The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	1582469	1594030	4498956	tRNA	Escherichia_phage(62.5%)	10	NA	NA
WP_096387058.1|1582469_1583813_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	4.8e-80
WP_025800951.1|1583921_1585214_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
WP_043492488.1|1585697_1588142_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-213
WP_025800953.1|1588152_1588773_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_111329269.1|1588774_1589635_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.7	2.1e-25
WP_111329270.1|1589748_1590363_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.7	3.5e-30
WP_111329271.1|1590362_1590950_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	38.0	6.6e-26
WP_043492326.1|1591066_1592206_+	MFS transporter	NA	NA	NA	NA	NA
WP_025800958.1|1592281_1592737_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025800959.1|1593289_1594030_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 2
NZ_CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	1664342	1742909	4498956	protease,plate	uncultured_Caudovirales_phage(50.0%)	59	NA	NA
WP_111330821.1|1664342_1665920_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025801009.1|1666296_1666755_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_025801010.1|1666874_1667930_-	porin OmpA	NA	NA	NA	NA	NA
WP_025801011.1|1668287_1668797_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_025801012.1|1669018_1669642_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_111329289.1|1669728_1671864_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_025801014.1|1671875_1672322_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_111329290.1|1672532_1674587_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	7.2e-19
WP_043492573.1|1674631_1675090_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_040045936.1|1675194_1675704_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_025801018.1|1675905_1676322_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_025801019.1|1676376_1676697_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_040045938.1|1676854_1678048_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_043492578.1|1678156_1678435_+	acylphosphatase	NA	NA	NA	NA	NA
WP_025801022.1|1678435_1678765_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_008813056.1|1678950_1679613_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.1	8.1e-41
WP_111330823.1|1680082_1680400_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_162622594.1|1680768_1690488_+	DUF4573 domain-containing protein	NA	NA	NA	NA	NA
WP_111329292.1|1690650_1691646_-	glutaminase A	NA	NA	NA	NA	NA
WP_046450052.1|1693331_1693649_-	DUF4387 domain-containing protein	NA	NA	NA	NA	NA
WP_025802701.1|1693645_1695019_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_025802703.1|1695020_1696265_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_025802707.1|1696264_1697710_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_096387146.1|1697724_1699116_-	glutamate mutase	NA	NA	NA	NA	NA
WP_111329293.1|1699112_1699559_-	methylaspartate mutase subunit S	NA	NA	NA	NA	NA
WP_043492615.1|1700161_1701022_-	GHMP kinase	NA	NA	NA	NA	NA
WP_111329294.1|1701108_1701891_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_111329295.1|1702642_1704178_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_111329296.1|1704203_1704962_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_111329297.1|1704984_1706049_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025802722.1|1706081_1707005_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111329298.1|1707166_1708813_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_111329299.1|1708830_1709421_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_043492645.1|1709985_1710630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025802730.1|1711599_1712100_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038502127.1|1712125_1713679_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_096387169.1|1713697_1715047_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025802736.1|1715043_1715703_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_111329300.1|1715715_1717425_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025802740.1|1717512_1718004_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_111329301.1|1718211_1720977_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.2e-92
WP_111329302.1|1720970_1723367_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.6	1.7e-19
WP_162622595.1|1723380_1724142_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_111329304.1|1724176_1724677_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_111329305.1|1724757_1725267_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_111329306.1|1725348_1725855_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_111329307.1|1725842_1728182_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_046457902.1|1728191_1728449_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_111329308.1|1728445_1729576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111329309.1|1729562_1732940_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_111329310.1|1733246_1734218_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_111329311.1|1734240_1735209_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_111329312.1|1735221_1735743_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_111329313.1|1736241_1737288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061554280.1|1737456_1739049_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_111329314.1|1739126_1740890_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_111329315.1|1740853_1741939_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_096387213.1|1741919_1742468_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043492680.1|1742471_1742909_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	1750243	1797003	4498956	plate,coat,holin,terminase,head,tail,integrase,capsid,lysis	Escherichia_phage(41.94%)	51	1755600:1755614	1805713:1805727
WP_111329319.1|1750243_1751224_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_111330825.1|1751225_1753586_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_111329320.1|1753654_1754416_-	molecular chaperone	NA	NA	NA	NA	NA
WP_051874120.1|1754431_1754968_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025801660.1|1754974_1755544_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
1755600:1755614	attL	AAATGCGCAAAGAAA	NA	NA	NA	NA
WP_096387225.1|1756157_1756823_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_025801662.1|1757217_1757436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111329321.1|1757538_1757985_-	VOC family protein	NA	NA	NA	NA	NA
WP_025801664.1|1758678_1758939_-	DUF2545 family protein	NA	NA	NA	NA	NA
WP_025801665.1|1759057_1759402_-	GlpM family protein	NA	NA	NA	NA	NA
WP_004094789.1|1759530_1759755_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_025801666.1|1760364_1761021_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_043492707.1|1761013_1762846_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_025801668.1|1762903_1763452_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_111329322.1|1764165_1764384_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	70.8	4.1e-26
WP_111329323.1|1764505_1765669_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	74.7	6.6e-155
WP_111329324.1|1765665_1766151_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.1	7.3e-47
WP_111329325.1|1766163_1768608_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	61.8	9.1e-239
WP_111329326.1|1768597_1768732_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	73.7	9.6e-10
WP_111329327.1|1768764_1769073_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	6.0e-31
WP_111329328.1|1769132_1769651_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	2.2e-78
WP_111329329.1|1769664_1770852_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.8	2.3e-187
WP_162622596.1|1770990_1771527_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	43.5	3.3e-32
WP_162622621.1|1771538_1772486_-	hypothetical protein	NA	A0A0A0RVQ0	Citrobacter_phage	34.9	2.2e-07
WP_111329332.1|1773390_1773951_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	79.4	1.8e-81
WP_111329333.1|1773943_1774852_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	78.5	2.3e-126
WP_111329334.1|1774855_1775203_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	70.2	1.5e-38
WP_111329335.1|1775199_1775838_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.0	5.8e-68
WP_162622597.1|1776271_1777615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111329337.1|1777715_1778162_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	7.1e-49
WP_111329338.1|1778154_1778622_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	69.7	9.7e-57
WP_111329339.1|1778717_1779143_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	42.3	2.3e-20
WP_111329340.1|1779139_1779640_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	77.2	7.4e-71
WP_111329341.1|1779639_1779936_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	76.1	1.4e-29
WP_111329342.1|1779939_1780143_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	74.6	5.7e-22
WP_111329343.1|1780142_1780628_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	61.3	2.3e-53
WP_111329344.1|1780720_1781377_-|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	67.3	2.7e-73
WP_111329345.1|1781379_1782453_-|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	70.9	4.5e-150
WP_111329346.1|1782499_1783345_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	62.1	2.2e-91
WP_095661471.1|1783487_1785257_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	79.5	1.3e-279
WP_111329347.1|1786184_1786409_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_162622598.1|1786833_1787955_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_046457853.1|1788134_1788320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111329349.1|1788439_1790719_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.6	1.8e-260
WP_111329350.1|1790715_1790934_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	53.5	7.6e-12
WP_111329351.1|1791003_1791513_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	54.5	1.9e-45
WP_111330827.1|1791694_1792213_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	42.1	2.6e-26
WP_111329352.1|1792588_1793152_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	39.4	1.7e-26
WP_111329353.1|1793160_1795266_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_111329354.1|1795265_1795952_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_111329355.1|1795998_1797003_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	61.1	1.7e-111
1805713:1805727	attR	AAATGCGCAAAGAAA	NA	NA	NA	NA
>prophage 4
NZ_CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	2149708	2163608	4498956	tRNA	Tupanvirus(33.33%)	14	NA	NA
WP_025801264.1|2149708_2151646_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.6e-129
WP_025801265.1|2151641_2152184_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
WP_025801266.1|2152282_2152480_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004089950.1|2152522_2152879_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_121626058.1|2153009_2153054_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_025801267.1|2153345_2154329_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.7e-34
WP_111329443.1|2154343_2156731_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	6.6e-08
WP_004089944.1|2156735_2157032_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_025801269.1|2157115_2157313_+	protein DsrB	NA	NA	NA	NA	NA
WP_111329445.1|2157371_2158397_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_111330852.1|2158399_2159185_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.3	7.5e-09
WP_025801272.1|2159468_2160617_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.8	1.2e-23
WP_046449407.1|2160609_2161626_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.9	1.5e-38
WP_111329447.1|2161625_2163608_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
>prophage 5
NZ_CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	3278370	3296627	4498956	tRNA,integrase	Cronobacter_phage(40.0%)	18	3282809:3282832	3296671:3296694
WP_025800033.1|3278370_3279342_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
WP_071842638.1|3279352_3281209_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004096758.1|3281236_3281569_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.2	3.4e-11
WP_025800036.1|3281670_3282798_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.5	2.9e-91
3282809:3282832	attL	CAGCATCAGAAAAACAGTCTGATG	NA	NA	NA	NA
WP_111330256.1|3283009_3283387_-	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	48.0	2.1e-25
WP_111330258.1|3283628_3283994_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	67.5	4.9e-40
WP_111330260.1|3283990_3284911_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	85.9	2.3e-150
WP_111330262.1|3284907_3286368_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	28.3	1.0e-35
WP_162622607.1|3286404_3288489_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	64.7	6.7e-49
WP_111330264.1|3288545_3291011_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	54.7	8.8e-266
WP_111330266.1|3290958_3291390_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	64.8	5.1e-44
WP_162622608.1|3291802_3292048_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	55.0	2.1e-18
WP_111330270.1|3293160_3293511_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	52.5	2.6e-22
WP_111330272.1|3293512_3293734_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	78.5	5.3e-21
WP_111330274.1|3293777_3294098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111330276.1|3294618_3295161_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	67.9	2.0e-61
WP_111330278.1|3295162_3295381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111330280.1|3295580_3296627_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	36.9	4.4e-57
3296671:3296694	attR	CAGCATCAGAAAAACAGTCTGATG	NA	NA	NA	NA
