375.1|4009458_4010448_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	44.7	1.6e-69
>prophage 306
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4035400	4037377	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
WP_112777739.1|4035400_4037377_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	2.4e-157
>prophage 307
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4041771	4042992	4847638		Orpheovirus(100.0%)	1	NA	NA
WP_003857310.1|4041771_4042992_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.6	4.1e-38
>prophage 308
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4049198	4054687	4847638		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_045336212.1|4049198_4049885_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.1	8.5e-09
WP_023324612.1|4049975_4050581_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_112777738.1|4050784_4054687_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	5.0e-53
>prophage 309
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4061640	4064036	4847638		Escherichia_phage(100.0%)	3	NA	NA
WP_003857288.1|4061640_4062171_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.0	1.0e-17
WP_045346296.1|4062211_4063279_-	oxidoreductase	NA	NA	NA	NA	NA
WP_045346295.1|4063292_4064036_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	8.6e-15
>prophage 310
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4084460	4086626	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_045336224.1|4084460_4086626_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.4	1.0e-31
>prophage 311
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4094431	4095550	4847638		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_112778020.1|4094431_4095550_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.1	4.7e-33
>prophage 312
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4099979	4101473	4847638		Pandoravirus(100.0%)	1	NA	NA
WP_112777785.1|4099979_4101473_+	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	30.6	2.2e-33
>prophage 313
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4109581	4110811	4847638		Brevibacillus_phage(100.0%)	1	NA	NA
WP_058673127.1|4109581_4110811_-	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	2.1e-05
>prophage 314
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4117150	4122841	4847638		Phage_TP(50.0%)	6	NA	NA
WP_045346277.1|4117150_4119115_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.5	2.7e-23
WP_015570548.1|4119111_4119345_-	DUF2554 family protein	NA	NA	NA	NA	NA
WP_003857209.1|4119588_4119951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045346322.1|4120098_4121097_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_003857206.1|4121170_4121581_+	rhodanese	NA	NA	NA	NA	NA
WP_045346275.1|4121737_4122841_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.1	2.4e-101
>prophage 315
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4126982	4128488	4847638		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_015570541.1|4126982_4127780_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	1.2e-11
WP_032609186.1|4127789_4128488_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	5.2e-14
>prophage 316
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4131821	4132202	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_001303241.1|4131821_4132202_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	33.3	2.1e-09
>prophage 317
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4142099	4143065	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_032609205.1|4142099_4143065_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.9	8.9e-12
>prophage 318
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4149312	4151345	4847638		Bacillus_phage(100.0%)	2	NA	NA
WP_022651194.1|4149312_4150053_+	response regulator	NA	W8CYM9	Bacillus_phage	35.5	2.5e-30
WP_045346258.1|4150049_4151345_+	ATP-binding protein	NA	W8CYF6	Bacillus_phage	24.2	3.0e-15
>prophage 319
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4188238	4189123	4847638		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_022651207.1|4188238_4189123_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.5	9.7e-82
>prophage 320
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4197326	4201424	4847638		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_045346213.1|4197326_4198877_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.8	3.1e-06
WP_045349982.1|4198972_4199989_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_045346215.1|4200017_4201424_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	23.2	4.4e-12
>prophage 321
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4213499	4216151	4847638		Planktothrix_phage(66.67%)	3	NA	NA
WP_022651223.1|4213499_4214486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.2e-17
WP_003857074.1|4214478_4215405_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.1e-14
WP_003857073.1|4215401_4216151_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	3.2e-17
>prophage 322
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4222989	4225916	4847638		Tupanvirus(100.0%)	2	NA	NA
WP_112777705.1|4222989_4224699_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	9.4e-41
WP_045346225.1|4224905_4225916_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	1.7e-26
>prophage 323
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4236370	4238980	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
WP_023314189.1|4236370_4237444_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.4	6.6e-149
WP_112777703.1|4237489_4238980_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	31.3	5.7e-34
>prophage 324
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4245073	4246618	4847638		Escherichia_phage(100.0%)	1	NA	NA
WP_003857031.1|4245073_4246618_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 325
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4249718	4257773	4847638		Acinetobacter_phage(25.0%)	10	NA	NA
WP_072050846.1|4249718_4250081_+	CHAP domain-containing protein	NA	I3WW63	Acinetobacter_phage	30.0	3.0e-05
WP_058673144.1|4250080_4250506_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_045346233.1|4250573_4252676_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.4e-62
WP_045346235.1|4252837_4253137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023324686.1|4253129_4253771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023314194.1|4253862_4254864_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.2	3.3e-54
WP_032609265.1|4255050_4255281_-	tautomerase PptA	NA	NA	NA	NA	NA
WP_045346236.1|4255318_4255936_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003857009.1|4256102_4256990_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003857007.1|4256999_4257773_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.4e-20
>prophage 326
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4263720	4264260	4847638		Leuconostoc_phage(100.0%)	1	NA	NA
WP_003856993.1|4263720_4264260_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	34.7	3.4e-13
>prophage 327
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4268958	4271076	4847638		Salmonella_phage(100.0%)	1	NA	NA
WP_023314203.1|4268958_4271076_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.4	6.7e-137
>prophage 328
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4297030	4338785	4847638	integrase,tRNA,transposase,plate	Escherichia_phage(20.0%)	37	4295781:4295797	4348660:4348676
4295781:4295797	attL	TGACGGTCGATCAGCAC	NA	NA	NA	NA
WP_112777697.1|4297030_4298158_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.6	3.0e-120
WP_022651250.1|4298192_4298615_-	GFA family protein	NA	NA	NA	NA	NA
WP_003856931.1|4298618_4298816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071785691.1|4299236_4299437_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_045346248.1|4299764_4300436_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	4.2e-77
WP_023314222.1|4300524_4301409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023314223.1|4301511_4302606_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_045346249.1|4302643_4303525_+	arginase family protein	NA	NA	NA	NA	NA
WP_112778021.1|4303868_4304925_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	74.7	4.8e-128
WP_003856923.1|4305442_4306378_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_045337431.1|4306421_4307795_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	3.6e-51
WP_163270243.1|4307852_4308005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023314230.1|4308279_4309263_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080339342.1|4309353_4310484_-	chemoreceptor protein	NA	NA	NA	NA	NA
WP_058659765.1|4310800_4311289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058673151.1|4311317_4312634_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_045347387.1|4312657_4313113_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_045347389.1|4313112_4313658_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_023324760.1|4313635_4314721_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023324761.1|4314684_4316439_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_045347392.1|4316480_4318082_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_112777828.1|4318081_4321480_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_045347397.1|4321485_4322916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032648447.1|4322915_4323179_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045347399.1|4323267_4323999_-	DUF3274 domain-containing protein	NA	NA	NA	NA	NA
WP_058673152.1|4324560_4324947_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	41.2	1.3e-09
WP_127913678.1|4324971_4325202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045347410.1|4325191_4326241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072049647.1|4326242_4326866_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_072026010.1|4326804_4327065_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045347413.1|4327065_4328997_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.8	1.3e-59
WP_045347416.1|4329250_4331743_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.1	8.7e-19
WP_112778022.1|4331739_4334385_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.9e-96
WP_045347680.1|4334558_4335050_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_063251064.1|4335055_4336762_-	OmpA family protein	NA	NA	NA	NA	NA
WP_045347663.1|4336758_4337448_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032628287.1|4337444_4338785_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
4348660:4348676	attR	GTGCTGATCGACCGTCA	NA	NA	NA	NA
>prophage 329
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4351879	4352962	4847638		Indivirus(100.0%)	1	NA	NA
WP_032609322.1|4351879_4352962_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-13
>prophage 330
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4370040	4379524	4847638		Bacillus_virus(50.0%)	8	NA	NA
WP_003856840.1|4370040_4371033_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	2.3e-07
WP_003856838.1|4371034_4371841_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	26.8	1.8e-13
WP_003856836.1|4371837_4372428_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112777633.1|4372560_4372962_+	RidA family protein	NA	NA	NA	NA	NA
WP_032609348.1|4373839_4375180_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.0	1.2e-17
WP_003856831.1|4375573_4376362_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_045346337.1|4376514_4377501_+	oxidoreductase	NA	NA	NA	NA	NA
WP_045346338.1|4377589_4379524_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.3	5.5e-05
>prophage 331
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4388180	4388771	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003856813.1|4388180_4388771_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.3e-42
>prophage 332
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4393695	4398025	4847638	protease	Tupanvirus(50.0%)	3	NA	NA
WP_003856806.1|4393695_4396293_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.0	4.6e-87
WP_003856804.1|4396691_4396943_+	YciN family protein	NA	NA	NA	NA	NA
WP_022651351.1|4396978_4398025_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
>prophage 333
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4403974	4406932	4847638		Acinetobacter_phage(100.0%)	2	NA	NA
WP_003856782.1|4403974_4405570_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.0	1.8e-49
WP_003856781.1|4405573_4406932_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
>prophage 334
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4421206	4424103	4847638		Lactobacillus_phage(33.33%)	3	NA	NA
WP_003856745.1|4421206_4422043_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	39.8	6.1e-09
WP_003856743.1|4422088_4423093_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	8.9e-15
WP_003856742.1|4423089_4424103_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.8e-15
>prophage 335
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4432318	4442516	4847638		Citrobacter_phage(25.0%)	10	NA	NA
WP_003856726.1|4432318_4432933_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.7	1.7e-56
WP_003856724.1|4433483_4433897_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_003856723.1|4434099_4435005_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	2.6e-58
WP_003856721.1|4435204_4436218_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003856719.1|4436307_4437210_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_045333133.1|4437323_4437788_+	YchJ family protein	NA	NA	NA	NA	NA
WP_003856715.1|4437829_4438672_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	49.3	2.7e-12
WP_003856712.1|4439596_4440274_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_022651366.1|4440273_4440984_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_017384243.1|4440980_4442516_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	1.7e-20
>prophage 336
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4458851	4459640	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_045336446.1|4458851_4459640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	3.5e-30
>prophage 337
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4463711	4472544	4847638		uncultured_Caudovirales_phage(25.0%)	10	NA	NA
WP_045346350.1|4463711_4465496_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	3.5e-14
WP_015570352.1|4465690_4465930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777636.1|4465960_4466656_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003856674.1|4466832_4467063_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	45.3	1.0e-06
WP_003856672.1|4467331_4468432_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_003856671.1|4468538_4469393_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.5	4.4e-47
WP_003856670.1|4469429_4470239_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_023314273.1|4470242_4470635_-	SirB family protein	NA	NA	NA	NA	NA
WP_045346353.1|4470631_4471462_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003856667.1|4471461_4472544_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 338
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4475646	4478398	4847638		Tupanvirus(50.0%)	2	NA	NA
WP_003856663.1|4475646_4476594_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_032658872.1|4476718_4478398_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	6.7e-23
>prophage 339
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4488371	4489124	4847638		Streptomyces_phage(100.0%)	1	NA	NA
WP_052686896.1|4488371_4489124_-	Appr-1-p processing protein	NA	A0A2L1IVW3	Streptomyces_phage	34.6	3.8e-18
>prophage 340
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4495693	4506691	4847638		Serratia_phage(50.0%)	7	NA	NA
WP_112777638.1|4495693_4500118_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	50.8	9.6e-29
WP_023324829.1|4500121_4500562_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_022651393.1|4500770_4501289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672750.1|4501278_4503861_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	9.6e-45
WP_058672751.1|4504020_4505121_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	42.8	7.9e-57
WP_022651396.1|4505159_4505540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045337769.1|4505620_4506691_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	42.6	1.8e-58
>prophage 341
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4510117	4518952	4847638		Ralstonia_phage(33.33%)	6	NA	NA
WP_058672753.1|4510117_4512076_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.2	1.6e-44
WP_058672754.1|4512159_4512615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032661818.1|4512628_4513375_-	accessory protein	NA	NA	NA	NA	NA
WP_003859977.1|4513386_4514853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651404.1|4514878_4516312_-	serine/threonine protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.0	6.1e-09
WP_045347053.1|4516336_4518952_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.3	3.2e-80
>prophage 342
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4527367	4528357	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_006810951.1|4527367_4528357_-	hypothetical protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	32.6	3.2e-41
>prophage 343
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4564997	4572240	4847638	tRNA	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003859933.1|4564997_4566683_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_047653749.1|4566886_4567468_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_032658967.1|4567505_4568201_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003859928.1|4568267_4570178_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	8.0e-89
WP_003859925.1|4570661_4570844_-	YoaH family protein	NA	NA	NA	NA	NA
WP_003859923.1|4570905_4572240_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	41.9	6.4e-45
>prophage 344
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4576098	4577658	4847638		Moraxella_phage(100.0%)	1	NA	NA
WP_003859916.1|4576098_4577658_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	6.0e-42
>prophage 345
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4585090	4585300	4847638		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4585090_4585300_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 346
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4590564	4592613	4847638		Moraxella_phage(100.0%)	1	NA	NA
WP_003859896.1|4590564_4592613_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
>prophage 347
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4599831	4648875	4847638	integrase,head,terminase,holin	Salmonella_phage(28.33%)	73	4615145:4615159	4653300:4653314
WP_045347139.1|4599831_4600476_-	protein-serine/threonine phosphatase	NA	S4TNS0	Salmonella_phage	45.0	6.2e-54
WP_003859879.1|4600643_4601624_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_058672762.1|4602053_4603322_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	4.4e-229
WP_080399863.1|4603321_4603627_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.6	5.6e-13
WP_045340345.1|4603738_4604101_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
WP_058672764.1|4604097_4605015_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	1.3e-158
WP_058672765.1|4605014_4606622_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	31.4	1.7e-60
WP_112777642.1|4608656_4611134_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	93.1	0.0e+00
WP_032677284.1|4611120_4611486_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
WP_015571561.1|4611499_4611970_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_058672993.1|4611969_4612467_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	2.1e-89
WP_058672994.1|4612466_4614791_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	52.2	1.7e-146
WP_016245416.1|4614848_4615223_-	membrane lipoprotein lipid attachment site-containing protein	NA	A0A0M4QWT0	Salmonella_phage	53.4	5.1e-24
4615145:4615159	attL	GCGAAATTGCCTTTT	NA	NA	NA	NA
WP_058672995.1|4615295_4616039_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.6	7.7e-64
WP_047724454.1|4616089_4616845_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.4	9.9e-59
WP_032619446.1|4616903_4617287_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	4.9e-38
WP_058672996.1|4617283_4617652_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	1.8e-45
WP_045324574.1|4617694_4617883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045324576.1|4617896_4618247_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	8.9e-39
WP_033486569.1|4618246_4618420_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	49.1	6.0e-12
WP_058672997.1|4618419_4618821_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	79.7	1.4e-56
WP_058672998.1|4618883_4619177_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	89.7	1.9e-42
WP_058672999.1|4619186_4620263_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	88.0	1.6e-179
WP_058673000.1|4620280_4620730_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	85.2	2.7e-64
WP_112777643.1|4620742_4622008_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.4	1.7e-220
WP_058673024.1|4622010_4622937_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	4.0e-163
WP_058673025.1|4622896_4624246_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	7.8e-232
WP_058673026.1|4624261_4625740_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.6	1.5e-257
WP_058673027.1|4625726_4626299_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.6	2.2e-71
WP_058673028.1|4626321_4626546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063137118.1|4626611_4626830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112778023.1|4627159_4627678_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	97.7	2.3e-91
WP_112777772.1|4628101_4628488_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	38.1	2.1e-12
WP_025760164.1|4628484_4628925_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	9.5e-62
WP_001514184.1|4628928_4629204_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|4629200_4629602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332618.1|4629875_4630376_-	antiterminator	NA	G8C7V7	Escherichia_phage	95.7	5.5e-90
WP_058647991.1|4630488_4631133_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	69.6	2.1e-73
WP_058647992.1|4631126_4631594_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	50.7	2.1e-35
WP_112777771.1|4631590_4631761_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	86.8	2.5e-18
WP_112777770.1|4631753_4632203_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	1.9e-33
WP_176691857.1|4632389_4632545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176691858.1|4632557_4633154_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	44.7	3.0e-26
WP_112777769.1|4633157_4633439_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	73.9	5.2e-29
WP_112777768.1|4633441_4633801_-	ead/Ea22-like family protein	NA	K7PLZ3	Enterobacterial_phage	46.3	6.0e-06
WP_112777766.1|4633991_4634180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777765.1|4634176_4634482_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	53.1	1.7e-14
WP_112777764.1|4634478_4634727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_176691861.1|4634723_4635023_-	protein ren	NA	M1FPD5	Enterobacteria_phage	48.4	1.3e-14
WP_112777762.1|4635027_4636401_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.1	8.4e-165
WP_112777761.1|4636397_4637483_-	replication protein	NA	E5AGE9	Erwinia_phage	45.4	1.5e-84
WP_015571544.1|4637475_4637622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777760.1|4637711_4638278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676295.1|4638308_4638524_-	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
WP_052254344.1|4638627_4639269_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	76.8	5.2e-93
WP_045286845.1|4639461_4640319_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	7.6e-39
WP_112777759.1|4640456_4640654_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	92.2	4.6e-24
WP_127913676.1|4640920_4641298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059453074.1|4641587_4641785_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_112777758.1|4641856_4642141_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	3.2e-47
WP_032608701.1|4642159_4643005_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
WP_024198026.1|4643001_4643682_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.6	6.9e-128
WP_112777757.1|4643678_4644107_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
WP_163374164.1|4644103_4644271_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	98.1	2.5e-23
WP_112777756.1|4644267_4644927_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	2.7e-121
WP_112777755.1|4644923_4645142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042889503.1|4645138_4645435_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.7	2.4e-29
WP_112777754.1|4645431_4645623_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	4.6e-13
WP_112777753.1|4645714_4646224_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	48.8	6.5e-38
WP_047355337.1|4646440_4646932_+	HNH endonuclease	NA	Q7Y5G7	Xanthomonas_virus	49.0	4.9e-35
WP_094058358.1|4646974_4647205_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	98.7	8.8e-35
WP_022650951.1|4647313_4647562_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_058672823.1|4647594_4648875_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	50.9	1.1e-123
4653300:4653314	attR	AAAAGGCAATTTCGC	NA	NA	NA	NA
>prophage 348
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4665182	4666457	4847638	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_017384594.1|4665182_4666457_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.0	5.5e-86
>prophage 349
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4669754	4671119	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_058672819.1|4669754_4671119_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	9.0e-18
>prophage 350
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4674893	4675412	4847638		Salmonella_phage(100.0%)	1	NA	NA
WP_023313963.1|4674893_4675412_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.6	3.7e-49
>prophage 351
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4682271	4693432	4847638		Bacillus_phage(16.67%)	11	NA	NA
WP_023313959.1|4682271_4683030_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	9.4e-17
WP_003857629.1|4683152_4683734_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	6.2e-45
WP_045346483.1|4683771_4684938_-	MFS transporter	NA	NA	NA	NA	NA
WP_003857632.1|4685099_4685189_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_003857634.1|4685486_4686512_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	1.3e-32
WP_003857638.1|4686529_4687441_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045336562.1|4687553_4688753_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003857641.1|4689051_4690200_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.8	3.6e-84
WP_003857643.1|4690231_4690873_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	3.9e-24
WP_045346480.1|4691098_4692472_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_003857647.1|4692961_4693432_-	Hsp20 family protein	NA	A0A1D7SNF0	Cyanophage	31.8	5.8e-09
>prophage 352
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4704815	4709025	4847638		Burkholderia_phage(50.0%)	3	NA	NA
WP_072050849.1|4704815_4705082_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	37.8	1.3e-05
WP_058672817.1|4706237_4707011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672816.1|4707003_4709025_-	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	30.6	2.1e-07
>prophage 353
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4712875	4715506	4847638		Cronobacter_phage(100.0%)	1	NA	NA
WP_112778024.1|4712875_4715506_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.9e-96
>prophage 354
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4728787	4729603	4847638		Planktothrix_phage(100.0%)	1	NA	NA
WP_023324533.1|4728787_4729603_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	2.8e-35
>prophage 355
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4732814	4735608	4847638		Staphylococcus_phage(50.0%)	2	NA	NA
WP_058673110.1|4732814_4733837_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.7e-14
WP_045346468.1|4734237_4735608_+	cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	36.8	5.4e-47
>prophage 356
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4740717	4747952	4847638		environmental_halophage(25.0%)	8	NA	NA
WP_045346417.1|4740717_4741938_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.9	1.3e-92
WP_045346418.1|4741934_4743206_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003857736.1|4743180_4743927_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.3	3.3e-06
WP_003857739.1|4743936_4745427_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003857741.1|4745435_4745804_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	42.2	2.9e-16
WP_045346421.1|4746300_4746660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609046.1|4746661_4747114_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_050871090.1|4747223_4747952_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.8	2.1e-50
>prophage 357
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4770136	4774881	4847638		Hokovirus(50.0%)	3	NA	NA
WP_023305974.1|4770136_4772515_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_017384644.1|4772850_4773684_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_045346435.1|4773834_4774881_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	6.1e-83
>prophage 358
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4780201	4793621	4847638	tRNA	Tupanvirus(25.0%)	15	NA	NA
WP_045346437.1|4780201_4780981_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	1.4e-12
WP_003857792.1|4780977_4782420_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	5.7e-55
WP_003857794.1|4782481_4783195_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015570730.1|4783488_4783953_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.7	2.3e-13
WP_022650906.1|4784025_4784781_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	26.2	1.7e-10
WP_045346439.1|4784780_4785332_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_022650904.1|4785365_4786346_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_003857805.1|4786449_4786749_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_058673106.1|4786753_4789141_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003857809.1|4789156_4790140_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	9.9e-35
WP_001386830.1|4790277_4790322_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4790444_4790801_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4790851_4791049_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_023616141.1|4791146_4791689_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.8e-15
WP_003857814.1|4791692_4793621_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	3.9e-128
>prophage 359
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4799736	4805444	4847638		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_003857827.1|4799736_4800498_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	1.9e-17
WP_112777726.1|4800593_4801184_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_015570743.1|4801311_4802703_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_071785203.1|4802751_4803006_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_112777725.1|4803194_4805444_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.0	8.4e-138
>prophage 360
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4811638	4812466	4847638		Bacillus_virus(100.0%)	1	NA	NA
WP_112777723.1|4811638_4812466_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	1.9e-71
>prophage 361
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4819796	4821017	4847638		Klosneuvirus(100.0%)	1	NA	NA
WP_022650886.1|4819796_4821017_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.5	8.8e-25
>prophage 362
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4825624	4826245	4847638		Bacillus_phage(100.0%)	1	NA	NA
WP_022650881.1|4825624_4826245_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.4	3.8e-08
>prophage 363
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4831166	4833074	4847638		Streptococcus_phage(100.0%)	1	NA	NA
WP_058673103.1|4831166_4833074_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	5.2e-40
>prophage 364
NZ_CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4837902	4840020	4847638		Tupanvirus(50.0%)	2	NA	NA
WP_045346459.1|4837902_4838544_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.6	3.6e-17
WP_058673102.1|4838763_4840020_+	glycoside hydrolase family 18 protein	NA	W5VKF1	Buzura_suppressaria_nuclear_polyhedrosis_virus	27.6	1.5e-22
>prophage 1
NZ_CP030077	Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence	170955	30574	57241	170955	integrase,transposase	Salmonella_phage(27.27%)	26	40376:40390	52279:52293
WP_001067855.1|30574_31279_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_112777917.1|32821_33691_-	23S ribosomal RNA methyltransferase Erm	NA	NA	NA	NA	NA
WP_157159259.1|34364_34559_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_112778027.1|34621_34867_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	41.0	5.3e-06
WP_000412211.1|35836_36496_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|36696_37074_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|37384_38389_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|38467_41434_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
40376:40390	attL	GGCCTCGATGGCGGC	NA	NA	NA	NA
WP_000147567.1|41436_41997_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|42122_42473_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|42675_43689_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|43846_44320_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|44450_45239_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|45444_45792_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|45785_46625_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|47029_48571_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_112777913.1|48748_48928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043000434.1|49005_49656_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_043000433.1|49821_50250_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	47.9	1.6e-26
WP_109740312.1|50279_51140_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044263728.1|51331_52216_+	SED family class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	70.6	7.4e-106
WP_043000430.1|52528_53158_-	transcriptional regulator	NA	NA	NA	NA	NA
52279:52293	attR	GCCGCCATCGAGGCC	NA	NA	NA	NA
WP_112778028.1|53210_54224_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000679427.1|54114_54462_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|54455_55295_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|55699_57241_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP030078	Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence	108358	0	107614	108358	tail,terminase,integrase	Salmonella_phage(94.55%)	119	1067:1089	108237:108259
WP_016051671.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
1067:1089	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
WP_004110030.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	100.0	8.1e-35
WP_004110033.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
WP_004110036.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_058687805.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
WP_004110040.1|2741_3152_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_004110049.1|3668_4499_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_000589750.1|4502_4703_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_000920226.1|5873_6140_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_058687803.1|6139_7084_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	8.8e-182
WP_004110098.1|7144_8173_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_004110100.1|8292_8724_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	1.2e-72
WP_004110104.1|9268_9832_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	9.9e-64
WP_002213143.1|9861_10305_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
WP_100229806.1|10301_13820_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
WP_022649894.1|14000_15236_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
WP_100229807.1|15332_17723_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	92.7	0.0e+00
WP_004110118.1|17832_18045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687799.1|18308_18695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687798.1|18686_19793_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
WP_100229808.1|19964_20381_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_100229809.1|20371_20896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100229810.1|20992_21238_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	2.9e-12
WP_032655934.1|21237_21603_-	phage family protein	NA	K7PH35	Enterobacteria_phage	65.6	1.5e-36
WP_058687797.1|21618_21822_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
WP_058687796.1|21832_22606_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	1.4e-89
WP_127345900.1|22849_24046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100229811.1|25051_25357_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	1.2e-47
WP_004110177.1|25505_25718_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	100.0	2.6e-33
WP_023180937.1|25877_27200_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	2.8e-258
WP_072105575.1|27234_27711_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	98.1	6.4e-80
WP_100229813.1|27792_28587_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	76.5	2.1e-112
WP_058687793.1|28773_30027_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_169803265.1|30018_31134_-	DNA primase	NA	J9Q720	Salmonella_phage	94.1	1.2e-209
WP_006812582.1|31292_32633_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_100229815.1|32693_33419_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	5.4e-139
WP_080395882.1|33683_34481_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.4	7.3e-12
WP_160859104.1|34521_34875_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_023315962.1|34880_35546_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
WP_006812497.1|35902_36172_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_006812498.1|36175_36700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023316023.1|36726_36933_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.0	1.1e-23
WP_042863552.1|36883_37135_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	88.0	9.3e-30
WP_006812500.1|37136_37829_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_042863551.1|37842_38166_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
WP_042863549.1|39386_39818_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	53.8	1.5e-16
WP_045339244.1|48690_49281_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.8	9.0e-100
WP_045339242.1|49268_50066_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	95.1	3.5e-155
WP_016051624.1|50058_50757_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_045339239.1|50846_51182_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	99.1	5.2e-60
WP_100229795.1|51223_55807_-	tape measure protein	NA	J9Q712	Salmonella_phage	91.4	0.0e+00
WP_000952684.1|55814_56039_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|56164_56482_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_006812510.1|56541_57288_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
WP_000469441.1|57362_57746_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_000523626.1|57747_58221_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_001027662.1|58211_58556_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_045339227.1|58653_59487_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
WP_042863546.1|59486_59921_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	8.1e-74
WP_042863545.1|59964_60888_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	99.7	9.6e-157
WP_045339225.1|60962_61838_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_100167782.1|61864_62758_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.6	3.3e-138
WP_042863542.1|62780_64355_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	98.9	3.5e-300
WP_002211787.1|64388_65645_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_006812517.1|65647_66289_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_000176291.1|66484_66751_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|66760_67651_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_001113021.1|67656_67911_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_016051719.1|67903_68542_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_042863541.1|68538_69207_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_032634983.1|69206_69905_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
WP_100229796.1|69969_71529_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.2	2.8e-294
WP_039264874.1|71531_71810_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	1.3e-40
WP_127345898.1|71872_72400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127345899.1|72443_73232_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	39.0	1.6e-06
WP_048228561.1|73358_73871_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	3.1e-56
WP_100229798.1|74188_74839_+	hypothetical protein	NA	J9Q754	Salmonella_phage	98.6	3.5e-113
WP_046622227.1|74889_75093_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
WP_023316004.1|75734_76217_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	7.1e-87
WP_058652473.1|76422_76704_-	hypothetical protein	NA	J9Q753	Salmonella_phage	97.8	6.5e-48
WP_045339203.1|76830_77226_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	1.2e-42
WP_058687815.1|77354_77666_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	96.1	7.9e-47
WP_172688704.1|77806_78022_-	hypothetical protein	NA	J9Q804	Salmonella_phage	95.8	5.9e-33
WP_042863534.1|78029_78251_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	1.4e-34
WP_063162178.1|80172_80490_-	hypothetical protein	NA	J9Q750	Salmonella_phage	83.8	3.9e-49
WP_042863533.1|80489_80726_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	97.4	1.6e-39
WP_042863532.1|80811_81078_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.1e-31
WP_006812537.1|81264_81468_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_042863531.1|81523_82222_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	91.8	2.0e-114
WP_042863530.1|82260_82812_-	hypothetical protein	NA	J9Q748	Salmonella_phage	92.3	2.3e-97
WP_042863529.1|82808_83450_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	99.1	1.4e-114
WP_042863528.1|83541_83913_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	7.2e-63
WP_042863527.1|83915_84197_-	hypothetical protein	NA	J9Q801	Salmonella_phage	97.8	3.6e-46
WP_042863526.1|84193_84883_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	96.9	8.8e-123
WP_042863525.1|84941_86627_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.8	0.0e+00
WP_022649922.1|86768_87341_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.3e-97
WP_000462606.1|87449_88292_-	Rha family transcriptional regulator	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|88400_88589_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_045339190.1|88598_89093_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.2	2.1e-81
WP_100229801.1|89234_89843_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.0	1.4e-116
WP_000262979.1|90438_90669_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_004109976.1|90867_91461_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_045339187.1|91646_92489_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	91.8	1.7e-107
WP_000208226.1|92617_93175_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_004109992.1|93184_93604_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|93667_94312_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_000781812.1|94311_94788_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_169803266.1|94784_95180_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.2	1.5e-66
WP_022649915.1|95199_96303_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_100229802.1|96492_97362_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	97.9	8.7e-160
WP_002231164.1|97444_98587_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_042863520.1|98694_101010_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_002214145.1|101087_101657_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_045339176.1|101668_102415_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	1.3e-135
WP_058687808.1|102404_104321_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	94.4	0.0e+00
WP_100229804.1|104550_105636_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	97.8	4.2e-204
WP_058687806.1|105864_106368_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
WP_004110023.1|106399_106894_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_022649908.1|106969_107614_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
108237:108259	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP030079	Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence	91816	3436	46373	91816	integrase,transposase	Escherichia_phage(27.78%)	53	NA	NA
WP_112778029.1|3436_4141_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_049824851.1|4150_4621_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|4640_5429_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|5428_5947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|5951_6368_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|6753_7458_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|7579_8485_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|8481_9720_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|9719_10304_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|10796_11561_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|11730_12435_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_112777775.1|12471_13452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389732.1|13451_13712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389733.1|14326_14596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389734.1|14647_15034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069325153.1|15045_15579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389736.1|15583_16360_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	85.1	3.6e-48
WP_053389737.1|16453_16738_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_048227675.1|16785_17439_-	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	45.4	7.0e-45
WP_048227674.1|17716_18688_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	44.5	1.4e-68
WP_053389738.1|18692_19082_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_053389739.1|19085_20357_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	3.5e-157
WP_048227699.1|20356_20785_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.3e-28
WP_053389740.1|21239_21983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072206635.1|22337_22799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389741.1|22798_23137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389742.1|23500_24280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389743.1|24687_25197_+	antirestriction protein ArdA	NA	A0A222ZHP3	Rhodococcus_phage	30.8	6.3e-09
WP_048227667.1|25239_25428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176691863.1|25589_25823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158236436.1|25958_26108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077223967.1|26250_26583_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_053389745.1|26650_28639_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	1.7e-25
WP_053389746.1|28682_29108_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_048227664.1|29104_29839_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_048227663.1|29835_30072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040231232.1|30303_30462_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_040231230.1|31369_31726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389747.1|31768_32587_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	34.4	4.0e-13
WP_053389748.1|32666_33158_+	antirestriction protein	NA	NA	NA	NA	NA
WP_053389749.1|33202_33505_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_053389750.1|33501_33759_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	48.3	2.3e-07
WP_048227658.1|34514_34661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389751.1|34715_35285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389752.1|35692_36526_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.6	3.3e-47
WP_069325148.1|36688_37012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048227655.1|37255_37591_+	nikA protein	NA	NA	NA	NA	NA
WP_053389753.1|37612_40312_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_112777774.1|40407_41559_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.4	1.5e-29
WP_094935554.1|41684_42461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048227650.1|42491_42761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389033.1|42833_45134_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_053389034.1|45242_46373_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	85.9	2.0e-188
>prophage 1
NZ_CP030080	Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence	286652	69555	111910	286652	transposase,protease,integrase	Acinetobacter_phage(22.22%)	48	95705:95764	116687:117975
WP_000795949.1|69555_70731_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|70900_71113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777793.1|71473_72556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|72721_74221_-	kinase	NA	NA	NA	NA	NA
WP_000081060.1|74246_75884_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|75883_76924_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|77008_77647_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|77646_78288_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|78310_78949_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|79411_79879_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|79896_81105_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_031942304.1|81115_82072_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|82071_83151_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|83152_83926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|83918_85061_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|85070_86129_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|86449_87031_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|87030_88188_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|88210_88666_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|88688_89729_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|89777_90356_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|90424_91000_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|91428_92670_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|92760_93216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|93456_93648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|93739_94081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|95067_95322_+	hypothetical protein	NA	NA	NA	NA	NA
95705:95764	attL	GGGGTCGTCTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGAC	NA	NA	NA	NA
WP_000427623.1|95981_96986_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_010791757.1|97135_98818_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_000393453.1|98820_99729_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011405615.1|99725_100943_+	TniQ family protein	NA	NA	NA	NA	NA
WP_010981357.1|101003_101618_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_010981356.1|101656_101977_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_005413392.1|101992_102229_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_031942307.1|102225_102591_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|102702_103341_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_077269372.1|103355_103709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981353.1|103638_104073_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427614.1|104151_105156_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_072201471.1|105729_105942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021443905.1|106032_106380_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_058672289.1|106376_107015_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_112778030.1|107095_107749_-	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_011405608.1|107784_109494_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
WP_011405607.1|109681_109957_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|109970_110321_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_032490487.1|110392_110827_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427614.1|110905_111910_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
116687:117975	attR	GTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTCTGAGACGACCCCGATCAGTATTACGTTATCCCACTCCAGCCCCTTGGAACCATGCAGTGTGGAAAGGATGAAGGGATCGCAGTCAGTAGCAGCCTCGCCTGGATTCAAGATAAGGTTTAAAAACGTGCGGGAATCGATCTTACTGGAGTCAAGTAGCTCCCCGATCCTCACGACCCCTCGTTGCTGGTCGTTCGATCCAGTGCGAGTTACACCCTCAGAGCCAACACTATCAATGAAACCCTCCATACTCAGGCGTCGTAACACATCGATAGCAGGCGTTTCCTCTCCGTCTTTCTGGCAGATAGTGGCGAGCCTGCCCAGCCGATCTTTTTGGTATTGTGCGCCCTCGAATAACTGACCTAGAGCAGACCATAGGTCGGCGTGCGGAGCCATCAATCCACTGAGCGCCGCTTTGAATTGCCCTTTCTGCCATCTAAAACCAGCCTCCTTCAGAAAGCCGTAAACAATCGCTTGTTTGTTGGGATGGTTTTCCAGTAGCCGCAGATCGCCGTACACAGACAGCAAGACGCCAACTACCAGTATCCCGATTTCGGTGCGGGTGTGTAATGCGCTTGAACCATTGAGGTAGCGATAAGGTAGCCCACACAGGCGTAAAGCAATTTCCGCCTCAGCAAGGTTCGCCTTAGTGCGGGACAATATGGCTTGTGTTCCACTGCTCACCGAGAGGTTTGATAGCACCTTGGATAGGCAGTTATCAAAGTGCAATCTGACCTCTGTTTTGGGGGTGCTAGGATGACTGACACAAAGCTTGGTCAGCTTTGTAGAGTTGCGCCGAATTACCGAGTTAGCCATCAAGGAAAGCTCATGGCCAAATCTGAACGTGCATGACAGTTGAAACACCTTCGTATTCGGGTAGTGCCTTTCAAACAGTCCGCCGATAAAGTCTGGTCGAGCACCACGCCACTCATAAATACACTGGTTAACATCACCAACAGCCATAACCGACGTATCCGACTTAGATAGCAAGCGGGTCATGTCATGCTGTATCAGGTTAACGTCCTGATATTCATCAACAATGATGTGCTTGAAGTGGGCACCAAGGCTGCTGTCATTACGCAACAGTGCGACAGCCTCAATCAAACAGTCATCAAAGGTTCGCAGACTGTTTTCCTCCAGCAGCTCACAATAGCGGCCATAGGCGTGAATAAACTCCCGTTTGATGTTGCTGAACGTTGGATCATTGGCAGCATCAACAGGAGTTACGGCCGCCGCCCGGCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP030080	Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence	286652	115464	174982	286652	transposase,protease	Salmonella_phage(54.55%)	49	NA	NA
WP_000427623.1|115464_116469_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000211823.1|118407_119394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|120314_120707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|121365_122022_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_101724158.1|122224_122722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083579.1|122726_124115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|124515_124809_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|124813_126139_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|126199_126406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|126506_126917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001641519.1|126929_127745_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
WP_000278471.1|127997_128423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|128971_129280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|129295_130153_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|130759_131164_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|131341_131635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|131660_131897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|131937_132393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|132452_133118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|133175_133556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|137713_138418_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001120775.1|139205_139481_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842119.1|139539_140649_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	1.8e-32
WP_000070400.1|140699_141098_+	VOC family protein	NA	NA	NA	NA	NA
WP_000664785.1|141255_142590_+	DUF3422 family protein	NA	NA	NA	NA	NA
WP_000440264.1|142637_143468_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000233327.1|143485_144796_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000038427.1|144999_147651_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	2.1e-156
WP_000765646.1|147842_148274_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_001141269.1|148638_148914_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_007372360.1|149599_150751_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000859348.1|150911_151058_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_007372361.1|151083_152094_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_022646510.1|153357_153522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831397.1|153579_153948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896835.1|154631_155999_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003026030.1|155974_156643_-	response regulator	NA	NA	NA	NA	NA
WP_001805638.1|156728_157505_-	membrane protein	NA	NA	NA	NA	NA
WP_001067855.1|159168_159873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_112777898.1|159931_160057_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	6.4e-08
WP_000114860.1|160216_161380_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_101724159.1|161627_163319_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	2.2e-66
WP_000070862.1|163315_163492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502495.1|163540_163996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000535423.1|163982_164264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000966518.1|164321_164948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232713.1|165320_167777_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000159528.1|168884_169973_+	IncHI-type plasmid replication initiator protein RepHI2	NA	J9Q7H0	Salmonella_phage	50.9	2.8e-83
WP_000654804.1|174013_174982_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
>prophage 3
NZ_CP030080	Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence	286652	237379	269701	286652	transposase,integrase	uncultured_Caudovirales_phage(42.86%)	36	267220:267233	272442:272455
WP_100185530.1|237379_238294_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_000900745.1|238459_238777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|238827_239235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|239692_240364_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|240408_240714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|240736_241054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|241267_242671_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|242699_243332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065945190.1|243528_244932_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|244964_245669_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|245755_246076_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|246121_247411_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|247423_247849_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|247908_248736_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|248754_250233_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|250724_251000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|251140_251338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|252324_252582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|253016_253913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|253915_254431_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|254645_256073_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|256133_256301_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078513.1|256323_257643_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|257655_257859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|257922_259128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|259124_259943_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572379.1|260147_260315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019951.1|260408_260681_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|260803_261919_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|262176_262611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|262828_264175_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_016809156.1|264213_265182_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_001572373.1|265370_266990_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|267066_267543_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
267220:267233	attL	CATCGCCACCCGCA	NA	NA	NA	NA
WP_001067855.1|267708_268413_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|268687_269701_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
272442:272455	attR	CATCGCCACCCGCA	NA	NA	NA	NA
>prophage 1
NZ_CP030081	Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence	39601	0	31135	39601	transposase,integrase	Acanthamoeba_polyphaga_mimivirus(11.11%)	32	9583:9601	36998:37016
WP_012850347.1|2221_4159_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_112777808.1|4124_5156_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_112777807.1|5136_6363_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_112777806.1|6362_7199_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_012850352.1|7200_7941_-	Type IV secretory pathway component	NA	NA	NA	NA	NA
WP_112777805.1|7940_8162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777804.1|8322_9333_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_112777803.1|9344_9605_-	EexN family lipoprotein	NA	NA	NA	NA	NA
9583:9601	attL	TTTCGTGCGCACGAAAAAT	NA	NA	NA	NA
WP_112777802.1|9614_10247_-	type IV secretion protein	NA	NA	NA	NA	NA
WP_112777801.1|10243_12802_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_112777822.1|12699_13017_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_012850360.1|13029_13350_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_012850362.1|13767_15738_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.2	1.2e-76
WP_112777800.1|15734_16475_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012850364.1|16484_16973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850365.1|17397_17655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850366.1|17702_17840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850367.1|17946_18270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112777799.1|18279_19344_+	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	34.9	5.3e-34
WP_012850369.1|19344_19992_-	recombinase family protein	NA	NA	NA	NA	NA
WP_112777798.1|19991_20723_-	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	33.9	1.9e-06
WP_112777797.1|20712_21579_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.9	1.1e-26
WP_001389365.1|21888_22653_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_013263789.1|23006_23807_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_000845039.1|23973_24987_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_084852353.1|25273_25585_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_112777820.1|25769_27122_+	replication protein	NA	A0A1B1P892	Bacillus_phage	25.4	3.1e-10
WP_041692624.1|27768_28191_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.0	1.6e-05
WP_112777819.1|28300_29296_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_112777818.1|29483_29864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971684.1|30064_30379_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_112777817.1|30382_31135_+	ParA family protein	NA	H7BUL8	unidentified_phage	29.9	4.3e-14
36998:37016	attR	TTTCGTGCGCACGAAAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP030081	Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence	39601	37107	38637	39601		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_112777811.1|37107_38637_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	6.9e-35
