The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1153189	1167986	4108882		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187844.1|1153189_1153738_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1154000_1155500_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1155501_1157877_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1157883_1158867_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1158877_1159573_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1159582_1160389_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1160398_1161448_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1161803_1164536_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1164615_1167315_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|1167410_1167986_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
>prophage 2
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1271512	1312026	4108882	plate,capsid,integrase	Acinetobacter_phage(94.74%)	60	1271494:1271510	1313289:1313305
1271494:1271510	attL	CACCAAATCTACACCAA	NA	NA	NA	NA
WP_000775332.1|1271512_1272532_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.1	3.2e-68
WP_000512308.1|1272528_1272819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000927773.1|1272819_1273089_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	57.3	3.9e-18
WP_001094953.1|1273090_1273591_-	N-6-adenine-methyltransferase	NA	A0A0C5AN16	Bacteriophage	62.0	1.5e-47
WP_000132376.1|1273587_1274025_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	84.5	7.0e-33
WP_000132012.1|1274029_1274398_-	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	96.7	2.2e-64
WP_001057139.1|1274408_1275287_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	97.9	1.2e-145
WP_000505394.1|1275289_1275604_-	hypothetical protein	NA	A0A1B1P9H1	Acinetobacter_phage	94.2	1.2e-53
WP_001056649.1|1275611_1275821_-	hypothetical protein	NA	A0A1B1P9G5	Acinetobacter_phage	95.7	3.8e-29
WP_000371053.1|1275885_1276650_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	66.2	6.4e-90
WP_001058895.1|1276642_1276906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076126.1|1276905_1277097_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	68.2	1.1e-14
WP_001129670.1|1277303_1277807_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
WP_000048049.1|1277809_1278811_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
WP_001065785.1|1278861_1279077_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	1.6e-30
WP_000357169.1|1279097_1279772_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	96.9	5.8e-119
WP_001077693.1|1279873_1280074_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
WP_000048916.1|1280084_1280405_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001095608.1|1280460_1280751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033653.1|1280747_1281794_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
WP_001110396.1|1281790_1282741_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_000544510.1|1282733_1283483_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
WP_000647820.1|1283479_1283902_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_002018225.1|1283951_1284314_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_001288422.1|1284306_1284531_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100185.1|1284530_1284926_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|1284922_1285423_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|1285618_1286269_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000715269.1|1286530_1287289_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
WP_000787534.1|1287383_1288031_+	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
WP_000113271.1|1288078_1288588_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
WP_000220360.1|1288584_1290243_+	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
WP_000522918.1|1290253_1291666_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
WP_000635838.1|1291688_1292324_+|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
WP_000473611.1|1292612_1293929_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
WP_000525986.1|1293932_1294409_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
WP_000040568.1|1294473_1295499_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
WP_000041170.1|1295508_1295940_+	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
WP_000622625.1|1295943_1296330_+	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
WP_000094499.1|1296326_1296887_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
WP_000057776.1|1296873_1297242_+	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
WP_000502801.1|1297244_1297784_+	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
WP_000174797.1|1297787_1299263_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
WP_000109247.1|1299277_1299721_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	99.3	9.5e-78
WP_001165481.1|1299720_1300185_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	66.2	4.2e-52
WP_001285939.1|1300380_1302405_+	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	99.1	0.0e+00
WP_000821708.1|1302401_1302758_-	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	99.2	1.3e-61
WP_001051325.1|1302757_1302985_-	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
WP_001018608.1|1303344_1303941_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
WP_001240305.1|1303943_1304240_+	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	90.8	3.7e-46
WP_000003733.1|1304236_1305196_+	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	99.1	2.2e-180
WP_001218526.1|1305198_1305861_+	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	99.5	2.0e-127
WP_001270575.1|1305895_1306249_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	99.1	6.9e-63
WP_001229407.1|1306251_1307436_+|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	99.7	3.5e-220
WP_001192560.1|1307435_1308026_+	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	92.9	3.5e-104
WP_000359221.1|1308018_1308627_+	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	98.5	2.6e-110
WP_000224782.1|1308690_1310745_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	96.3	0.0e+00
WP_001104855.1|1310746_1310974_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	96.0	5.6e-34
WP_000433900.1|1311051_1311441_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
WP_001019738.1|1311483_1312026_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	92.2	1.6e-95
1313289:1313305	attR	CACCAAATCTACACCAA	NA	NA	NA	NA
>prophage 3
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1372982	1393826	4108882	transposase	Escherichia_phage(33.33%)	19	NA	NA
WP_001067858.1|1372982_1373687_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|1373940_1374756_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067858.1|1374868_1375573_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014454105.1|1376602_1377157_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_002075262.1|1377249_1377882_+	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
WP_001206316.1|1377939_1378731_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|1378894_1379242_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1379235_1380075_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|1380479_1382021_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|1383419_1384193_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|1384173_1384455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|1384674_1384860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|1384908_1386093_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|1386491_1387967_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|1388022_1388907_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000753551.1|1389550_1391110_-|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000781558.1|1391202_1391559_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000555098.1|1391561_1391846_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|1393121_1393826_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 4
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1572382	1624854	4108882	capsid,terminase,integrase,transposase	Acinetobacter_phage(96.61%)	73	1560947:1560962	1597074:1597089
1560947:1560962	attL	TTTTCAAAATCATTAA	NA	NA	NA	NA
WP_000773627.1|1572382_1573645_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
WP_000910238.1|1573650_1573920_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000015927.1|1573920_1574178_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.1	4.7e-45
WP_000048750.1|1574181_1574466_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.7e-43
WP_000453808.1|1574462_1574672_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
WP_000654849.1|1574674_1574920_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_020752379.1|1574921_1575998_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
WP_004793763.1|1575994_1577116_-	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
WP_000064469.1|1577126_1577450_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
WP_038338696.1|1577442_1577892_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	5.5e-73
WP_000054453.1|1578094_1578961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002055001.1|1578961_1579852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002055031.1|1579924_1580614_-	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	5.3e-59
WP_001217697.1|1580741_1580918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002055026.1|1580914_1581178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001095606.1|1581221_1581512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033653.1|1581508_1582555_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
WP_001110399.1|1582551_1583502_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
WP_000544506.1|1583494_1584244_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001031749.1|1584240_1584375_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000648413.1|1584361_1584784_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_002018225.1|1584833_1585196_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_001288422.1|1585188_1585413_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100185.1|1585412_1585808_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|1585804_1586305_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|1586500_1587151_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000715269.1|1587412_1588171_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
WP_111805013.1|1588265_1588907_+|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	71.9	1.1e-90
WP_000212566.1|1588965_1589436_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_017817073.1|1589425_1590853_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	94.7	3.2e-260
WP_038340150.1|1590849_1592301_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	97.9	6.8e-282
WP_024435922.1|1592302_1593406_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	98.6	4.3e-204
WP_005135095.1|1593414_1593843_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	98.6	7.5e-72
WP_038340149.1|1593941_1594184_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	98.8	6.2e-39
WP_162986048.1|1594199_1594352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038340148.1|1594403_1594595_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	98.4	1.5e-27
WP_000770049.1|1594708_1595476_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214189.1|1595503_1596460_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_038340146.1|1596526_1597192_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	74.7	1.1e-80
1597074:1597089	attR	TTAATGATTTTGAAAA	NA	NA	NA	NA
WP_005135101.1|1597196_1597586_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	94.6	2.6e-63
WP_005135103.1|1597587_1597959_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	94.3	2.7e-62
WP_005135105.1|1598014_1598953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038340145.1|1598997_1599405_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.9	8.2e-52
WP_038340144.1|1599376_1599745_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	84.4	8.8e-53
WP_170832343.1|1599701_1600145_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	98.0	1.5e-78
WP_038340131.1|1600146_1600365_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.4	9.5e-31
WP_000064601.1|1600423_1600777_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	99.1	1.6e-59
WP_047938233.1|1600776_1602132_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	98.2	1.2e-200
WP_000094250.1|1602184_1603102_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.4	7.3e-165
WP_047938234.1|1603171_1603687_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	97.0	5.9e-71
WP_000838146.1|1604012_1604195_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_000966688.1|1604287_1604692_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_004793706.1|1604790_1605309_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	35.9	4.4e-26
WP_004793705.1|1605373_1605874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004793704.1|1605996_1606155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038338654.1|1606306_1611220_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	85.7	0.0e+00
WP_000937383.1|1611294_1612047_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
WP_000246069.1|1612050_1612443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277443.1|1612507_1612906_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_047938235.1|1612905_1613412_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.6	6.5e-91
WP_000835157.1|1613408_1613771_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
WP_038350211.1|1613763_1617210_+	bacteriophage protein	NA	A0A0D4DBG7	Acinetobacter_phage	97.0	0.0e+00
WP_000433923.1|1617278_1617668_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_000720514.1|1617867_1618209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735265.1|1618212_1618539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226299.1|1618595_1619087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124482.1|1619106_1619367_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000096283.1|1619532_1620432_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
WP_031974499.1|1620770_1621316_+	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	99.4	5.2e-102
WP_000999701.1|1621504_1622185_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001109862.1|1622195_1622843_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_047938236.1|1622849_1623443_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	99.5	9.7e-102
WP_085942227.1|1623688_1624854_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
>prophage 5
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2170343	2200146	4108882	capsid,head,protease,terminase,tail,portal	uncultured_Caudovirales_phage(37.04%)	46	NA	NA
WP_000095892.1|2170343_2170853_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000774828.1|2170836_2171103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104854.1|2171177_2171402_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_002018761.1|2171403_2173440_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
WP_000078482.1|2173493_2176328_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_001026372.1|2176278_2176674_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000587324.1|2176670_2177180_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_000882463.1|2177182_2177644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047938240.1|2177659_2181256_-	transglycosylase SLT domain-containing protein	NA	D4FUM0	Pseudomonas_phage	31.7	1.4e-41
WP_000718016.1|2181313_2181598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031978725.1|2181741_2181957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047938241.1|2181992_2182508_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_038808725.1|2182507_2182981_-	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	61.1	6.0e-54
WP_043041646.1|2183057_2183429_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	47.9	2.3e-21
WP_047938242.1|2183428_2183914_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	43.3	1.1e-26
WP_033514245.1|2183917_2184274_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000631204.1|2184275_2184563_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	9.3e-18
WP_166436857.1|2184559_2184736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042053170.1|2184783_2185956_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	1.2e-87
WP_000375469.1|2185948_2186611_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000108390.1|2186603_2187830_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000125540.1|2187826_2189521_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
WP_001191044.1|2189692_2189884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219090.1|2189903_2190386_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
WP_047938243.1|2190555_2190738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649784.1|2190748_2191027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776298.1|2191023_2191323_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	6.5e-22
WP_000615238.1|2191252_2191543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047938244.1|2191520_2192078_-	hypothetical protein	NA	A0A0A0RVZ2	Escherichia_phage	57.1	2.7e-05
WP_000503081.1|2192070_2192433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047938245.1|2192425_2192608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433061.1|2192597_2193128_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
WP_000856318.1|2193143_2193542_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_000862382.1|2193623_2193818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001256755.1|2193857_2194139_-	DUF968 domain-containing protein	NA	A0A1B1P9J2	Acinetobacter_phage	95.4	1.8e-42
WP_079452707.1|2194089_2194293_-	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	94.0	2.7e-27
WP_032041139.1|2194295_2194604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032008026.1|2194697_2194946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|2195305_2195803_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_001003589.1|2195802_2195973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847048.1|2195969_2196248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038350198.1|2196244_2197657_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.4	1.5e-79
WP_000543838.1|2197653_2198724_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
WP_001005282.1|2198723_2199020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414267.1|2199080_2199314_-	hypothetical protein	NA	A0A2H4J114	uncultured_Caudovirales_phage	50.0	3.8e-09
WP_000420592.1|2199441_2200146_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PKV4	Moraxella_phage	45.1	1.2e-53
>prophage 6
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2663460	2718678	4108882	tRNA,transposase	Escherichia_phage(27.78%)	50	NA	NA
WP_002000926.1|2663460_2664201_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_000912930.1|2664371_2664998_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000703552.1|2665008_2665788_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000026482.1|2665874_2667290_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001987632.1|2667503_2668748_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000546639.1|2668751_2669768_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_000654268.1|2669891_2670236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498918.1|2670453_2672679_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001060738.1|2672704_2673121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941316.1|2673389_2673878_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|2673934_2676514_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237344.1|2676815_2677622_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001026230.1|2677618_2678044_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001195082.1|2678135_2678558_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000203219.1|2678996_2679662_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_085940413.1|2679718_2680808_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001159802.1|2681053_2682103_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_001034598.1|2682162_2682942_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000776215.1|2683058_2683376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517792.1|2683498_2684818_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|2684882_2686049_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188823.1|2686324_2687350_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000199457.1|2687619_2690256_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001185176.1|2690321_2691602_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|2691848_2692103_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495836.1|2692172_2692739_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000735756.1|2692804_2693194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111760.1|2693432_2693990_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077405.1|2694033_2695032_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|2695143_2696463_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_002001404.1|2696785_2696983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256760.1|2697381_2698932_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000599996.1|2698955_2699786_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000226456.1|2699851_2700814_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000459997.1|2701324_2702047_+	pirin family protein	NA	NA	NA	NA	NA
WP_000107496.1|2702111_2702735_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000626177.1|2703259_2704219_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000600025.1|2704281_2705115_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|2705947_2706652_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000147567.1|2707685_2708246_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2708371_2708722_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|2708939_2709644_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|2709773_2710589_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|2710741_2710921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|2711187_2711892_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|2711903_2712563_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|2715586_2716291_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2716361_2717222_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_029642339.1|2717404_2717944_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.8	1.2e-85
WP_001067855.1|2717973_2718678_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2786380	2818416	4108882	capsid,head,protease,terminase,tail,integrase,portal	Acinetobacter_phage(43.33%)	46	2786167:2786220	2822253:2822306
2786167:2786220	attL	ACCTTGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCAT	NA	NA	NA	NA
WP_000115731.1|2786380_2787745_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	42.7	2.9e-85
WP_001186629.1|2787728_2787923_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	2.7e-13
WP_002018743.1|2788017_2788188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265243.1|2788156_2788525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095892.1|2788524_2789034_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000774828.1|2789017_2789284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104854.1|2789358_2789583_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_002018761.1|2789584_2791621_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
WP_000078482.1|2791674_2794509_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_001026372.1|2794459_2794855_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000587324.1|2794851_2795361_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_000882463.1|2795363_2795825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246490.1|2795840_2799434_-	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	39.9	3.0e-44
WP_001031955.1|2799496_2799829_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
WP_000498808.1|2799905_2800121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074127.1|2800156_2800672_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_001062223.1|2800673_2801150_-	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
WP_000598741.1|2801221_2801596_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
WP_000235306.1|2801595_2802081_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
WP_001139340.1|2802084_2802441_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000631202.1|2802442_2802730_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
WP_000666093.1|2802726_2802903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137059.1|2802950_2804123_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
WP_000375469.1|2804115_2804778_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000108390.1|2804770_2805997_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000125540.1|2805993_2807688_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
WP_001191044.1|2807859_2808051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219090.1|2808070_2808553_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
WP_000202128.1|2808699_2808924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776297.1|2808968_2809268_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
WP_001079329.1|2809197_2809491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063945.1|2809496_2809679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433065.1|2809668_2810199_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
WP_000856318.1|2810214_2810613_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_000238616.1|2810688_2810907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780217.1|2811616_2811892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|2812271_2812769_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_001003589.1|2812768_2812939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360556.1|2812935_2813316_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	44.4	3.0e-16
WP_001288609.1|2813317_2813602_-	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	63.8	3.5e-33
WP_002018656.1|2813594_2813957_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	98.3	4.3e-68
WP_000801891.1|2814006_2814351_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	75.2	8.0e-40
WP_000180364.1|2814622_2816035_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.6	6.5e-80
WP_000543838.1|2816031_2817102_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
WP_001005282.1|2817101_2817398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000418954.1|2817759_2818416_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ00	Moraxella_phage	36.9	1.2e-31
2822253:2822306	attR	ACCTTGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCAT	NA	NA	NA	NA
>prophage 8
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2829447	2858121	4108882	capsid,terminase	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001019739.1|2829447_2829993_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|2830034_2830424_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|2830491_2833917_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|2833909_2834272_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2834268_2834775_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2834774_2835173_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2835265_2835853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2835943_2840254_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|2840381_2840645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2840646_2841327_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2841431_2841890_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2841898_2842198_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|2842700_2843216_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2843285_2844203_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|2844255_2845434_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|2845433_2845787_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2845883_2846405_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2846513_2846732_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001984404.1|2846733_2847177_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_000539749.1|2847133_2847502_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|2847473_2847884_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|2847935_2848229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|2848236_2848434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|2848502_2848871_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|2848871_2849252_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|2849255_2849591_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|2849635_2850586_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|2850599_2851391_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|2851477_2851792_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_001291451.1|2851843_2851996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004550.1|2852011_2852242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|2852238_2853345_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|2853354_2854695_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|2854734_2856027_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|2855986_2856502_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435230.1|2856560_2857202_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000378523.1|2857170_2857605_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|2857665_2858121_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 9
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2862079	2874427	4108882		Acinetobacter_phage(95.65%)	24	NA	NA
WP_001277128.1|2862079_2862556_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|2862552_2862954_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|2862953_2863346_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|2863338_2863677_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|2863673_2864474_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|2864476_2865358_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|2865350_2865575_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|2865646_2865919_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|2865980_2866301_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|2866311_2866500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|2866604_2867357_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|2867371_2867587_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|2867638_2868646_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2868647_2869151_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|2869289_2869493_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|2869499_2869742_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|2869935_2870379_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|2870378_2870669_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|2870661_2870985_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|2870996_2872118_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|2872114_2873047_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|2873048_2873300_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|2873300_2873708_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|2873704_2874427_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 10
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2992605	3044816	4108882	holin,transposase	Vibrio_phage(33.33%)	45	NA	NA
WP_000179784.1|2992605_2994672_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
WP_000243382.1|2994789_2996412_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
WP_001985959.1|2996665_2997301_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001286309.1|2997293_2998766_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001021934.1|2998861_3000520_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_000714073.1|3001030_3002671_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000188090.1|3002762_3003233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000697115.1|3003449_3004328_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_001271336.1|3004333_3005668_+	amino acid permease	NA	NA	NA	NA	NA
WP_002071221.1|3005722_3007600_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001115355.1|3007759_3008467_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_000061141.1|3008787_3009063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105559.1|3009077_3009968_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000050871.1|3010155_3011100_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000182788.1|3011272_3012658_+	MFS transporter	NA	NA	NA	NA	NA
WP_001046209.1|3012735_3014082_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_000675273.1|3014728_3015013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020972.1|3015293_3015596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998814.1|3015600_3016551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109893.1|3016941_3017805_-	DNA adenine methylase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	26.5	6.9e-16
WP_000203259.1|3017869_3019591_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001050367.1|3020154_3020820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947913.1|3021995_3023085_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000370726.1|3023183_3024590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075481.1|3024593_3024881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075484.1|3024885_3025800_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000807825.1|3025973_3026591_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	34.8	2.0e-25
WP_000147423.1|3026590_3026986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014466162.1|3027135_3027648_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|3028312_3029134_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085947913.1|3029239_3030329_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000370726.1|3030427_3031834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075481.1|3031837_3032125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000147423.1|3033833_3034229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014466162.1|3034378_3034891_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|3035555_3036377_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085947913.1|3036482_3037572_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000370726.1|3037670_3039077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075481.1|3039080_3039368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075484.1|3039372_3040287_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000807825.1|3040460_3041078_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	34.8	2.0e-25
WP_000147423.1|3041077_3041473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014466162.1|3041622_3042135_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001046004.1|3042799_3043621_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085947913.1|3043726_3044816_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	3123726	3131823	4108882	integrase	Acinetobacter_phage(57.14%)	14	3124571:3124585	3136483:3136497
WP_001260065.1|3123726_3124098_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.6	1.4e-10
WP_000643997.1|3124268_3124949_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
3124571:3124585	attL	AATTAAGGCAAAGGC	NA	NA	NA	NA
WP_000805204.1|3124961_3125990_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000986115.1|3126130_3126421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|3126421_3126601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609004.1|3126593_3127130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578497.1|3127126_3127636_+	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
WP_000028957.1|3127632_3127842_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_001292077.1|3127838_3128054_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_000119264.1|3128054_3128225_+	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_000527288.1|3128231_3129224_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000549863.1|3129338_3129794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076477.1|3129784_3130669_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000947475.1|3130665_3131823_-|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
3136483:3136497	attR	AATTAAGGCAAAGGC	NA	NA	NA	NA
>prophage 12
NZ_CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	3796260	3853334	4108882	integrase,tRNA,transposase	Staphylococcus_phage(14.29%)	54	3835669:3835728	3859694:3861885
WP_000216739.1|3796260_3797193_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|3797242_3798439_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908243.1|3798463_3799810_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942498.1|3799970_3800222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278225.1|3800242_3802096_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|3802092_3802356_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608730.1|3802499_3803420_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_000011159.1|3803566_3804382_+	DsbC family protein	NA	NA	NA	NA	NA
WP_047938254.1|3804626_3805928_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|3805983_3807123_+	threonine synthase	NA	NA	NA	NA	NA
WP_003384760.1|3807229_3808276_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|3808488_3809124_+	response regulator	NA	NA	NA	NA	NA
WP_002001070.1|3809179_3810703_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000840549.1|3810727_3812149_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000942504.1|3812152_3813337_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|3813352_3814900_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|3815025_3816096_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|3816095_3817196_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|3817339_3818788_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151592.1|3818780_3819188_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001988710.1|3819226_3819865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|3819995_3820214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|3820273_3820933_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|3820975_3822268_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292506.1|3822264_3823350_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|3823365_3823824_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738520.1|3823981_3825379_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000780326.1|3825436_3825775_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|3826054_3826282_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010465.1|3826347_3827205_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144971.1|3827287_3829075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|3829457_3830261_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3830260_3831097_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|3831216_3831441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3831651_3833145_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000512977.1|3833382_3833787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088605.1|3833764_3834388_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089073.1|3834469_3835687_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
3835669:3835728	attL	TTGTCAGTTCCACAAATAAATCAGAGTTTACACAAATAAACTAGAGCAAGAATAAAAAGT	NA	NA	NA	NA
WP_001144964.1|3835769_3837566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953322.1|3837860_3839348_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_000034564.1|3839360_3840212_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|3840279_3840579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3840651_3841023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017214.1|3841397_3842828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081835.1|3842820_3843936_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000417085.1|3843965_3844886_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|3844890_3846801_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736396.1|3846801_3847512_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_071543477.1|3847716_3848010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|3847903_3848206_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|3848292_3849108_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|3849200_3850290_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|3850712_3852623_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|3852623_3853334_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
3859694:3861885	attR	TTGTCAGTTCCACAAATAAATCAGAGTTTACACAAATAAACTAGAGCAAGAATAAAAAGTATATTATCTATATGCTTTAATTTTTCATTTTGTAAAAATATATGCCTGTTAATAATGACAAAATAACGACTATTGATTGCTTCCCAAACGATAATATTAGTCGAGTGGTTTATAGATATGGTGGACTTGTTAGAAACGAAGATAACGATTCAACTAATCCTTTTGTTGAAGTGTTATTAATTGAGATTAGAAAAAGTGATCAATGGTTATTTTTAGATAAGTGCTCAACATTCCTTGTTCCCGTACTTGATCTTGATGCTGTTCAACATGGCAGTATTTGGGATGGAAATGTTTTAACCGATCAATCCTATCGGTTTTCAGGAAAACTCATTACAAAACGATTTTCTTTCGACTTCACCAATAATAAACCTAAGAATATAAAACTTACGGACAGAATCCCCAATACTTCTGACTACTACATTCCTTTAAAAAACTATTTCCTCCCAAATAAAGTTGATTATGTTCTTCAAGGCTATCCATTTACCAAATATACCAATGATTCATATCGCAAAGTGAATCATTGCCTAATGCATTCCAATGATGGAACTCAAGTCATCACATCATCAATTCATGTATTGCATAGCTTATTCGTCAATCGGAAGGATATTAGGGGACTTTTATTAGGAACTTCGAGTCAATCCATCATTAATCGTTTTTTAGAATCTTATACAACAGAAATTGTGGACGATAATGTTGAATATAAAATTAAAATCAGAAAGCCATATGAAGATATAGGCGAGACTGCAATTATTTTTCTTGCTAATCTTGCCTTAAACCCATATGTGCAAACGATAGTTGATAAAATTCAACGAAGTATGGAAATTACCGAGTTTAATCATCTTCAGCAGGGTACAGGCAAAAGGTATCCCATTGTGTTTCCACCACATCCCACAAAGCTTTTCCTTGAAGCAGAAGGAATTTGGCTAGATGACAATAAGACTCGTTTTTTTATCACTAGAGTGAAAAAATTTGATCCTATTAACGATCACATGATTGATGTCAACAAAGACCTGACCAATACAATTTCAAAGCCTGATGAGAAAAATCCTAGACCTCGTGAAAAAAGTCAAAATAAGAATGAGCACATCAATACTCAAAAACCACCATCAAGAACAAGCGGTGAATATCGTAAGCGTTCTGAGGTGGAAACTGGAAATACACAAGGTATTCTGAAGTATTCTTTTAATGAACCAACCGATGATCCAATTGAAGTCGGAGCATCTAATCAACCTTATTCAGATAAATCAGAAGAGGTTGAAACATCTTCTGATGAACCCTATGGTAATCAAAATACTAAGATCAAAAAATCTGAAACGACAGATACACCACCTAGCAGAGATGAACGTTTTGACATTCAATACATTATCCAATCTCTCCAAGAACTTGCTTCTGAAATGGGTTCTCCTCTGGAACATCTGTCTGCAATTAATGAACATGGTGAAATGATAGCGAGTATTAATTTGCTTCAAATCAAAAAACTTGTGCCTGAACCCAAGCATCCCTCATGGATTGATTATGATAAAGGGCGAAAATTATTGTTCTTAAAATTAGACTTAAAAGATCAAAATGGATTTTCCTATCTCATCGATATACATAAAAATAAAAATCATGAAGCATTTTGTGCCTTTCTTATTTTTACTCAGAATAAGTTAACAAGCGAACAAATTAAAAAAATCTGTATTGAACTAGAAAATGCCAAGGGAATAAAAAAATGGGCACTCTACTGTGATAGTTTCATTCATAAAATGATTGCAATAAAACATTTATACGCAACACCAGATGAATGGAAAAATCGCTTTAAAAATTTATTCATAAGCTTACAGAAGGACAAATCCTAATTAAAGAATATTTTTTATACAATCATATGTTCATGAAATTACTTGGTATTTCATGTTTTCTATAAATTTGCGAAATAAAAAAGAGTGAAATTTTCGTTCAGTTCGCCTATACTAACAGTTCAATTTAAATTTCTATTCGTATTCACACACTTATGCTTTTGACTCCACCCTAGTTTATTTACCCATCTTTTTGTAAATAACTCATCACTGTCTAGTGATGTGGTGTAGTCGCTTGTGTGTTGTATATATCACATCACTAGCCTTTCCTAAAATTTAAAAAAATAGGCTATTTTC	NA	NA	NA	NA
>prophage 1
NZ_CP021327	Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence	112155	0	107030	112155	portal,integrase,transposase,terminase,tail	Pseudomonas_phage(29.41%)	110	29383:29406	94387:94410
WP_002017390.1|237_657_-	dehydrogenase	NA	NA	NA	NA	NA
WP_000450759.1|666_774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804052.1|916_1525_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087972.1|1629_1860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655271.1|1943_3071_-	alkene reductase	NA	NA	NA	NA	NA
WP_000699626.1|3271_3949_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000931662.1|4033_5191_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000920558.1|5787_6090_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000402508.1|6413_7253_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842147.1|7481_8594_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
WP_001133624.1|8615_8891_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_085942965.1|9081_10246_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	79.2	8.8e-131
WP_001202407.1|11047_12211_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.0	2.2e-09
WP_000119273.1|13634_13880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495140.1|14113_14440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000075093.1|14455_15178_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.1	4.2e-14
WP_000401859.1|15253_15502_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	44.8	1.3e-07
WP_000172716.1|15560_15902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000906141.1|16009_16228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881636.1|16291_16627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121876.1|17953_18160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000960557.1|18892_19318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993863.1|19757_20558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819256.1|20951_21521_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000146944.1|21555_21834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741665.1|21897_22191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000521251.1|22316_24026_-	DEAD/DEAH box helicase	NA	L7TNS5	Rhizobium_phage	46.2	3.4e-131
WP_000110211.1|24104_24743_+	ParB N-terminal domain-containing protein	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
WP_000131110.1|24771_25374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292430.1|25370_26021_+	ParB N-terminal domain-containing protein	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
WP_000312034.1|26020_26677_+	ATP-binding cassette domain-containing protein	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
WP_000184979.1|26673_27096_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000416809.1|27134_28088_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
WP_001175928.1|28078_28402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002027127.1|28370_28865_+	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
WP_000084570.1|28976_29378_+	hypothetical protein	NA	NA	NA	NA	NA
29383:29406	attL	AATTATTAATAAGCGCTTATTATT	NA	NA	NA	NA
WP_000134192.1|29530_30136_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
WP_000764108.1|30145_31390_+|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
WP_000206081.1|31435_33106_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	51.9	8.1e-146
WP_001131896.1|33149_34028_+	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
WP_001130341.1|34163_35066_+	hypothetical protein	NA	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
WP_000769019.1|35204_35699_+	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
WP_001110365.1|35705_36476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002027131.1|36477_37173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494965.1|37159_37510_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	2.5e-09
WP_001068664.1|37506_37893_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
WP_000101578.1|37892_38390_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_000002670.1|38474_39020_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	52.2	6.3e-39
WP_000771531.1|39114_39468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119495.1|39524_39821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000896671.1|39823_45412_+|tail	tail length tape measure protein	tail	NA	NA	NA	NA
WP_000394499.1|45484_45811_+|tail	phage tail protein	tail	D6PGG4	uncultured_phage	31.1	9.0e-09
WP_000504046.1|45810_46506_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	48.0	2.8e-60
WP_000567460.1|46502_47252_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	40.5	7.8e-48
WP_000959558.1|47245_47824_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	35.6	2.5e-25
WP_000992032.1|47847_59031_+|tail	tail protein	tail	A4JX16	Burkholderia_virus	36.4	7.6e-155
WP_001262280.1|59031_59346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121317.1|59359_60094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281052.1|60103_60355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185526.1|60487_60691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138816.1|60814_61207_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	56.2	9.7e-34
WP_000097415.1|61206_61845_+	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	65.0	2.0e-68
WP_000818857.1|62848_63970_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000084436.1|64086_64818_+	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.6	1.7e-15
WP_000005905.1|64905_65337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102028.1|65373_66777_+	DNA helicase	NA	L7TS87	Rhizobium_phage	38.8	4.3e-84
WP_001283392.1|66864_67959_+	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.7	1.1e-87
WP_000053683.1|68022_68577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082443.1|68576_69068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256859.1|69061_69670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000063348.1|69666_70176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083510.1|70188_71892_+	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.2	2.3e-87
WP_000497826.1|71931_72504_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	7.1e-09
WP_000925127.1|72576_73197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016664.1|73184_73613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770709.1|73609_74287_-	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	26.8	2.8e-12
WP_001180910.1|74489_74897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124736.1|74901_75486_-|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	4.0e-07
WP_000833465.1|75825_76245_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000047261.1|76666_76861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005716.1|77101_79024_+	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	43.9	3.9e-75
WP_000063932.1|79168_80413_+	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	41.7	2.4e-86
WP_000252084.1|80437_81103_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000840050.1|81153_81834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931856.1|81879_84237_+	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	43.4	4.3e-177
WP_000432853.1|84285_84861_+	HNH endonuclease	NA	A0A2D1GG92	Gordonia_phage	44.4	2.1e-24
WP_000695256.1|84857_86123_+	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
WP_000034357.1|86212_87301_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
WP_001099771.1|87443_88304_+	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
WP_000429229.1|88366_89404_+	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	8.8e-50
WP_000433629.1|89406_91605_+	recombinase RecA	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
WP_000680035.1|91692_92052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|92151_93241_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_047938264.1|93243_93699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234226.1|93698_94079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017393.1|94421_95537_+	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	38.1	1.3e-59
94387:94410	attR	AATTATTAATAAGCGCTTATTATT	NA	NA	NA	NA
WP_000698012.1|95536_97477_+	AAA family ATPase	NA	L7TNH6	Rhizobium_phage	42.8	6.4e-118
WP_000192217.1|97569_98406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692605.1|98537_99140_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.8	1.1e-31
WP_000030999.1|99213_99594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103335.1|99615_101988_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
WP_023897602.1|102085_103075_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
WP_001167538.1|103087_103999_+	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.4	7.7e-66
WP_001019929.1|104002_104287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000047654.1|104286_104514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017378.1|104544_104802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774949.1|104794_105160_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0S0NAG1	Pseudomonas_phage	63.6	2.8e-35
WP_000575331.1|105156_105828_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000973813.1|106019_106166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613547.1|106490_107030_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	48.9	2.0e-37
>prophage 2
NZ_CP021327	Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence	112155	110257	111121	112155		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000991896.1|110257_111121_+	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	29.7	8.8e-11
