The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	1081703	1112927	5140937	protease,coat	Moraxella_phage(33.33%)	27	NA	NA
WP_048321499.1|1081703_1082639_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_048322069.1|1082659_1085002_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_048321500.1|1085147_1085912_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033646335.1|1085936_1086491_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071883799.1|1086490_1086994_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|1086996_1087536_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_048321501.1|1087810_1089247_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_048322070.1|1089349_1091980_-	PqiB family protein	NA	NA	NA	NA	NA
WP_048322071.1|1091948_1093196_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033638286.1|1093451_1093949_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1094045_1094756_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|1094775_1096824_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638291.1|1097133_1098012_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_048321502.1|1098249_1098957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646331.1|1099057_1100452_-	MFS transporter	NA	NA	NA	NA	NA
WP_048321503.1|1100683_1101475_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_048321504.1|1101521_1102325_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033646329.1|1102327_1103191_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033646328.1|1103192_1104329_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_048321505.1|1104325_1105336_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048321506.1|1105511_1106231_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_048321507.1|1106386_1107490_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_048321508.1|1107499_1108309_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_033653910.1|1108372_1109764_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_048321509.1|1109945_1110494_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_033638306.1|1110917_1111583_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033646324.1|1111646_1112927_-|protease	protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	1933809	1968697	5140937	terminase,integrase,head,plate,tail,capsid,portal	Salmonella_phage(25.71%)	43	1934909:1934930	1967870:1967891
WP_039565556.1|1933809_1934712_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.8	5.7e-37
1934909:1934930	attL	AAAAAGGCCGCCGAAGCGGCCT	NA	NA	NA	NA
WP_033643461.1|1935039_1935258_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.8e-21
WP_048321690.1|1935337_1936507_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.7	3.0e-163
WP_033644295.1|1936503_1936989_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	3.5e-49
WP_048321691.1|1937001_1939449_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	64.9	1.7e-256
WP_071796738.1|1939441_1939561_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	4.5e-11
WP_048321692.1|1939593_1939896_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.3	1.9e-29
WP_048321694.1|1939953_1940472_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	1.0e-75
WP_048321695.1|1940488_1941658_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	81.4	6.2e-185
WP_048321696.1|1942403_1942622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321697.1|1942790_1943315_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.3	6.2e-36
WP_080441018.1|1943316_1945413_-	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	7.0e-62
WP_048321698.1|1945419_1945953_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	6.3e-76
WP_048321699.1|1945945_1946854_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	64.9	1.5e-101
WP_048321700.1|1946858_1947209_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	8.9e-39
WP_048321701.1|1947205_1947847_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.6	2.9e-67
WP_147435411.1|1948003_1948534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063701.1|1948523_1948961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321705.1|1949036_1949483_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.6	2.9e-50
WP_048321706.1|1949475_1949943_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	4.5e-62
WP_048321707.1|1950032_1950470_-	hypothetical protein	NA	O80310	Escherichia_phage	42.4	1.2e-13
WP_048321708.1|1950466_1950976_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.7	1.5e-63
WP_033652228.1|1950959_1951169_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	39.1	9.8e-09
WP_048321710.1|1951171_1951375_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	1.1e-20
WP_021504058.1|1951374_1951881_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	71.4	1.5e-63
WP_048321711.1|1951974_1952718_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.9e-71
WP_080441019.1|1952720_1953920_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	75.9	9.3e-152
WP_048321712.1|1953990_1954836_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	66.7	9.6e-103
WP_048321713.1|1954996_1956769_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	81.3	3.8e-287
WP_048321714.1|1956765_1957797_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.3	6.3e-165
WP_108675270.1|1958108_1959251_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_048321716.1|1959247_1960897_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_048321717.1|1961082_1961811_-	hypothetical protein	NA	Q37850	Escherichia_phage	57.0	9.8e-72
WP_048321718.1|1961900_1964189_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.5	1.5e-267
WP_162619289.1|1964185_1964470_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	56.7	4.6e-25
WP_021504068.1|1964469_1964685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321721.1|1964687_1964987_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_033652239.1|1964979_1965237_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_037421654.1|1965300_1965801_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	72.3	2.2e-67
WP_048321722.1|1965992_1966268_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.5e-33
WP_072071899.1|1966393_1966693_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
WP_048321723.1|1966780_1967764_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	64.8	4.1e-121
WP_015378226.1|1967908_1968697_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.3	9.2e-92
1967870:1967891	attR	AAAAAGGCCGCCGAAGCGGCCT	NA	NA	NA	NA
>prophage 3
NZ_CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	3373710	3415087	5140937	tRNA,terminase,integrase,head,plate,capsid,tail,lysis,portal	Erwinia_phage(46.15%)	50	3379891:3379941	3415180:3415230
WP_033649054.1|3373710_3374724_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
WP_001144069.1|3375049_3375265_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025304325.1|3375401_3377150_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_033636080.1|3377307_3379149_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_033649053.1|3379224_3379713_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3379891:3379941	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_033644586.1|3380136_3380367_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
WP_048321949.1|3380450_3381611_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.4	7.4e-138
WP_015379102.1|3381607_3382093_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_048321950.1|3382092_3384921_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.1	2.8e-106
WP_023456045.1|3384913_3385036_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_048321951.1|3385068_3385350_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	9.1e-26
WP_023447563.1|3385404_3385914_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_048321952.1|3385929_3387099_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
WP_072071904.1|3387374_3387794_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	2.6e-16
WP_108658201.1|3387799_3390460_-	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.8e-61
WP_048321954.1|3390466_3391000_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	1.6e-76
WP_048321955.1|3390992_3391901_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.9	2.4e-107
WP_048321956.1|3391905_3392256_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
WP_108658200.1|3392252_3392519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321958.1|3392534_3393164_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.3	1.1e-76
WP_072071905.1|3393245_3395075_-	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	24.7	3.7e-11
WP_048321959.1|3395157_3395607_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	61.1	7.2e-41
WP_048321960.1|3395593_3396070_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	1.1e-50
WP_048321961.1|3396165_3396594_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.0	4.6e-13
WP_048321962.1|3396590_3397103_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	6.7e-59
WP_031231709.1|3397086_3397296_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_048321963.1|3397300_3397504_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	1.8e-20
WP_033639340.1|3397503_3397992_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_033649039.1|3398085_3398745_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_048321964.1|3398747_3399932_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	4.5e-159
WP_048321965.1|3399974_3400790_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.5	7.1e-71
WP_033632041.1|3400932_3402705_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	5.2e-292
WP_048321966.1|3402704_3403739_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
WP_033633573.1|3403783_3404125_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_072071906.1|3404124_3404379_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.6e-16
WP_072071907.1|3404763_3405846_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_072071908.1|3405842_3407639_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_072071909.1|3407799_3408012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321967.1|3408050_3410267_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.3	3.1e-238
WP_048321968.1|3410263_3410545_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_072071910.1|3410667_3411249_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	58.4	1.7e-58
WP_048321969.1|3411254_3411473_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.9	5.6e-15
WP_048321970.1|3411472_3411784_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_048321971.1|3411783_3412026_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_031221632.1|3412089_3412392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322123.1|3412403_3412583_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_015379133.1|3412593_3413103_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
WP_048321972.1|3413133_3413355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321973.1|3413464_3414049_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
WP_049279097.1|3414052_3415087_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
3415180:3415230	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
>prophage 4
NZ_CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	4989969	4998625	5140937	integrase	Enterobacteria_phage(66.67%)	9	4991569:4991583	4997429:4997443
WP_033637217.1|4989969_4991073_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
WP_033649937.1|4991082_4992336_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	2.8e-98
4991569:4991583	attL	CTGGAACAGTGCGGC	NA	NA	NA	NA
WP_033649938.1|4992754_4993945_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_048321296.1|4994680_4994944_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_048321297.1|4994940_4995156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321298.1|4995142_4995688_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
WP_048321299.1|4995684_4995948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321300.1|4995944_4996280_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_048321301.1|4996291_4998625_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
4997429:4997443	attR	GCCGCACTGTTCCAG	NA	NA	NA	NA
