The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	956377	1014830	4995456	protease,tRNA,head,tail,holin,integrase,lysis,capsid,terminase,portal	Enterobacteria_phage(48.21%)	76	966528:966574	1015253:1015299
WP_000912345.1|956377_957763_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143508.1|957798_958320_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|958427_958640_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|958641_959508_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|959979_960522_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|960740_961433_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001361257.1|961463_964073_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|964085_965093_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|965103_965619_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|965621_966254_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
966528:966574	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_061092788.1|966587_967751_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
WP_000446905.1|967606_967978_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|967949_968228_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|968275_968494_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|968592_968874_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032255841.1|968884_969442_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_045173744.1|969438_969597_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_024228451.1|969593_970274_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_052953584.1|970270_971056_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995439.1|971061_971358_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_061092790.1|971433_971640_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_061092791.1|972195_972513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092792.1|972644_972914_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_061092793.1|972994_973750_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	4.7e-93
WP_001067459.1|973788_974019_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_061092794.1|974100_974640_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_061092802.1|974726_975656_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	4.7e-111
WP_001566186.1|975652_976354_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_000145912.1|976350_976653_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001070442.1|976720_977053_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|977144_977252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|977309_978836_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|978947_979265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|979469_980399_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|980497_980599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|980595_981051_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|981050_981221_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|981213_981504_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|981500_981863_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_032139865.1|981859_982000_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001205470.1|982084_982441_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|982420_983635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|983637_984813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120496.1|985104_985431_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001518397.1|985434_985911_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001228695.1|986127_986310_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|986400_986694_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|987056_987251_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453566.1|987639_988185_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001518400.1|988159_990085_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|990081_990288_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518401.1|990284_991886_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_001518402.1|991866_993186_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001299443.1|993195_993528_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063252.1|993583_994609_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001518405.1|994650_995049_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000752994.1|995060_995414_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001518407.1|995425_996004_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683145.1|996000_996396_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518408.1|996403_997144_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_001518409.1|997159_997582_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518410.1|997608_997998_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001567091.1|997990_1000552_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_000847401.1|1000548_1000878_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001518412.1|1000877_1001576_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_024177847.1|1001580_1002324_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|1002260_1002863_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_061092795.1|1002923_1006403_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228252.1|1006470_1007070_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092796.1|1007134_1009507_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_061092797.1|1009506_1009788_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_000235975.1|1009797_1010502_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_016245272.1|1010512_1010806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|1010998_1011667_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|1012205_1013690_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061092798.1|1013876_1014830_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
1015253:1015299	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1369640	1379082	4995456		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569365.1|1369640_1370567_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783133.1|1370571_1371303_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1371283_1371391_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1371450_1372182_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1372403_1374089_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001308766.1|1374085_1374805_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001361590.1|1374851_1375322_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001296231.1|1375362_1375824_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361589.1|1375948_1377949_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001292746.1|1377945_1379082_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 3
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1491225	1502483	4995456		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
WP_000026026.1|1491225_1492242_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
WP_000699784.1|1492310_1493318_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000335121.1|1493328_1494450_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000163129.1|1494453_1495419_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_001042472.1|1495421_1495877_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001361571.1|1495888_1497274_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_000868618.1|1497357_1498104_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_000736848.1|1498128_1499499_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000043484.1|1499662_1501069_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|1501316_1502483_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 4
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1549615	1588852	4995456	plate,transposase,integrase	uncultured_Caudovirales_phage(44.44%)	29	1543124:1543183	1560436:1560517
1543124:1543183	attL	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCT	NA	NA	NA	NA
WP_061092889.1|1549615_1549870_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-15
WP_157930104.1|1549866_1550478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061092891.1|1550940_1551276_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_085949836.1|1551279_1552493_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077252459.1|1552640_1556729_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
WP_061093069.1|1556739_1557081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249107.1|1557125_1557839_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
WP_052895708.1|1557841_1558135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016248851.1|1558257_1558566_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_021550960.1|1558569_1558887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
WP_072693178.1|1559010_1560273_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
WP_061093028.1|1560839_1561757_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
1560436:1560517	attR	AATTTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAAT	NA	NA	NA	NA
WP_001011018.1|1561858_1562809_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_061093029.1|1566876_1567710_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	43.3	3.0e-24
WP_061093030.1|1567879_1569016_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115314324.1|1569123_1569498_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_061093031.1|1569643_1570201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061102077.1|1570213_1571746_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.0	4.0e-22
WP_061093078.1|1571969_1572497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093033.1|1574249_1574543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249119.1|1574562_1578981_-	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	6.0e-23
WP_061093034.1|1578983_1580165_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_061093035.1|1580175_1582164_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016159310.1|1582377_1582896_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093036.1|1583578_1584085_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_061093037.1|1584104_1585589_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061093038.1|1585591_1586014_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_061093039.1|1586018_1587842_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061093053.1|1587808_1588852_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	2928626	2941554	4995456	integrase	Escherichia_phage(83.33%)	6	2934129:2934142	2942599:2942612
WP_000368135.1|2928626_2929559_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_000100042.1|2930146_2930677_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
WP_001361862.1|2930724_2938644_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
2934129:2934142	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_000243052.1|2938668_2939289_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001181154.1|2939606_2940236_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224627.1|2940984_2941554_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
2942599:2942612	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 6
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	3318434	3408643	4995456	tRNA,tail,plate,integrase,transposase,capsid	Burkholderia_virus(37.5%)	101	3357145:3357160	3405974:3405989
WP_000568908.1|3318434_3319484_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001219237.1|3319480_3319960_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000246153.1|3319959_3320670_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000517476.1|3320688_3321000_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_001246103.1|3321193_3321517_-	DUF3561 family protein	NA	NA	NA	NA	NA
WP_001173673.1|3321566_3322172_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090363.1|3322171_3323599_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_000372392.1|3323600_3324509_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_000490426.1|3324760_3325798_+	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_000956458.1|3325923_3326076_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000039852.1|3326340_3327075_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_001290706.1|3327148_3328861_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_000211339.1|3328860_3330660_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000987944.1|3330975_3331341_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_001361312.1|3331418_3332690_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000109536.1|3332680_3332941_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001130256.1|3332957_3333533_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_001361313.1|3333679_3334540_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_001361314.1|3334536_3335316_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_000218268.1|3335293_3336703_-	MFS transporter	NA	NA	NA	NA	NA
WP_000059294.1|3336724_3338179_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_001361315.1|3338248_3339034_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.1e-20
WP_001164562.1|3339351_3340629_+	MFS transporter	NA	NA	NA	NA	NA
WP_000039729.1|3340655_3342134_+	sugar kinase	NA	NA	NA	NA	NA
WP_001276284.1|3342298_3343216_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000277206.1|3343386_3344904_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_061092716.1|3344964_3346335_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_032245922.1|3346334_3347744_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	5.6e-15
WP_001232705.1|3347769_3348777_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001199974.1|3348861_3349533_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_000944228.1|3349705_3350308_+	LemA family protein	NA	NA	NA	NA	NA
WP_001243483.1|3350321_3351215_+	YgcG family protein	NA	NA	NA	NA	NA
WP_001217974.1|3351229_3352378_+	YgcG family protein	NA	NA	NA	NA	NA
WP_089075444.1|3352383_3353256_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3353315_3354614_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3354700_3356338_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_001071641.1|3356565_3357357_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
3357145:3357160	attL	TTGCGCGTAAAACACC	NA	NA	NA	NA
WP_000254738.1|3357428_3357764_-	endoribonuclease MazF	NA	NA	NA	NA	NA
WP_000581940.1|3357763_3358012_-	type II toxin-antitoxin system antitoxin MazE	NA	NA	NA	NA	NA
WP_000226815.1|3358089_3360324_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_000046818.1|3360371_3361673_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
WP_000186450.1|3361729_3364486_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000904922.1|3364888_3365461_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001529038.1|3365532_3366006_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_001529037.1|3366012_3366627_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_096976434.1|3366626_3368558_-	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.4	9.0e-40
WP_000138756.1|3368560_3369139_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|3369131_3370235_-	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859116.1|3370225_3370573_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|3370627_3371224_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001529032.1|3371220_3372393_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_012602373.1|3372380_3372596_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|3372592_3373477_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_001529030.1|3373476_3376689_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_001202894.1|3376764_3376923_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|3376846_3377182_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|3377279_3377561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|3377563_3378085_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|3378084_3379512_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|3379501_3379756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021539012.1|3379752_3380217_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	1.3e-37
WP_000271668.1|3380216_3380663_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|3380664_3381003_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|3381012_3381966_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|3381980_3383096_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|3383310_3383769_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|3383771_3384593_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_021512536.1|3384573_3386070_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
WP_000137893.1|3386069_3387593_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_000533684.1|3387589_3388132_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|3388134_3388446_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|3388445_3388772_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000270138.1|3388768_3389422_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	31.9	4.3e-10
WP_001104438.1|3389408_3390146_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|3390148_3390499_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|3390629_3391373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|3391348_3391753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|3391751_3391967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110826422.1|3392158_3392923_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_029490538.1|3393041_3393407_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021518100.1|3393495_3393684_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
WP_029490537.1|3393737_3394046_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_106631226.1|3394056_3394974_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.0	2.4e-75
WP_061092904.1|3394973_3395291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110826423.1|3395306_3397076_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.6	3.1e-228
WP_000960680.1|3397086_3398253_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843446.1|3398255_3398525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|3398552_3399083_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_042203510.1|3399371_3399644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|3399653_3399959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|3399955_3400639_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000631814.1|3400635_3400866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|3400855_3401071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988473.1|3401060_3401513_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|3401484_3401883_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_001571573.1|3401997_3402630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110826424.1|3402978_3404244_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000211776.1|3404264_3405605_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	9.1e-07
WP_000097082.1|3405606_3406959_-	galactarate/glucarate/glycerate transporter GudP	NA	NA	NA	NA	NA
3405974:3405989	attR	GGTGTTTTACGCGCAA	NA	NA	NA	NA
WP_000807747.1|3407393_3407843_-	flavodoxin	NA	NA	NA	NA	NA
WP_000889991.1|3407860_3408643_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	4414792	4419446	4995456	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_061092936.1|4414792_4415599_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
WP_061092935.1|4415614_4416253_-	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
WP_061092934.1|4416249_4417512_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
WP_096427327.1|4418168_4418372_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
WP_001339397.1|4418421_4419099_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4419098_4419446_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 8
NZ_CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	4920907	4937399	4995456	plate,tail	Burkholderia_phage(35.29%)	21	NA	NA
WP_061092773.1|4920907_4921699_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_061092772.1|4921713_4922169_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092771.1|4922165_4922873_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_000135569.1|4922869_4924450_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_000359520.1|4924452_4925169_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000951744.1|4925161_4926277_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_001093498.1|4926267_4926627_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000679401.1|4926725_4927427_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001361462.1|4927436_4928477_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_001269711.1|4928464_4928674_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_000271436.1|4928673_4929627_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_015674804.1|4932103_4932232_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658214.1|4932191_4932509_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|4932559_4933084_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_000729835.1|4933083_4934508_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
WP_000875310.1|4934497_4934695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404767.1|4934691_4935147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4935291_4935606_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4935618_4936224_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000758131.1|4936226_4936514_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
WP_000619864.1|4937051_4937399_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
>prophage 1
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	0	27867	276880	transposase,integrase	Escherichia_phage(33.33%)	25	13316:13375	17281:18101
WP_001067855.1|228_933_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|2570_2813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|2844_3495_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_077248803.1|3600_4800_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|4831_5716_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|5853_6246_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000844627.1|8058_8301_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|8332_8983_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_077248803.1|9088_10288_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|10319_11204_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|11341_11734_-	cysteine hydrolase	NA	NA	NA	NA	NA
13316:13375	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|13368_14073_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|14870_15884_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|16039_16513_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|16582_17287_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072794601.1|17657_20624_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
17281:18101	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGGCGTACGCATCGAGTTCCTTAAGGAGCATTTGACCTTCACCGGCGAGGACTCGCCGATGGCGAACCTGATGCTGTCGGTAATGGGCGCGTTCGCCGAGTTCGAACGCGCCTTGATCCGCGAGCGGCAGCGCGAGGGCATCGCGCTCGCCAAGCAGCGCGGGGCCTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTGGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCAATCCTGTCCGCCGCCGAGCGCGAAAGCCTGCTGGCGTTGCCGGACACCAAGGATGAGTTGATCCGTCACTACACGTTCAGCGAAACCGACCTCTCCATCATCCGGCAGCGGCGCGGCCCGGCCAACCGGCTGGGCTTCGCCGTGCAGCTCTGTTACCTGCGCTTTCCTGGTGTCATCCTGGGCGTCGATGAGCCGCCGTTTCCGCCCTTGTTGAAACTGGTCGCCGACCAGCTCAAGGTCAGCGTCGAAAGCTGGGACGAATACGGGCAGCGGGAGCAGACCCGGCGCGAGCACCTGGTCGAACTGCAAACGGTGTTCGGCTTCCAGCCCTTTACCATGGGCCACTACCGGCAGGCCGTCCAGTTGCTGACCGAGATGGCCTTGCAGACCGACAAGGGCATCGTGCTGGCCAGCACCTTGATCGAGCAC	NA	NA	NA	NA
WP_000427619.1|20702_21707_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|21888_22065_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_110826437.1|22394_23210_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.2	1.3e-08
WP_001082320.1|23270_24074_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|24073_24910_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|25140_26001_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|26183_26741_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_020219413.1|26904_27045_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	93.8	1.3e-09
WP_001067855.1|27162_27867_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	41089	42094	276880		Aeromonas_phage(100.0%)	1	NA	NA
WP_032192066.1|41089_42094_+	ParB N-terminal domain-containing protein	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 3
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	45199	46237	276880		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000818955.1|45199_46237_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 4
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	60920	62705	276880		Bacillus_phage(100.0%)	1	NA	NA
WP_042634277.1|60920_62705_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.7	3.5e-22
>prophage 5
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	82142	127688	276880	transposase,protease,integrase	Escherichia_phage(23.08%)	47	77091:77104	89608:89621
77091:77104	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|82142_83117_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|83312_84938_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_039003037.1|85009_85732_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001424615.1|85898_86102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|86123_87299_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|87469_87682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|88042_89125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|89291_90791_-	kinase	NA	NA	NA	NA	NA
89608:89621	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|90816_92454_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|92453_93494_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|93579_94218_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|94217_94859_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|94881_95520_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|95982_96450_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|96467_97676_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|97686_98643_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|98642_99722_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|99723_100497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|100489_101632_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|101641_102700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|103023_103605_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|103604_104762_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|104784_105240_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|105262_106303_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|106351_106930_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|106997_107573_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|108001_109243_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|109805_110087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|110136_110328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|110419_110791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|111133_111526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|112129_112423_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|112427_113753_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|113813_114020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|114121_114532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|114544_115360_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|115613_116039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|116587_116896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|116911_117769_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_152921942.1|118617_119085_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	4.9e-08
WP_063120614.1|119742_120876_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|120981_121305_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|121847_122552_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|122581_123286_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_000427623.1|123858_124863_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000105383.1|125280_126717_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067855.1|126983_127688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	131026	188513	276880	transposase,protease,tRNA	Escherichia_phage(43.75%)	56	NA	NA
WP_001389365.1|131026_131791_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067858.1|131958_132663_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000490638.1|132980_133646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|133703_134084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|134726_135545_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|135541_136747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|137026_138346_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|138596_140024_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|140238_140754_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|140756_141653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|141874_142108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|142769_143000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|143336_143798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|143827_144235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|144285_144603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|144979_145330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|147019_147724_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071448054.1|147729_148476_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|148475_148994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|148998_149415_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001617865.1|150026_150902_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014342101.1|150881_151004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|151204_151909_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|152022_152799_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|153027_154053_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|154474_155227_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|157037_157523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|157719_158810_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_110826437.1|158899_159715_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.2	1.3e-08
WP_000251875.1|159801_160104_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|159997_160249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|160279_161773_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|161884_162190_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|162217_163432_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|163648_164533_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_015344975.1|164563_166057_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|166168_166474_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|166501_167716_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|167932_168817_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|169418_170123_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|172546_173251_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|174561_174963_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|174895_175153_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|175245_175899_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000774297.1|176837_177695_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001324615.1|177687_178182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|178162_178237_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|178468_178726_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|179009_179159_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|179839_180052_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139315.1|180187_180748_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704513.1|180850_181711_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205749.1|181769_182516_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000986962.1|182535_187806_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|187887_188115_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|188114_188513_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	206869	207091	276880		Vibrio_virus(100.0%)	1	NA	NA
WP_001278689.1|206869_207091_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 8
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	215191	216013	276880		Yersinia_phage(100.0%)	1	NA	NA
WP_001234469.1|215191_216013_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
>prophage 9
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	219509	223557	276880		Macacine_betaherpesvirus(66.67%)	4	NA	NA
WP_000290840.1|219509_220049_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032193435.1|220282_220492_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_000817028.1|221419_222391_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|222390_223557_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
>prophage 10
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	234718	238877	276880		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_001318207.1|234718_235099_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|236341_237199_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|237195_238053_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|238049_238877_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
>prophage 11
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	242772	258483	276880	transposase,protease,integrase,bacteriocin	Macacine_betaherpesvirus(40.0%)	15	231966:231982	262832:262848
231966:231982	attL	TTTCACGCAGGGAAAAC	NA	NA	NA	NA
WP_000361611.1|242772_243750_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|244034_244775_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|244895_245084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|245457_246366_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|246428_247538_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|247970_248924_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|250196_250355_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|250538_251751_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001259759.1|252932_253136_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014640552.1|253113_253350_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|253813_254095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478345.1|254540_255515_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001312845.1|256295_257111_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|257160_257514_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|257691_258483_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
262832:262848	attR	GTTTTCCCTGCGTGAAA	NA	NA	NA	NA
>prophage 12
NZ_CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	272117	274511	276880	transposase	Salmonella_phage(100.0%)	2	NA	NA
WP_000608644.1|272117_273380_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|273635_274511_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
