The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	994821	1008004	4423666		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|994821_995583_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|995576_996203_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|996342_997482_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|997544_998537_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|998630_999995_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1000083_1000860_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1000864_1001503_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1001499_1002762_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1002758_1003667_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272546.1|1003832_1004630_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141323.1|1004680_1005337_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
WP_110991403.1|1005442_1008004_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.3e-30
>prophage 2
NZ_CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	1599560	1609002	4423666		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569316.1|1599560_1600487_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1600491_1601223_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1601203_1601311_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1601370_1602102_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1602323_1604009_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1604005_1604725_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1604771_1605242_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1605282_1605744_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1605868_1607869_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1607865_1609002_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	1699790	1706084	4423666		Enterobacteria_phage(50.0%)	6	NA	NA
WP_042200028.1|1699790_1701185_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	3.7e-19
WP_000183032.1|1701359_1702253_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_042200026.1|1702625_1703711_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.0e-102
WP_042200024.1|1703710_1704610_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	3.7e-28
WP_042200022.1|1704667_1705546_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_042200020.1|1705550_1706084_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	4.1e-51
>prophage 4
NZ_CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	2346474	2361290	4423666	lysis	Escherichia_phage(40.0%)	20	NA	NA
WP_000837924.1|2346474_2347608_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2347748_2348183_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|2348447_2348621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2348960_2349074_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2349142_2349376_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000089447.1|2350850_2351945_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000126788.1|2351948_2352158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2352135_2353068_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_110991472.1|2353060_2353852_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	1.3e-48
WP_001097895.1|2353989_2355447_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2355643_2355829_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_110991473.1|2356045_2356543_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_000839565.1|2356542_2356758_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2357009_2357384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2357555_2357984_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2359028_2359571_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|2359567_2359858_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|2359857_2360457_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000882656.1|2360925_2361138_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
WP_122056959.1|2361182_2361290_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
>prophage 5
NZ_CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	2947109	2993225	4423666	head,integrase,capsid,lysis,protease,portal,terminase,tail	Enterobacteria_phage(54.1%)	64	2957212:2957227	3002195:3002210
WP_000586336.1|2947109_2948441_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001657981.1|2948514_2949099_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_110991500.1|2949098_2952581_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_110991501.1|2952645_2953245_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	1.4e-108
WP_110991502.1|2953311_2956794_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
WP_000090892.1|2956854_2957487_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
2957212:2957227	attL	AATCTGGAATACGCCA	NA	NA	NA	NA
WP_000194783.1|2957423_2958167_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|2958172_2958871_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|2958870_2959200_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001774776.1|2959196_2961776_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000459457.1|2961768_2962203_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|2962184_2962607_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001361512.1|2962622_2963363_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000683129.1|2963370_2963766_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|2963762_2964341_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|2964352_2964706_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|2964717_2965113_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|2965154_2966180_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|2966235_2966568_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_110991503.1|2966577_2967897_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
WP_001316285.1|2967877_2969479_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000198149.1|2969475_2969682_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_110991504.1|2969678_2971604_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|2971578_2972124_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001663509.1|2972512_2972746_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_001537735.1|2972805_2973216_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001059339.1|2973518_2974043_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_110991505.1|2974245_2974398_-	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	3.1e-20
WP_110991506.1|2974394_2974853_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.8	9.8e-70
WP_001135281.1|2974849_2975347_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|2975346_2975562_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|2976151_2977234_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|2977422_2977806_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|2977891_2978032_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001540841.1|2978028_2978391_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000950954.1|2978410_2978605_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2978597_2978939_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|2978941_2979118_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|2979114_2979642_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|2979638_2980079_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|2980152_2980443_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|2980439_2981141_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_001540839.1|2981137_2982037_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	6.5e-174
WP_001177650.1|2982071_2982350_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|2982458_2982644_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|2982724_2983375_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|2983687_2983960_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|2983976_2984558_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065374.1|2984818_2985187_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|2985259_2985424_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2985392_2985536_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|2985610_2985907_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|2985912_2986698_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186851.1|2986694_2987375_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_110991507.1|2987371_2987530_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.2	2.6e-22
WP_001001031.1|2987526_2988771_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	34.0	7.1e-46
WP_000205067.1|2988782_2989385_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_110991508.1|2989381_2989960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|2990329_2990551_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_044803963.1|2990547_2990919_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	91.4	9.2e-34
WP_000103023.1|2990915_2991569_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	48.5	4.8e-62
WP_001277770.1|2991665_2991845_+	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_001303849.1|2991958_2992177_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533645.1|2992154_2993225_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3002195:3002210	attR	AATCTGGAATACGCCA	NA	NA	NA	NA
>prophage 1
NZ_CP029493	Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence	179444	16	61800	179444	transposase,integrase	Escherichia_phage(35.14%)	53	10669:10683	62813:62827
WP_001113742.1|16_901_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_089613810.1|1193_2003_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	1.3e-154
WP_001285362.1|2171_3368_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|3384_4386_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_000067710.1|4611_6318_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_089613812.1|6377_7967_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	4.9e-302
WP_104730529.1|7976_8792_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	97.0	3.9e-109
WP_000035250.1|8827_9409_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
WP_000509940.1|9420_9930_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
10669:10683	attL	GTTCACTGGCGAGGA	NA	NA	NA	NA
WP_001352007.1|11395_11551_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_104730522.1|11948_12287_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	1.6e-32
WP_104730523.1|12311_12650_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	87.8	9.6e-38
WP_104730524.1|12652_13866_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
WP_001776124.1|14693_15119_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_001776125.1|15118_16390_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	1.0e-153
WP_049239040.1|16706_17915_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.8	1.7e-190
WP_001698877.1|19138_20110_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
WP_000523812.1|20109_21276_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200069.1|22016_23027_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
WP_001067855.1|23671_24376_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|24968_25874_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|27107_27692_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064145616.1|28096_28789_-	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
WP_042881802.1|28896_29115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078207745.1|29197_29575_+	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
WP_001389365.1|29546_30311_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_104769218.1|31620_34608_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	1.1e-294
WP_001282381.1|35056_35506_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001235773.1|35517_37842_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.2	6.0e-38
WP_001243650.1|37861_38107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000689410.1|38521_38992_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	2.8e-19
WP_000480972.1|39119_39956_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|39955_40759_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|40819_41635_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067858.1|42566_43271_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|45926_46631_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001206356.1|46835_47627_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|47632_47923_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|48034_48532_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|48936_49641_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|49830_50646_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|50796_51501_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|51731_52595_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|52632_52878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|53346_54138_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|54140_54416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|55317_55650_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|55819_56611_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|56703_57963_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|58224_59016_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|59073_59682_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|59777_60620_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|60786_61800_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
62813:62827	attR	GTTCACTGGCGAGGA	NA	NA	NA	NA
>prophage 2
NZ_CP029493	Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence	179444	68996	141859	179444	transposase,integrase	Escherichia_phage(45.95%)	57	68159:68218	119370:120120
68159:68218	attL	CTACACCGACACGGCCGGCTTCACCGATCACGTCTTTGCCCTGATGCACCTGCTAGGCTT	NA	NA	NA	NA
WP_000227969.1|68996_70073_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000754566.1|71415_71832_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|71828_72059_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|72854_73559_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_054528934.1|74966_75995_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.4	2.2e-61
WP_077250684.1|76957_77926_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
WP_001039464.1|78506_78893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020956880.1|79032_80001_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.9e-179
WP_072196731.1|82231_82357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|83509_84723_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001310555.1|85654_86671_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000133023.1|88004_88727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071636.1|88723_89209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478345.1|89863_90838_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_039003037.1|90927_91650_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_049589868.1|91721_93347_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_012478345.1|93542_94517_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_104730531.1|94984_95515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077478202.1|96642_97689_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000543166.1|97678_98128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104769191.1|99859_103375_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
WP_000896262.1|103744_103945_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_000222771.1|104234_104522_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_001139206.1|104518_104770_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001470165.1|104856_105024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104730517.1|105381_109320_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.2	0.0e+00
WP_023352064.1|109353_109794_+	hypothetical protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
WP_000747846.1|109790_110039_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_104730518.1|111033_111684_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001514450.1|111776_112421_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
WP_104730519.1|112609_113170_-	Ref family protein	NA	Q71TG3	Escherichia_phage	98.9	1.0e-100
WP_038989442.1|113419_113731_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
WP_089613821.1|113781_114813_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	3.2e-193
WP_042630942.1|114820_115042_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	5.8e-36
WP_000874156.1|115646_115856_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611661.1|115966_116818_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
WP_001351993.1|116850_117162_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
WP_069067567.1|117464_118508_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
WP_001067858.1|120827_121532_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
119370:120120	attR	AAGCCTAGCAGGTGCATCAGGGCAAAGACGTGATCGGTGAAGCCGGCCGTGTCGGTGTAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAACGTTTTCTGCCTCTGACGCCTCTTTTAATGGTCTCAGATGTCCTTTGGTCACCAGTTCTGCCAGCGTGAAGGAATAATGGCCGAGCATATTGATATGTCCGTGGCAAAGCGGGGAGAGGCGTGCGATATCTTCATCATTCAGTGTTTCACCCTGCGCCCGGAGATGATCCAGGGCTGCCTGCATATAAATAGTGTTCCATAACACGACGGCGTTAGTGACCAGCCCCAGTGTGCCCAGTTGATCTTCCTGACCGTCGGTATATCGTTTTCTTATCTCACCTTTTTGACCGTGACAGATGGCTCTGGCAACGGCATGGCGACTTTCTCCCCGATTAAGCTGGGTCAGAATGCGCCGGCGGTAATCTTCATCATCAATATAATTAAGCAGATACAGCGTTTTGTTGATGCGCCCCACTTCAATGATTGCCTGAGTCAGTCCGGAAGGACGTTCACTTTTCAGCAATGAACGGACCAGCACTGAAACCTGTACTTTGCCCAGCTTCAGGGAGCCAGCGGTCCGGATCATTTCGTCCCACTGAAGGACTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTG	NA	NA	NA	NA
WP_110991584.1|122499_123714_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
WP_001255015.1|123741_124047_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|124158_125652_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_088813962.1|125682_125928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|125939_126644_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|127261_128122_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_074139093.1|129118_130585_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	98.6	3.6e-73
WP_001216039.1|130820_131201_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
WP_001190711.1|131200_131422_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
WP_069067570.1|132799_134062_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
WP_104730539.1|134363_135065_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	2.8e-140
WP_000484116.1|135735_136362_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_012817939.1|136259_136922_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_001567997.1|136863_137019_-	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
WP_001547737.1|137471_137822_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_110991585.1|137741_138893_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.6e-42
WP_000578338.1|139654_140389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087902421.1|140585_141859_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.1e-170
