The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	235407	244822	5223981		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|235407_236028_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|236020_237286_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|237297_238200_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|238461_239223_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023280043.1|239243_240104_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|240401_240662_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|240748_241837_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|241867_243133_-	MFS transporter	NA	NA	NA	NA	NA
WP_161283558.1|243187_244822_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.7	6.9e-182
>prophage 2
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	687777	743195	5223981	tRNA,tail,plate,capsid,integrase,portal,head,terminase,transposase	Enterobacteria_phage(52.94%)	62	693005:693022	729431:729448
WP_002901088.1|687777_688278_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|688394_688841_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|688824_689619_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162616948.1|689726_690902_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|690933_691626_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|691771_692281_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|692285_692624_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004190888.1|692613_692853_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
693005:693022	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|693117_693369_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_068815128.1|693412_694552_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
WP_068815130.1|694706_695879_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
WP_032414481.1|695878_696394_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_004131585.1|696439_696757_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|696756_696915_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_068815132.1|696901_699877_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
WP_032457467.1|699891_700383_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
WP_068815134.1|700698_702186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457351.1|702435_703533_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
WP_009486478.1|703532_703745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815136.1|703741_706768_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
WP_068815138.1|706757_707681_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
WP_004131573.1|707682_708033_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_068815140.1|708029_708617_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
WP_068815142.1|708613_709249_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_068815144.1|709245_709713_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
WP_159080880.1|709713_710049_-	peptidase	NA	B6SD31	Bacteriophage	33.3	1.2e-05
WP_023339943.1|710235_710781_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|710777_711062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|711052_711253_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023339940.1|711252_711768_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_068815146.1|711880_712738_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
WP_004213107.1|712787_713822_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_068815147.1|713831_714671_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
WP_068815148.1|714827_716555_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
WP_050597847.1|716548_717610_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
WP_068815150.1|718209_719034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815152.1|719403_719763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549017.1|720012_721752_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_068815154.1|724451_725468_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
WP_068815155.1|725741_726308_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
WP_004213098.1|726304_726529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213097.1|726597_726870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815159.1|726885_727263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328080.1|727278_727497_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|727517_727796_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_068815161.1|727916_728216_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
WP_068815163.1|728331_729345_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
WP_068815165.1|729579_730593_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
729431:729448	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|730650_730752_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|730751_730826_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|730943_731069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|731128_731392_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|731522_732161_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|732250_733165_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|733825_734869_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|735171_736380_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023279889.1|736453_738238_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_068815169.1|738244_739135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|739255_740764_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004140498.1|740797_740962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|741074_741761_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004099053.1|742226_743195_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 3
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	994350	1003813	5223981	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_023279659.1|994350_996072_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_004141853.1|996098_996818_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|997171_997390_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|997509_999789_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|999819_1000137_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1000462_1000684_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1000760_1002701_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1002697_1003813_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	1453273	1528269	5223981	tRNA,tail,plate,capsid,integrase,holin,portal,head,terminase,transposase	Enterobacteria_phage(19.57%)	91	1475014:1475060	1520641:1520687
WP_002892491.1|1453273_1454791_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|1455122_1456598_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|1456657_1458805_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|1458887_1460222_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_004147422.1|1460587_1462156_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892402.1|1462448_1462721_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|1462821_1463742_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_004211259.1|1464252_1465119_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004147417.1|1465141_1466167_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023279772.1|1466168_1468604_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012068380.1|1468614_1469310_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004151792.1|1469368_1469929_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_020804404.1|1470400_1471063_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892375.1|1471040_1471346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|1471398_1472703_-	citrate synthase	NA	NA	NA	NA	NA
WP_004142684.1|1472748_1472889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892370.1|1473213_1473384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|1473462_1473864_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|1474259_1474553_-	hypothetical protein	NA	NA	NA	NA	NA
1475014:1475060	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_074192281.1|1475215_1475422_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
WP_071549009.1|1476764_1477610_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_162616951.1|1478708_1480331_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_025713552.1|1480748_1481063_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
WP_141769812.1|1481220_1481766_-	hypothetical protein	NA	A0A291LCK3	Klebsiella_phage	38.1	6.3e-15
WP_004176137.1|1481746_1482778_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_068815285.1|1482861_1483041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713554.1|1483093_1483690_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
WP_065954093.1|1483686_1484835_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
WP_068815287.1|1484824_1485274_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
WP_065954091.1|1485270_1485852_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049268057.1|1485848_1486934_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
WP_068815289.1|1486930_1488331_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_068815295.1|1488377_1490231_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|1490372_1490651_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896639.1|1490652_1491024_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068815297.1|1491027_1492539_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
WP_071549008.1|1492543_1492720_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065954087.1|1492722_1493268_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_068815298.1|1493264_1493624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815299.1|1493628_1494009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815300.1|1494010_1495060_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
WP_068815301.1|1495158_1495566_-|head	head decoration protein	head	NA	NA	NA	NA
WP_068815304.1|1495565_1496156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210580.1|1496157_1497024_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
WP_068815306.1|1497020_1498655_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
WP_000483310.1|1498654_1498918_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_068815311.1|1498926_1501053_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
WP_068815313.1|1500994_1501576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954080.1|1501837_1502476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954079.1|1502571_1502778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815315.1|1503011_1503401_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
WP_064148680.1|1503397_1503895_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
WP_064782731.1|1503872_1504142_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_068815318.1|1504685_1505369_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
WP_009308007.1|1505365_1505506_-	YlcG family protein	NA	NA	NA	NA	NA
WP_068815320.1|1505502_1506141_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
WP_068815322.1|1506133_1506802_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
WP_012542614.1|1506798_1506966_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
WP_068815323.1|1506946_1507414_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
WP_071549007.1|1507695_1507917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269509.1|1508097_1508946_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
WP_068815324.1|1508942_1509323_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
WP_077269510.1|1509322_1510156_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
WP_046181580.1|1510152_1510359_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_068815326.1|1510355_1510757_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
WP_064146426.1|1510753_1511056_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068815328.1|1511052_1511901_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_068815329.1|1513064_1513385_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
WP_019704103.1|1513434_1513650_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
WP_068815331.1|1513749_1514382_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
WP_008807814.1|1514818_1515025_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_068815333.1|1515106_1515391_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
WP_068815335.1|1515407_1516154_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
WP_068815338.1|1516150_1516774_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_032426563.1|1516802_1517330_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
WP_068815340.1|1517543_1517888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815341.1|1517880_1518558_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
WP_040217354.1|1518554_1518782_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
WP_068815344.1|1518778_1519000_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_064344914.1|1518999_1519239_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
WP_071549006.1|1519251_1519587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068815346.1|1519463_1520627_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	6.6e-203
WP_004143017.1|1521057_1521924_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1520641:1520687	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_023279775.1|1521925_1522138_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1522183_1523569_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|1523744_1524239_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004178782.1|1524242_1524965_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004178781.1|1525072_1525411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178780.1|1525507_1526017_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|1526013_1527081_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068815347.1|1527192_1528269_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	1542317	1596936	5223981	transposase,tRNA	Salmonella_phage(27.27%)	52	NA	NA
WP_002892205.1|1542317_1542797_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002892203.1|1542902_1544555_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004147385.1|1544824_1546045_+	MFS transporter	NA	NA	NA	NA	NA
WP_002892197.1|1546045_1546159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217162.1|1546179_1546302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892195.1|1546270_1547947_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002892192.1|1547982_1549287_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_002892189.1|1549350_1550313_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002892184.1|1550441_1551086_-	adenylate kinase	NA	NA	NA	NA	NA
WP_004177228.1|1551308_1553183_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_002892177.1|1553294_1553900_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|1553899_1554232_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004147381.1|1554289_1556197_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_004177230.1|1556289_1556841_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|1556991_1557369_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|1557438_1557966_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|1557978_1558152_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_023279779.1|1558219_1559119_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
WP_004177234.1|1559154_1562502_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_002892080.1|1562631_1563282_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_004177236.1|1563424_1564618_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_002892069.1|1564640_1567787_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|1568272_1568647_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|1568673_1568892_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|1569050_1569617_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004147370.1|1569588_1569729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892026.1|1569749_1570220_+	membrane protein	NA	NA	NA	NA	NA
WP_021313732.1|1570194_1571646_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|1571746_1572445_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|1572441_1572582_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|1572581_1572845_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|1572960_1574031_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_004177240.1|1574301_1575573_+	maltoporin	NA	NA	NA	NA	NA
WP_002892003.1|1575709_1576024_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_023279781.1|1576088_1578146_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_064174663.1|1578177_1579380_-	galactosidase	NA	NA	NA	NA	NA
WP_004204761.1|1579384_1580236_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279783.1|1580246_1581554_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279784.1|1581616_1582849_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004147361.1|1582887_1583031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815348.1|1583205_1584315_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
WP_068815349.1|1584548_1586108_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014342881.1|1586142_1586388_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_023279787.1|1586579_1587443_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_068815351.1|1587487_1588084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|1588127_1589096_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_001101446.1|1589390_1590416_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004142688.1|1592044_1592260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147352.1|1592256_1592514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|1593422_1594448_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004099053.1|1594742_1595711_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_068815353.1|1595967_1596936_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	4.3e-184
>prophage 6
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4499571	4562870	5223981	transposase,tRNA	Bacillus_phage(21.05%)	46	NA	NA
WP_004175147.1|4499571_4500435_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_068814719.1|4500445_4501219_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
WP_004151134.1|4501460_4502357_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_068814721.1|4502598_4503960_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	3.9e-207
WP_004175198.1|4504278_4505001_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_068814723.1|4504997_4506476_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004149057.1|4506472_4507888_-	MFS transporter	NA	NA	NA	NA	NA
WP_009485875.1|4507889_4510967_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_004149055.1|4510967_4514090_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_068814724.1|4514089_4515328_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_068814726.1|4515628_4516909_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001101446.1|4516940_4517966_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077269499.1|4518284_4519253_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|4519547_4520573_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021440454.1|4520990_4521602_-	positive transcription regulator	NA	NA	NA	NA	NA
WP_032411492.1|4521717_4521858_-	small membrane protein	NA	NA	NA	NA	NA
WP_000019449.1|4522041_4523022_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004899452.1|4523294_4523996_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068814727.1|4524010_4525867_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016531337.1|4526155_4527508_-	molecular chaperone	NA	NA	NA	NA	NA
WP_023282839.1|4527645_4528494_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_002912442.1|4528608_4529250_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|4529340_4529922_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_031591026.1|4529952_4531800_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_068814730.1|4532031_4533615_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_031591031.1|4534374_4535271_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
WP_031591033.1|4535662_4536292_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068814731.1|4537251_4538691_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_031591037.1|4538836_4539970_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024177910.1|4539975_4540410_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_068814732.1|4540426_4542589_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068814733.1|4542661_4544092_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_068814736.1|4544115_4545579_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023322974.1|4545571_4546702_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031591043.1|4546710_4547805_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_159080874.1|4548349_4548775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|4549400_4550369_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_158414492.1|4551378_4551540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322969.1|4552471_4553623_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004099053.1|4553761_4554730_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_031591050.1|4554834_4556241_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_162616940.1|4556428_4557397_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
WP_004180506.1|4557532_4558948_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004899416.1|4558969_4560340_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_031589093.1|4560503_4561670_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_031589100.1|4561862_4562870_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
>prophage 7
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4667619	4677211	5223981	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_004099053.1|4667619_4668588_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_002911596.1|4668767_4669913_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004148893.1|4670304_4670571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|4670451_4670733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|4670775_4671483_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_014343261.1|4671559_4672960_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
WP_004200342.1|4672940_4673435_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_004899215.1|4673409_4674321_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|4674504_4675416_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_040183072.1|4675531_4677211_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 8
NZ_CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4814554	4909557	5223981	protease,tail,plate,capsid,integrase,holin,portal,head,terminase,transposase	Vibrio_phage(27.85%)	116	4824662:4824679	4880760:4880777
WP_004175481.1|4814554_4815301_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|4815780_4816638_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004200323.1|4816793_4817774_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|4817766_4818567_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|4818604_4818727_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_014343223.1|4819024_4819168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|4819344_4820286_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|4820379_4821369_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|4821394_4822726_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|4822753_4823962_+	propionate kinase	NA	NA	NA	NA	NA
WP_068814843.1|4823990_4826285_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
4824662:4824679	attL	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_004225356.1|4826336_4826483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162616953.1|4826772_4827831_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|4827940_4828855_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_068814845.1|4828864_4830151_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|4830147_4831023_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_068814850.1|4831019_4831739_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|4831744_4832638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|4832921_4834565_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|4834614_4835091_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|4835189_4836116_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|4836419_4837715_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_162616943.1|4837726_4838536_+	solute-binding protein	NA	NA	NA	NA	NA
WP_065803155.1|4838776_4840039_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
WP_016244760.1|4840081_4840327_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_029497927.1|4840544_4841294_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
WP_023312753.1|4841290_4841515_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_123640128.1|4841746_4841968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048265752.1|4842038_4842332_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_159080877.1|4843000_4843144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068814854.1|4843485_4844082_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
WP_048289165.1|4844190_4844403_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068814858.1|4844423_4844744_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_047666494.1|4844939_4845194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814860.1|4845190_4846285_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
WP_068814862.1|4846311_4846707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|4846706_4846928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814864.1|4846920_4847706_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
WP_040209280.1|4848357_4848621_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_068814868.1|4849062_4849338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161787.1|4850202_4850937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065520066.1|4851968_4852562_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
WP_068814873.1|4852558_4853329_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
WP_077269504.1|4853325_4853970_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
WP_068814875.1|4853966_4854566_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
WP_068814876.1|4855203_4855473_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
WP_068815639.1|4855450_4855951_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
WP_068814877.1|4855947_4856439_+	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
WP_068814879.1|4856540_4856891_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
WP_162616932.1|4857202_4857574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549025.1|4857522_4857873_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
WP_004884285.1|4858002_4858497_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_068814881.1|4858493_4860224_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_068814883.1|4860418_4861648_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
WP_068814885.1|4861634_4862288_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
WP_068814887.1|4862302_4863511_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
WP_077269505.1|4863537_4863753_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
WP_040186339.1|4863749_4864070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004899632.1|4864139_4864337_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004899631.1|4864338_4864671_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
WP_032437723.1|4864663_4865203_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
WP_068814891.1|4865199_4865565_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
WP_000115125.1|4865621_4866113_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_001177591.1|4866156_4866510_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_031591515.1|4866542_4866806_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
WP_068814894.1|4866870_4867338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814896.1|4867382_4869827_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
WP_004207036.1|4869826_4870297_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_068814899.1|4870293_4870776_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
WP_064143746.1|4870786_4871167_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_159080878.1|4871163_4871304_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	93.3	1.8e-19
WP_048981108.1|4871530_4872094_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|4872275_4872500_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_004114537.1|4874632_4875580_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
WP_004114539.1|4875584_4875824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|4875826_4876114_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_004099053.1|4876678_4877647_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_068814901.1|4877893_4878391_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
WP_068814903.1|4878350_4878827_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
WP_068814905.1|4878823_4879378_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
WP_064176649.1|4879374_4879764_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
WP_141769813.1|4879772_4880036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|4880040_4881057_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
4880760:4880777	attR	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_068814908.1|4881552_4882131_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
WP_019704473.1|4882133_4882352_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
WP_068814910.1|4882344_4882752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814912.1|4882739_4883345_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
WP_068814914.1|4883341_4883572_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114566.1|4883552_4883855_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_004114568.1|4883864_4884152_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_068814916.1|4884154_4884430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114570.1|4884419_4884998_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
WP_068814917.1|4884994_4886584_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
WP_068814918.1|4886583_4888155_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
WP_023301732.1|4888147_4888990_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
WP_108676103.1|4889178_4890195_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
WP_068814921.1|4890197_4891097_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
WP_068814923.1|4891173_4891680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114585.1|4891679_4892120_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
WP_048981146.1|4892119_4892662_+	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
WP_068814926.1|4892658_4893270_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
WP_049086219.1|4893272_4893482_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_068814930.1|4893483_4894965_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
WP_068814932.1|4894974_4895328_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
WP_068814934.1|4895331_4895715_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
WP_068814936.1|4895813_4897622_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
WP_068814938.1|4897621_4898878_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
WP_068814940.1|4898870_4899962_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
WP_068814944.1|4899952_4900492_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
WP_068814946.1|4900488_4900941_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_068814950.1|4900927_4902004_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
WP_068814952.1|4901988_4902573_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
WP_068814954.1|4902575_4903388_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
WP_068814956.1|4903387_4904263_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
WP_068814961.1|4904272_4906258_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
WP_068814965.1|4906623_4909557_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 1
NZ_CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	174	24822	183663	transposase,integrase,protease	Escherichia_phage(45.45%)	27	12619:12634	31166:31181
WP_020324562.1|174_879_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_063840321.1|1022_1577_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|1768_2473_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550555.1|2618_2909_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
WP_077625545.1|3003_3504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3480_4185_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|4425_5130_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|7560_8565_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|8746_8923_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_022631488.1|9252_10068_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
WP_001067855.1|10221_10926_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_009310051.1|11107_11371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|11937_12282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|12389_13025_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
12619:12634	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
WP_016338368.1|13024_15133_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338369.1|15122_16400_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000754566.1|17976_18393_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|18389_18620_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004153649.1|19284_19491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|19536_19845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|19872_20202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|20227_20626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|20632_20965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|20964_21747_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|22638_22869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|22960_23434_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|23553_24822_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
31166:31181	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
>prophage 2
NZ_CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	29397	41489	183663		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|29397_31425_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|31536_31752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|31976_32309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|32685_33660_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|33656_34862_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|35183_36080_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|36480_37752_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|37751_38183_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|38414_39386_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|39388_40060_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|40120_40351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|40469_40586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|40787_41489_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 3
NZ_CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	53680	108826	183663	transposase,integrase	uncultured_Caudovirales_phage(25.0%)	54	69820:69843	108893:108916
WP_004199413.1|53680_56698_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004152379.1|61059_61785_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
WP_004152380.1|61856_62450_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015060010.1|62610_63213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|63262_63907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152382.1|63962_64613_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|64609_64918_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_001067855.1|65294_65999_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277466.1|66098_66464_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000522996.1|68194_68620_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|68647_68923_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|68938_69304_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|69375_69831_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
69820:69843	attL	ACTACGCCTTAGCGTGCTTTATTT	NA	NA	NA	NA
WP_001776119.1|70090_70618_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|70650_71082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|71561_72527_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|72996_74484_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|74889_75321_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|75320_76592_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|76673_77648_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|77647_78853_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|79267_79537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|79893_80760_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|81294_81399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|81527_81785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|81842_82619_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|82615_83359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|83409_83760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074193041.1|83903_84365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|84321_84552_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|84844_85549_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118538.1|86198_86531_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|86884_88033_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_021740570.1|88157_91175_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004118534.1|91548_91923_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|92451_93648_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|93719_94547_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|94565_96044_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|96527_96881_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|96976_98260_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|98309_98738_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_000427614.1|99401_100406_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|100484_101042_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|101035_101407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|101403_101904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|101900_102227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|102481_102838_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|102827_103229_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|103225_103516_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000845048.1|103822_104836_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|104981_105773_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|105936_106284_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|106277_107117_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000427614.1|107821_108826_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
108893:108916	attR	AAATAAAGCACGCTAAGGCGTAGT	NA	NA	NA	NA
>prophage 4
NZ_CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	126292	135249	183663	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_001201739.1|126292_126676_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|126672_127020_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|127069_128605_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_015058217.1|129363_129573_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
WP_068814615.1|129640_132610_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
WP_015056403.1|132609_135249_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
>prophage 5
NZ_CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	161610	177829	183663	transposase,integrase	Burkholderia_phage(33.33%)	15	157642:157686	171844:171888
157642:157686	attL	AAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_004201235.1|161610_163080_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001749988.1|163836_164406_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|164798_165812_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|165967_166441_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|166661_166928_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|167070_167835_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|168095_169310_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|169343_170777_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|171158_171365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|171369_171882_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|172683_173388_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
171844:171888	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTT	NA	NA	NA	NA
WP_087759376.1|173485_174605_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_022631495.1|174652_175291_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
WP_004098982.1|175702_176578_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004098977.1|177202_177829_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
>prophage 1
NZ_CP029724	Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence	178561	39998	109061	178561	transposase	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
WP_085955172.1|39998_41206_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|42634_43066_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|43316_44792_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|44784_45465_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|45654_47040_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|47068_47422_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|47535_48828_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|48838_51985_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|52071_52512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317528.1|52638_55092_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
WP_000843497.1|55132_55330_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|55363_56101_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|56389_56839_-	copper resistance protein	NA	NA	NA	NA	NA
WP_068814620.1|57072_58890_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|58889_59786_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_009654298.1|59825_60206_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|60210_61140_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|61194_61875_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|61871_63272_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_068814621.1|63488_63923_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_024623170.1|64154_64334_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004196769.1|66076_66586_+	major intrinsic family protein	NA	NA	NA	NA	NA
WP_004196778.1|66635_67133_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|67464_67791_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004182006.1|67787_68501_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|68509_69055_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|69130_69493_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|71389_71926_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|71958_72384_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|72396_73686_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|73733_75485_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|75502_75865_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|75914_76265_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|76622_76892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|76879_77455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|77485_77980_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|78023_78392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814622.1|78425_78629_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|78677_78935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|79010_79265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|79440_79707_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|79694_80177_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077253535.1|80384_81731_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|81779_82175_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_009653207.1|82363_83761_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004197671.1|84000_84279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197678.1|84613_85180_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197675.1|85304_86948_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_023157975.1|87061_89509_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_009653212.1|89527_90961_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|91049_92333_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|92462_94655_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_013815099.1|95027_95996_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_022631502.1|96296_96497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706028.1|100754_101306_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
WP_019706029.1|101321_103418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706030.1|103809_104814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814598.1|105024_108033_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_001067855.1|108356_109061_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP029724	Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence	178561	112155	128783	178561	transposase,integrase	Escherichia_phage(50.0%)	17	108294:108353	124602:125422
108294:108353	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001389365.1|112155_112920_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000427614.1|114291_115296_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|115606_115984_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068815675.1|116184_116844_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.5	7.1e-130
WP_004189163.1|117467_117908_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|117904_118255_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|118285_119878_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_015059985.1|120517_121774_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_000237816.1|122019_122472_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_000845048.1|122644_123658_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|123893_124598_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|124978_125935_+	hypothetical protein	NA	NA	NA	NA	NA
124602:125422	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTATTGCGTGACGTAGATTCGTGACGTATAGTTACTGCAACTTATTTGTTTATAACTACCGTCAGGTACAAAATTATGTCTCCCGTACAAGCTAAACAAAAGCAGCATGAACGCTACGAAGCCGTAGCGGTGCAGGTTTTGCGTGGTCGTGCCGGTTACAAACCTGCCGTGAAAAGCCGCTTCAGTAAGTCAGCTAGTAGCAAATTCGCTCATACTATCGCTTTTGCCTGATCCTGAACTTTGAGGCACAATAAACCATCATTCGCTGATGGTTTTTTTATGCCTGTTCAAGACGTTATTCCCCCCTATGAGCAGATGTACCTGCTAAATCAGCAGCTGATCTGCAACGCTGATCAGTTCAAACATGCCGTTATCACAGTTGGCGGTCAGGCTGTGCAATACTGGATATCCTATTATCATGCACAATACGGCGACAGATTGCCTGATGAGCGCCTCACCACATCTGTTGACTGCGACTACAGCGCCCGGAAAGATGATATTGCGGCTATAGCAAAAACGCTCAACGTTAAGACGTGGGAGAACAAAGACGGTCAGCCCCCATCCCTTGCGCAGTTTATGCTTATCGATCAGGATACACACGATATCAAACGGGATGATGGACGCTTATTTGCCGTACCGGATGCGCCTGACGAGCCAAATGTGGTGGATATTATCGACCGCCCCGGAGGCTTTGACCGTTCTGATTTTCAGGGGAAAAAGCTTTACCTGTATACCGCCCCGTTTTATGTAGAAGCAACC	NA	NA	NA	NA
WP_011977825.1|125961_126123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|126119_126731_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|126784_127066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|127238_127574_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000019450.1|127802_128783_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
