The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	679676	689091	5347404		Escherichia_phage(87.5%)	9	NA	NA
WP_162557934.1|679676_681311_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	56.0	3.6e-183
WP_004176258.1|681365_682631_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|682661_683750_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|683836_684097_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|684394_685255_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|685275_686037_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|686298_687201_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|687212_688478_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|688470_689091_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	863733	952483	5347404	holin,tRNA,head,integrase,portal,plate,capsid,tail,protease,terminase	Klebsiella_phage(62.96%)	100	934160:934175	956753:956768
WP_002902422.1|863733_864669_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|864714_866088_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|866613_867597_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023302015.1|867876_868620_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
WP_023302016.1|868582_869701_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176404.1|869937_870132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705261.1|870244_870991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892563.1|871281_871950_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002902393.1|872963_873770_-	methionine-binding protein	NA	NA	NA	NA	NA
WP_023285056.1|873990_875166_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004179583.1|875210_876245_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004179582.1|876333_876882_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024622999.1|876936_877848_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_020324664.1|877840_878710_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_052455031.1|879406_879721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190483.1|879740_880646_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021440014.1|880790_881720_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004179576.1|881745_881952_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|882002_882881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151596.1|883039_883795_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021440012.1|883799_884393_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302022.1|884466_885180_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009309032.1|885246_885741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181981.1|885869_886412_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004176418.1|886389_887475_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021440010.1|887438_889193_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004183804.1|889271_890864_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440009.1|890860_894310_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_021440008.1|894299_895481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181978.1|895429_895687_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181976.1|895729_898129_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|898116_898647_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021440005.1|898671_899448_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024623002.1|899451_901821_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_023302030.1|901822_904477_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
WP_002902160.1|904741_905233_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021440002.1|905237_906944_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004176431.1|906940_907630_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004179544.1|907626_908970_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023302033.1|908979_910524_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|910566_911058_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032409032.1|911216_911339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|911903_912152_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040174799.1|912559_912982_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_074185737.1|913059_913242_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
WP_040186352.1|913253_914054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322138.1|916103_919172_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|919168_919549_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_040182606.1|919558_920041_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004899614.1|920027_920507_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182604.1|920506_922954_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_040186345.1|922998_923466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|923531_923795_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|923827_924181_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|924224_924716_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|924771_925137_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|925133_925673_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_040186341.1|925665_925998_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
WP_004899632.1|925999_926197_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_040186860.1|926257_926584_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
WP_044067369.1|926531_926774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186862.1|926810_927974_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
WP_077255528.1|927985_928666_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
WP_017880221.1|928671_929949_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|929951_931484_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|931493_931928_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|932049_932259_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|932271_932562_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|932632_932839_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|932919_933156_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|933480_933753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|933885_934170_+	hypothetical protein	NA	NA	NA	NA	NA
934160:934175	attL	ACCTGCAATAGCTCTC	NA	NA	NA	NA
WP_040182576.1|934405_934681_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|934688_935318_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|935317_935599_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|935585_935981_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|936543_936990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|936895_937153_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_040182574.1|937306_938089_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_071854264.1|938085_939048_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
WP_048322137.1|939049_940708_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_040182571.1|940749_941118_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_071854265.1|941788_942022_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_023304723.1|942162_942837_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_040182568.1|943000_943414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177202.1|943596_943821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218017.1|944025_944187_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_040186816.1|944179_944434_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
WP_004146412.1|944501_944624_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_040186814.1|944620_945061_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_040186812.1|945101_945620_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
WP_032415174.1|945625_946351_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
WP_040186810.1|946340_946565_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
WP_103219593.1|946561_947446_+	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
WP_004198245.1|947518_947665_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_077255525.1|947624_947867_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_040186739.1|947847_949029_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_016197745.1|949225_949774_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004224331.1|949972_951505_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_023285032.1|951721_952483_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
956753:956768	attR	GAGAGCTATTGCAGGT	NA	NA	NA	NA
>prophage 3
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1108941	1155079	5347404	tRNA,head,integrase,portal,plate,capsid,tail,terminase	Enterobacteria_phage(54.55%)	54	1114169:1114186	1151345:1151362
WP_004892876.1|1108941_1109442_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|1109558_1110005_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|1109988_1110783_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|1110890_1112066_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|1112097_1112790_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|1112935_1113445_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|1113449_1113788_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|1113777_1114017_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1114169:1114186	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|1114281_1114533_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|1114576_1115716_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|1115870_1117043_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|1117042_1117558_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|1117603_1117921_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_075604421.1|1117920_1118079_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040181412.1|1118065_1121041_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|1121056_1121530_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|1121993_1122656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|1122673_1123897_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|1124496_1125594_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|1125593_1125806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181424.1|1125802_1128829_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|1128818_1129742_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|1129743_1130094_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|1130090_1130678_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|1130674_1131310_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|1131306_1131774_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_158246032.1|1131774_1132110_-	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_023339943.1|1132296_1132842_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|1132838_1133123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|1133113_1133314_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|1133313_1133829_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|1133941_1134799_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|1134848_1135883_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|1135892_1136732_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|1136888_1138616_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|1138609_1139671_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|1140515_1141307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|1141306_1143577_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181444.1|1146466_1147423_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|1147655_1148222_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|1148218_1148443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|1148511_1148784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|1148799_1149177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|1149192_1149411_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|1149431_1149710_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|1149830_1150130_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|1150245_1151229_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|1151493_1152507_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1151345:1151362	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|1152564_1152666_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|1152665_1152740_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|1152857_1152983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1153042_1153306_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1153436_1154075_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|1154164_1155079_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 4
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1417567	1427041	5347404	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|1417567_1419289_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_072145323.1|1419315_1420035_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1420388_1420607_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1420737_1423017_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1423047_1423365_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1423690_1423912_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1423988_1425929_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1425925_1427041_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1916260	1964413	5347404	tRNA,head,integrase,lysis,terminase	Cronobacter_phage(27.66%)	72	1910603:1910649	1961484:1961530
1910603:1910649	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040186451.1|1916260_1918738_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|1918724_1919120_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|1919116_1919587_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|1919586_1920063_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|1920176_1920590_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|1920609_1920789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110521958.1|1920829_1924270_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|1924364_1924868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|1924970_1925198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|1925292_1925610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|1925661_1925982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|1926464_1926938_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|1926974_1927406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|1927416_1927782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|1927778_1928084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|1928388_1929072_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|1929124_1929877_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|1929945_1930338_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|1930334_1930760_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|1930762_1931125_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|1931124_1931298_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|1931297_1931678_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|1931680_1931956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|1931966_1933061_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|1933072_1933501_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|1933504_1934890_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|1934962_1935313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|1935412_1936426_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|1936358_1937822_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|1937834_1939133_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_048294303.1|1939116_1939584_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_058842816.1|1939614_1940241_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|1941090_1941549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087760209.1|1941982_1942120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|1942122_1942590_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|1942586_1943117_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|1943119_1943368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322094.1|1943795_1944320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|1944664_1945354_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|1945350_1945491_-	YlcG family protein	NA	NA	NA	NA	NA
WP_048322091.1|1945487_1946123_-	Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	76.5	1.5e-79
WP_032431555.1|1946115_1946286_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|1946266_1946734_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|1946924_1947182_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|1947510_1947708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|1947700_1947967_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|1948978_1949497_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|1949999_1950197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|1950189_1950453_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|1950449_1950872_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|1950868_1951171_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|1951167_1951905_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_040181719.1|1951901_1952867_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181694.1|1952926_1953724_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|1953809_1954031_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|1954070_1954304_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|1954408_1955098_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_032434121.1|1955438_1956155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|1956145_1956691_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|1956739_1956943_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_074183191.1|1957252_1957378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|1957370_1957565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|1957654_1957939_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|1957955_1958702_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|1958698_1959322_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|1959350_1959878_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|1959874_1960093_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|1960094_1960430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|1960306_1961470_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|1961901_1962768_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1961484:1961530	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|1962769_1962982_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1963027_1964413_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 6
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	4290462	4362308	5347404	transposase,tRNA	Escherichia_phage(84.85%)	60	NA	NA
WP_004174602.1|4290462_4291284_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
WP_004142894.1|4291326_4291758_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004174604.1|4291757_4292963_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
WP_002915549.1|4293160_4293385_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915545.1|4293736_4294654_+	glycine cleavage system transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_002915543.1|4294673_4295069_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_040181043.1|4295061_4296162_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_004142883.1|4296210_4296921_-	L-fucose operon activator	NA	NA	NA	NA	NA
WP_002915538.1|4296979_4297402_-	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_023342619.1|4297403_4298822_-	L-fuculokinase	NA	NA	NA	NA	NA
WP_023301522.1|4298929_4300705_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_004151076.1|4300737_4302048_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_032408709.1|4302340_4302463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915470.1|4302614_4303262_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_004149581.1|4303289_4304438_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_004142871.1|4304508_4305264_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
WP_004142865.1|4305360_4307304_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004219275.1|4307381_4307498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301524.1|4307575_4308748_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_023285507.1|4308794_4310192_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004890067.1|4310265_4311672_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023285506.1|4311668_4312691_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
WP_023285505.1|4312687_4313386_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002915265.1|4313382_4314261_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004149572.1|4314454_4315876_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915263.1|4315886_4317110_+	monooxygenase	NA	NA	NA	NA	NA
WP_002915261.1|4317155_4318097_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023280483.1|4318235_4319603_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_004151070.1|4319668_4320958_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_002915258.1|4321467_4322835_-	LOG family protein	NA	NA	NA	NA	NA
WP_048322187.1|4322946_4323792_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.0	3.6e-41
WP_002915253.1|4323860_4324406_+	SecY-interacting protein	NA	NA	NA	NA	NA
WP_001067855.1|4324638_4325343_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4326976_4327879_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4328140_4328902_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4328922_4329783_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4329919_4330624_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4332257_4333160_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4333421_4334183_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4334203_4335064_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4335200_4335905_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210513.1|4338701_4339463_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4339483_4340344_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4340480_4341185_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4342817_4343720_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4343981_4344743_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4344763_4345624_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4345760_4346465_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4348098_4349001_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4349262_4350024_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4350044_4350905_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4351041_4351746_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4353379_4354282_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4354543_4355305_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4355325_4356186_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4356322_4357027_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|4358660_4359563_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4359824_4360586_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|4360606_4361467_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|4361603_4362308_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5004804	5011707	5347404	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_048322216.1|5004804_5005668_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|5005678_5006452_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|5006692_5007589_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|5007831_5009193_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|5009509_5010232_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004189109.1|5010228_5011707_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 8
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5052271	5060650	5347404		Enterobacteria_phage(28.57%)	9	NA	NA
WP_000043542.1|5052271_5053678_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004189145.1|5053901_5054966_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_004189147.1|5054992_5055862_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
WP_004189149.1|5055893_5056784_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|5056798_5057353_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004152483.1|5057532_5058699_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004144151.1|5059121_5059244_-	small membrane protein	NA	NA	NA	NA	NA
WP_032435777.1|5059434_5059575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189151.1|5059645_5060650_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	6.1e-32
>prophage 9
NZ_CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5282359	5332782	5347404	terminase,integrase,lysis	uncultured_Caudovirales_phage(27.59%)	71	5286453:5286468	5334535:5334550
WP_004148802.1|5282359_5284003_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|5284052_5284529_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009307580.1|5284627_5285554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|5285857_5287153_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
5286453:5286468	attL	TGATTGTTCCGTTCAT	NA	NA	NA	NA
WP_074183181.1|5287164_5287974_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312745.1|5288214_5289477_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|5289519_5289765_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_032723532.1|5289768_5289987_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_040181681.1|5289983_5290511_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|5290507_5290666_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|5290662_5291349_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_124072215.1|5291341_5291791_-	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.6	1.0e-18
WP_040181685.1|5291958_5292804_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|5292819_5293104_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_004151303.1|5293193_5293388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181689.1|5293380_5293491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181691.1|5293832_5294465_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	9.2e-34
WP_023284762.1|5294564_5294780_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_040181693.1|5294829_5295150_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
WP_040181694.1|5295236_5296034_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_040181719.1|5296093_5297059_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181695.1|5297055_5297793_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|5297789_5298092_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|5298088_5298511_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_040181701.1|5298507_5298768_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|5299299_5299512_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|5300140_5300554_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_040181178.1|5301054_5301510_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
WP_040181180.1|5301509_5301680_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
WP_040181182.1|5301672_5302311_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_040181184.1|5302307_5302448_+	YlcG family protein	NA	NA	NA	NA	NA
WP_040181186.1|5302444_5303254_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_004146347.1|5304439_5304754_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_040181191.1|5304756_5305260_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|5305256_5305724_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|5305726_5305864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441335.1|5306220_5306709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|5306659_5308060_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|5308297_5309749_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|5309804_5310353_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|5310398_5310593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|5310602_5311805_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|5311808_5312303_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181207.1|5312314_5313256_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
WP_040181209.1|5313295_5313577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181211.1|5313545_5313965_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.1e-40
WP_040181213.1|5313961_5314468_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	2.4e-16
WP_023312779.1|5314467_5314854_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|5314948_5315389_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_040181215.1|5315392_5316538_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	6.3e-166
WP_023312781.1|5316547_5316991_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_040181217.1|5316994_5317414_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	8.8e-41
WP_016244729.1|5317455_5317608_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_048322155.1|5317597_5319601_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.2	5.9e-244
WP_025714269.1|5319786_5320200_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.1	4.0e-30
WP_025714270.1|5320275_5320503_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.3	1.6e-20
WP_048322154.1|5320505_5321528_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
WP_048322153.1|5321527_5321869_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	5.1e-23
WP_048322152.1|5321911_5322130_-	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	41.8	3.6e-06
WP_160538931.1|5322223_5322391_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_110521967.1|5322490_5323057_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.6	1.1e-30
WP_048322149.1|5323129_5323882_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	55.6	4.7e-61
WP_048322148.1|5323969_5324623_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	7.7e-60
WP_023312790.1|5324624_5324978_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
WP_040181231.1|5324977_5326177_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	75.3	1.3e-161
WP_040181232.1|5326173_5326947_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_023284799.1|5326946_5327720_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
WP_087750251.1|5327738_5329718_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	28.0	6.9e-27
WP_072040613.1|5329727_5330528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|5330976_5332464_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_040181236.1|5332542_5332782_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	1.1e-16
5334535:5334550	attR	TGATTGTTCCGTTCAT	NA	NA	NA	NA
>prophage 1
NZ_CP029739	Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence	175746	2774	76133	175746	transposase	Salmonella_phage(27.27%)	56	NA	NA
WP_001101446.1|2774_3800_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088941748.1|5674_6837_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.0	7.3e-53
WP_004118061.1|7245_7650_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_040217023.1|8331_8610_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|8703_8916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322245.1|9807_10248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016151349.1|11348_12317_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_017901242.1|14392_15358_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017901243.1|15354_16173_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
WP_017901244.1|16177_16840_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901245.1|16836_17508_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032430746.1|17531_18380_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020481021.1|18536_19490_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
WP_017901247.1|19576_20788_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_074423483.1|21126_22095_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.7	1.1e-176
WP_162616909.1|22112_22403_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	95.7	3.1e-45
WP_004144067.1|22534_23005_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_023287184.1|23001_23445_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_032430744.1|24739_26968_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_023287181.1|26964_28146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012541818.1|28282_29137_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012541817.1|29149_29668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024241646.1|30566_31649_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_032430741.1|31770_34845_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.1	0.0e+00
WP_032430739.1|34896_36150_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|36206_36377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654811.1|36891_37860_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_101987911.1|37818_38106_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	3.2e-34
WP_017900720.1|39493_39928_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|40143_41544_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|41540_42221_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_017900721.1|42275_43205_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|43209_43590_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|43629_44526_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_017900722.1|44525_46343_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_025999288.1|46577_47027_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|47315_48053_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|48086_48284_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_128306664.1|48324_50796_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	5.0e-83
WP_017900725.1|50893_51334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574021.1|51420_54567_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_048322224.1|54577_55870_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|55983_56337_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|56365_57751_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|57940_58621_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_004118652.1|58613_60089_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|60339_60771_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_017900727.1|60914_61265_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
WP_025999290.1|61652_62561_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001101446.1|63045_64071_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162616910.1|64365_65334_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_077263912.1|66655_67624_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	3.8e-180
WP_049015454.1|68763_69861_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
WP_032430783.1|71439_72456_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_048322225.1|73706_74243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381359.1|74561_76133_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 2
NZ_CP029739	Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence	175746	79259	165260	175746	transposase,integrase	Salmonella_phage(21.74%)	58	112358:112405	121839:121886
WP_017900946.1|79259_80270_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_017900945.1|80999_82166_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
WP_004117790.1|82165_83137_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004902307.1|84512_84695_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004189163.1|84891_85332_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_048322226.1|85328_85679_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_017901264.1|85709_87302_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.1e-175
WP_032747566.1|87395_87851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901263.1|87910_88414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901262.1|88449_90018_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_077263913.1|90068_91283_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017901260.1|91272_91998_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
WP_048322228.1|91997_93965_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_048322248.1|93961_94927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322229.1|94974_97689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023288355.1|97688_100757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077263914.1|100774_102133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072096726.1|102272_103385_-	tellurite resistance domain protein	NA	NA	NA	NA	NA
WP_023288353.1|103466_103949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025999344.1|104028_104766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322231.1|106129_107098_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_020477096.1|108361_108805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322232.1|108814_109222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435645.1|109264_110224_+	DNA replication protein	NA	NA	NA	NA	NA
WP_004099053.1|110313_111282_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_110521969.1|111377_112364_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.3e-172
112358:112405	attL	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_004197568.1|112505_112829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213829.1|112980_113298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322233.1|113363_114500_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048322234.1|114677_114932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162616911.1|115255_116224_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	5.3e-182
WP_048322219.1|116906_118415_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
WP_125337164.1|119954_120452_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_074187388.1|120884_121853_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	1.4e-182
WP_032430764.1|124469_126335_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
121839:121886	attR	GATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_032430763.1|126538_128095_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.4e-106
WP_032430798.1|129266_130586_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048322236.1|130578_133692_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.6	9.2e-26
WP_048322237.1|133753_133969_-	hypothetical protein	NA	J9Q747	Salmonella_phage	73.6	3.8e-16
WP_048298736.1|137573_139010_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	7.2e-10
WP_101987924.1|139769_141053_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_048322240.1|142985_143396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322241.1|144939_145383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217257.1|145403_146192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440835.1|147287_147695_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
WP_032430761.1|148435_149245_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_032430760.1|149237_150446_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_160421093.1|151905_152814_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_032430758.1|154089_155187_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
WP_032430757.1|155183_155828_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228066.1|155830_156511_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017900874.1|156541_157417_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032430756.1|157427_158960_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.2	9.0e-67
WP_017900872.1|158993_159551_-	HutD family protein	NA	NA	NA	NA	NA
WP_017900871.1|159547_160309_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_023329010.1|160411_161779_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_048293850.1|161977_162958_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	3.4e-184
WP_032430751.1|163721_165260_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.6	4.5e-276
>prophage 1
NZ_CP029740	Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence	103250	23235	34765	103250	transposase	Stx2-converting_phage(37.5%)	16	NA	NA
WP_004152492.1|23235_24057_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_004152751.1|24876_25710_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.8e-21
WP_004152750.1|25760_25907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152749.1|26001_26349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152748.1|26405_26759_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	64.2	5.0e-29
WP_072093151.1|26760_26880_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032277629.1|27207_28779_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|28798_29146_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|29145_29823_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_004153414.1|30095_30446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152661.1|30442_30715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152660.1|30762_31122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199367.1|31232_31556_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	34.2	2.3e-09
WP_004152658.1|31559_32282_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152657.1|32278_32710_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152656.1|32755_34765_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
>prophage 2
NZ_CP029740	Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence	103250	43972	54997	103250	integrase	Escherichia_phage(37.5%)	14	49870:49882	56590:56602
WP_001568041.1|43972_44674_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_014343518.1|44875_44992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322267.1|45110_45341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322266.1|45403_46075_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|46077_47049_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_162616913.1|47179_47305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|47297_48785_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_162616914.1|49097_49214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322265.1|49191_49623_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|49622_50894_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
49870:49882	attL	TGATGAACTGCCT	NA	NA	NA	NA
WP_004098982.1|51305_52181_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|52821_53448_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_077253981.1|53567_53747_+	Par-like protein	NA	NA	NA	NA	NA
WP_004197635.1|54202_54997_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
56590:56602	attR	AGGCAGTTCATCA	NA	NA	NA	NA
