The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	151126	199268	4848222	integrase,tail,tRNA,transposase	Escherichia_phage(48.15%)	49	150509:150523	185476:185490
150509:150523	attL	CGATGTTATTCAGCG	NA	NA	NA	NA
WP_000560983.1|151126_151564_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|151608_152550_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|153402_153621_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|153838_154081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027703.1|154410_155340_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|155336_155972_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|155968_156871_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|156883_159934_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|160127_160961_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|161113_162169_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|162218_163967_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019486.1|163966_165037_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|165026_166478_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|166488_166935_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|167235_167550_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|167559_168384_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|168834_170094_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|170090_171560_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|171847_172684_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|172667_173606_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063517.1|173602_174637_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|174921_175542_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001270260.1|176932_177607_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|177712_179086_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|179082_179781_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|179930_180431_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|180616_181597_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|181666_181960_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|182096_182369_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|182538_183039_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|183102_183327_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|183326_183629_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|183628_183853_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|183849_184125_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_002431311.1|185599_187141_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
185476:185490	attR	CGCTGAATAACATCG	NA	NA	NA	NA
WP_001016257.1|187155_187902_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000839179.1|188222_188627_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|188623_188971_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|189019_190555_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_062914736.1|190562_191165_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001286718.1|191224_192415_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|192427_192946_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|193002_193278_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|193310_193430_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069960.1|193422_195870_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978889.1|195884_196364_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|196363_197527_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|197608_197827_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_085947770.1|197899_199268_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 2
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	569469	627519	4848222	integrase,protease,tRNA,transposase	Enterobacteria_phage(21.05%)	52	578393:578408	607344:607359
WP_001162184.1|569469_570822_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|570876_571263_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106227.1|571307_571772_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
WP_087523559.1|571931_574070_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	3.4e-266
WP_001333756.1|574463_576119_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|576168_577590_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|577708_578656_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
578393:578408	attL	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001387276.1|578840_578894_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|579034_581731_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_024176429.1|581936_582323_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|582395_582857_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013049.1|582869_583805_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
WP_001296693.1|583808_583943_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|584223_584619_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500681.1|584749_585463_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256665.1|585533_586127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333754.1|586271_586724_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001333753.1|586846_588268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111530660.1|588254_588560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654804.1|588605_589574_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_000012906.1|589712_590717_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002954.1|590878_591295_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001333751.1|591340_591844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001014711.1|592036_593224_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_000416404.1|593275_596131_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|596130_596574_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|596927_598439_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|598705_599806_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|599805_600888_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|601048_602551_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001299662.1|602678_603698_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000772653.1|604142_605405_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
WP_001066505.1|605434_606073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455467.1|606450_606681_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000235891.1|606777_606963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023258408.1|607150_607327_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001246998.1|607319_607679_+	hypothetical protein	NA	NA	NA	NA	NA
607344:607359	attR	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001027153.1|607710_607995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075579.1|607991_608375_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000155331.1|608371_611044_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001066218.1|611444_612188_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126947.1|612184_612736_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185344.1|612741_613014_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_000993028.1|613659_614628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422112.1|614629_615562_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_001189123.1|617723_619232_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_049828170.1|620722_621112_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|621162_621381_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000169527.1|621447_621747_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878230.1|621743_622610_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
WP_000625669.1|622889_624167_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000088357.1|626379_627519_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 3
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	932158	1005001	4848222	plate,protease,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_001295561.1|932158_933511_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|933540_935973_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|936094_936580_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|936583_937609_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|937713_938169_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|938172_938961_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|938960_940109_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|940105_940702_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|940738_944221_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|944233_945193_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|945291_947433_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|947489_947879_+	VOC family protein	NA	NA	NA	NA	NA
WP_000062312.1|949289_949550_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|949536_949737_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|949902_950448_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|950444_950867_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|950880_951591_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|951790_952615_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|952668_954387_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|954498_955206_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|955202_955607_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|955724_956540_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|956579_957233_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|957225_958257_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|958444_959020_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|964779_965583_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|965579_966494_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|966734_967535_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|967538_968162_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|968209_969568_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|969639_970395_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|970428_971151_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|971147_971615_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|971679_972411_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|972947_973733_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|973869_974349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523582.1|974358_975273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|975316_975799_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|975822_977175_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|977185_980620_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|980728_982141_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|982145_982889_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|982885_985651_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|985659_986421_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|986425_987757_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|987759_988284_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|988280_989561_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|989585_990668_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|990631_992482_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|992485_992899_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|992905_994381_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|994431_994656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|994690_995191_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|995885_996404_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|996613_998755_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_039023185.1|998830_1003063_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_024198219.1|1003040_1003274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|1003864_1005001_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	1023891	1042339	4848222	integrase	Enterobacteria_phage(21.43%)	19	1024498:1024512	1031149:1031163
WP_039023169.1|1023891_1024947_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
1024498:1024512	attL	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_001285288.1|1025234_1026338_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1026349_1027603_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_021531046.1|1027958_1029173_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_074525659.1|1029565_1029769_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412539.1|1029768_1030200_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_087523546.1|1030212_1031022_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
WP_033554327.1|1031014_1031197_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
1031149:1031163	attR	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_077900594.1|1031190_1032258_+	ash family protein	NA	NA	NA	NA	NA
WP_001065738.1|1032250_1032445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|1032441_1032705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|1032701_1032923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058739.1|1032915_1033518_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_087523544.1|1033530_1036287_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
WP_016231259.1|1037048_1038515_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
WP_016231258.1|1038514_1040620_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231257.1|1040682_1041120_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_000678612.1|1041603_1041804_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_000230707.1|1041883_1042339_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
>prophage 5
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	1928590	1987218	4848222	head,capsid,transposase,integrase,tail,holin,portal,tRNA,terminase	Escherichia_phage(41.3%)	63	1923685:1923699	1930165:1930179
1923685:1923699	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|1928590_1929709_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|1929677_1929947_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|1930008_1932450_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
1930165:1930179	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|1932543_1932735_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1932731_1932920_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|1933320_1933524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|1933488_1933707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|1933799_1934000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|1934431_1934770_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|1935161_1935404_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|1935387_1935813_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|1935884_1936955_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|1936995_1937418_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|1937418_1937832_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|1937925_1938108_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001016257.1|1938475_1939222_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|1939236_1940778_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_011076332.1|1941310_1941529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1941731_1941944_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|1942111_1942390_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|1942391_1943450_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|1943450_1943831_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|1943827_1944649_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|1945043_1945130_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|1945618_1945831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|1945901_1946237_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|1946497_1946686_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|1946682_1946844_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000372595.1|1946993_1947209_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|1947213_1947564_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|1947627_1948161_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|1948377_1948560_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|1948650_1948944_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|1949469_1949820_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|1949967_1950450_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|1950449_1952207_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923134.1|1952354_1953581_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000766109.1|1954186_1955404_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|1955480_1955798_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|1955806_1956145_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|1956141_1956591_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|1956587_1956932_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|1956992_1957697_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001324129.1|1957696_1958083_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077253127.1|1958124_1958385_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|1958431_1961659_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|1961636_1961993_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|1961992_1962691_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|1962696_1963440_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|1963376_1963985_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|1964045_1967525_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|1967592_1968192_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|1972145_1973654_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000241001.1|1975833_1976502_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|1977055_1977919_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1977902_1979039_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1979288_1980515_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1980563_1981685_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1981760_1983221_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1983220_1983892_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1984060_1985431_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1985434_1986076_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1986111_1987218_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	2913533	2924448	4848222		Escherichia_phage(22.22%)	10	NA	NA
WP_087523507.1|2913533_2914541_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_000704907.1|2914733_2915900_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004206788.1|2916080_2916635_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_004206787.1|2916649_2917540_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_016161468.1|2917571_2918441_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_049139659.1|2918467_2919532_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_000043542.1|2919756_2921163_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_099147860.1|2921334_2921727_-	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_099147824.1|2921806_2923135_-	flippase	NA	NA	NA	NA	NA
WP_125922846.1|2923170_2924448_-	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
>prophage 7
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3012710	3022153	4848222		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|3012710_3013847_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|3013843_3015844_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_032204114.1|3015968_3016430_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001551352.1|3016471_3016942_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|3016988_3017708_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3017704_3019390_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|3019611_3020343_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3020402_3020510_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|3020490_3021222_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|3021226_3022153_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3034112	3134926	4848222	head,capsid,lysis,tail,portal,tRNA,terminase	Enterobacteria_phage(35.09%)	102	NA	NA
WP_001551359.1|3034112_3035060_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|3035298_3035697_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|3035693_3036389_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553553.1|3036518_3037403_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920064.1|3037552_3038272_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383045.1|3038274_3038514_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001551360.1|3038910_3040149_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_001551361.1|3040142_3041378_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275118.1|3041448_3042459_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255032.1|3042474_3043995_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001036964.1|3044055_3045054_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628659.1|3045333_3046374_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001551362.1|3046515_3047673_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|3047689_3048358_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|3048615_3049452_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000534384.1|3051753_3053223_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548286.1|3053427_3054309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182053.1|3054407_3055457_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873880.1|3055530_3056388_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
WP_001065004.1|3056390_3057479_+	sugar kinase	NA	NA	NA	NA	NA
WP_000382939.1|3057534_3058785_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000415426.1|3058884_3059826_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000658598.1|3059955_3060654_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_001328268.1|3060721_3061972_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_001208119.1|3062990_3063932_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854453.1|3064355_3066047_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|3066063_3067002_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487246.1|3067001_3068132_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551949.1|3068499_3069681_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_000389030.1|3069677_3069932_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136827.1|3070086_3070659_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_001091917.1|3070881_3072348_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198839.1|3072465_3073452_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001297918.1|3073490_3074204_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3074615_3075182_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000470599.1|3075362_3076919_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001316494.1|3077000_3078815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501604.1|3078815_3079910_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088901.1|3079909_3080935_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087523469.1|3080936_3082526_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|3082529_3082874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|3083206_3084397_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|3084424_3085120_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|3085269_3087030_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|3087154_3087439_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|3087577_3088585_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|3088766_3088994_+	YejL family protein	NA	NA	NA	NA	NA
WP_087523468.1|3089013_3090774_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001351450.1|3091693_3092896_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_070749868.1|3093998_3094127_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	92.9	7.3e-15
WP_111530668.1|3094181_3097940_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	88.7	0.0e+00
WP_001233090.1|3098004_3098604_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_111530669.1|3098674_3102172_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
WP_000090895.1|3102232_3102865_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|3102801_3103545_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152640.1|3103550_3104249_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000847379.1|3104248_3104578_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|3104574_3107154_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|3107146_3107581_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_111530670.1|3107562_3107985_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_021548555.1|3108000_3108741_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|3108748_3109144_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|3109140_3109719_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|3109730_3110084_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|3110095_3110491_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|3110532_3111558_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|3111613_3111946_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|3111955_3113275_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|3113255_3114857_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3114853_3115060_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|3115056_3116982_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3116956_3117502_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000105084.1|3117890_3118124_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3118180_3118591_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_024205918.1|3118877_3119135_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
WP_024174403.1|3119131_3119455_-	protein KilA	NA	A0A220NRM9	Escherichia_phage	99.1	7.9e-58
WP_001228685.1|3119538_3119724_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000075159.1|3119940_3120438_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_052978305.1|3120437_3120653_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_096956487.1|3120720_3121095_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	93.5	4.4e-60
WP_001310393.1|3121352_3121586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|3121729_3122269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044862710.1|3122483_3123236_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
WP_074527437.1|3123249_3124239_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_087604717.1|3124246_3125044_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.9e-148
WP_040074681.1|3125063_3125453_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_000210155.1|3125449_3125776_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_125316734.1|3125844_3126426_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	100.0	5.7e-115
WP_074527436.1|3126425_3126920_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.2e-86
WP_000104976.1|3126916_3127858_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_001250269.1|3127847_3128027_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515869.1|3128202_3128760_-	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_000205494.1|3128797_3128998_-	cell division protein	NA	NA	NA	NA	NA
WP_000450737.1|3129095_3129722_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000141752.1|3130310_3130556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3130993_3131356_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|3131420_3132245_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_021548838.1|3132372_3132909_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_001242718.1|3132899_3133262_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548839.1|3133258_3133474_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001096409.1|3133535_3133745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741304.1|3133747_3134926_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
>prophage 9
NZ_CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3672227	3685409	4848222		Escherichia_phage(50.0%)	12	NA	NA
WP_039023140.1|3672227_3674789_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|3674894_3675551_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272547.1|3675601_3676399_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000847984.1|3676564_3677473_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590403.1|3677469_3678732_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3678728_3679367_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3679371_3680148_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3680236_3681601_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3681694_3682687_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3682749_3683889_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3684027_3684654_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3684647_3685409_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	0	7647	113340		Wolbachia_phage(50.0%)	6	NA	NA
WP_001079808.1|521_980_+	IncI1-type conjugal transfer lipoprotein TraH	NA	NA	NA	NA	NA
WP_032220737.1|976_1795_+	IncI1-type conjugal transfer lipoprotein TraI	NA	NA	NA	NA	NA
WP_001024972.1|1791_2940_+	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_001299214.1|2936_3227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000014586.1|3241_3793_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	30.5	3.3e-19
WP_033560228.1|3882_7647_+	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	30.1	2.6e-19
>prophage 2
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	22875	67993	113340	transposase,integrase	Enterobacteria_phage(15.79%)	50	60958:61017	76651:77473
WP_001175009.1|22875_23280_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	55.2	6.5e-33
WP_024186316.1|23338_24565_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	99.7	1.0e-193
WP_001291965.1|25406_25658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303307.1|25729_25882_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000121273.1|26173_27382_+	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000151576.1|27400_28471_+	IncI1-type conjugal transfer protein TrbB	NA	NA	NA	NA	NA
WP_001289275.1|28463_30755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006855641.1|30791_33491_-	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
WP_001283947.1|33501_33834_-	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_000157095.1|34067_34403_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001077030.1|34488_35337_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_065793177.1|35916_36168_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000038339.1|36430_37372_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
WP_001247862.1|37436_37703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|37794_38229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117609.1|38957_39458_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000978012.1|39920_40517_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001276261.1|40513_41233_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845897.1|41229_41664_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145453.1|41718_43677_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.6e-20
WP_000006014.1|43735_43969_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001276110.1|44026_44554_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001762494.1|45721_47389_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.8	6.2e-162
WP_001027500.1|47666_47858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271729.1|47854_48277_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072132163.1|48323_48626_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015059345.1|48721_49294_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274403.1|49987_50422_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104887.1|50433_50655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|50655_51339_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_010891263.1|51415_51727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250494.1|51723_52695_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|53043_53292_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|53288_53726_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457492.1|53725_55000_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
WP_001278818.1|55001_55418_-	recombinase	NA	NA	NA	NA	NA
WP_000688514.1|55410_56391_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|56804_57113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|57199_57844_-	ParA family protein	NA	NA	NA	NA	NA
WP_001164198.1|58023_58803_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_000465036.1|58804_59218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|59749_60676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001596999.1|60720_60978_+	hypothetical protein	NA	NA	NA	NA	NA
60958:61017	attL	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067858.1|61011_61716_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|62412_63426_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777555.1|63582_64056_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001206317.1|64148_64940_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|65103_65451_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067858.1|66306_67011_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_021561477.1|67132_67993_+	inhibitor-resistant class A broad-spectrum beta-lactamase TEM-30	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
76651:77473	attR	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 3
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	71956	77409	113340	transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_039026029.1|71956_73171_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
WP_001255015.1|73198_73504_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|73615_75109_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|75139_75391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|75284_75587_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|75673_76489_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067858.1|76704_77409_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 4
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	87908	88757	113340		Vibrio_phage(100.0%)	1	NA	NA
WP_001057996.1|87908_88757_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
>prophage 5
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	92256	92520	113340		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001324596.1|92256_92520_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 6
NZ_CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	109405	110560	113340	integrase	Pseudomonas_phage(100.0%)	1	106609:106621	110754:110766
106609:106621	attL	TTTTTGTCCAGCG	NA	NA	NA	NA
WP_001139955.1|109405_110560_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
WP_001139955.1|109405_110560_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
110754:110766	attR	CGCTGGACAAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	0	5112	33826	integrase	Macacine_betaherpesvirus(100.0%)	6	2778:2789	5643:5654
WP_000654313.1|1056_1461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000577047.1|1596_2124_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000905709.1|2695_2947_-	hypothetical protein	NA	NA	NA	NA	NA
2778:2789	attL	ACAAACAAAACA	NA	NA	NA	NA
WP_001062964.1|2983_3286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516230.1|3451_4111_-	peptidyl-arginine deiminase	NA	NA	NA	NA	NA
WP_001278245.1|4215_5112_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.5	1.0e-22
5643:5654	attR	TGTTTTGTTTGT	NA	NA	NA	NA
>prophage 2
NZ_CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	9773	11612	33826		Klosneuvirus(50.0%)	2	NA	NA
WP_000517489.1|9773_11036_-	AAA family ATPase	NA	A0A1V0SKF8	Klosneuvirus	31.4	3.0e-07
WP_001215681.1|11117_11612_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.2	4.2e-18
>prophage 3
NZ_CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	30429	32266	33826		Aeromonas_phage(50.0%)	3	NA	NA
WP_001025396.1|30429_30945_-	J domain-containing protein	NA	A0A219YC37	Aeromonas_phage	32.2	2.5e-05
WP_000127483.1|31583_31934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147119.1|31930_32266_-	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	44.3	4.4e-11
>prophage 1
NZ_CP029978	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_E, complete sequence	99465	18805	63005	99465	integrase,protease,transposase	Macacine_betaherpesvirus(26.67%)	47	14087:14146	31489:31593
14087:14146	attL	CTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGG	NA	NA	NA	NA
WP_000016970.1|18805_19612_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|20333_21089_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|21676_22843_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|22842_23814_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_064766247.1|24551_25454_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032181561.1|25838_26522_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_001104873.1|26522_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|26757_27192_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001006251.1|27236_28007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001666994.1|28543_28846_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|28892_29315_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_086625070.1|29420_30197_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_000139363.1|30251_30812_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|30945_31158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077779935.1|31458_31626_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
31489:31593	attR	CCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGTGTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCT	NA	NA	NA	NA
WP_001339397.1|31602_32280_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|32279_32627_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_023149734.1|32646_34218_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_072142979.1|34921_35155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|35398_35548_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|35831_36089_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|36324_36399_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|38158_39379_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|39389_40301_+	carbamate kinase	NA	NA	NA	NA	NA
WP_086625071.1|40385_41390_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|41437_42841_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|42921_43401_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080227.1|43757_43979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|44009_44360_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|44356_44719_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032152936.1|45557_46136_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|46548_46902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|47373_48396_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|48800_49058_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|49292_49367_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032152935.1|49359_50217_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|51155_51809_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|51901_52159_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|52091_52493_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|52629_55527_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|55621_56227_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|57003_57396_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|57533_58418_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|58449_59649_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|59754_60405_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|60436_60679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|62300_63005_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
