The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	328800	369291	5359785	transposase,holin,integrase	Escherichia_phage(25.0%)	39	328881:328897	352611:352627
WP_000893251.1|328800_330054_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
328881:328897	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000772642.1|330409_331624_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|331766_332648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|333012_334221_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_096891973.1|334195_334381_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001035842.1|334380_334812_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_001019379.1|334824_335658_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_085948178.1|335781_336994_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000642924.1|337082_337493_+	hypothetical protein	NA	G5DES5	Salmonella_phage	41.9	2.1e-26
WP_000480477.1|337558_338497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234405.1|338586_339405_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
WP_000214420.1|339496_339982_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186787.1|339997_340474_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|340542_340764_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_085948178.1|341646_342860_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000942525.1|343360_344431_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|344409_345069_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001350215.1|345615_345975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284450.1|345967_346510_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000188903.1|346630_346816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000617443.1|347111_347393_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001236873.1|348067_348253_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000560496.1|349247_349637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001147279.1|349707_349935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|349969_350110_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|350109_350373_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|350736_350838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299013.1|356321_357179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
352611:352627	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_001345034.1|357427_358297_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.3e-51
WP_001345033.1|358456_359050_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085948178.1|359130_360343_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000474083.1|360383_360611_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|360719_362045_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000339608.1|362270_363125_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102119.1|363651_364371_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023922.1|364381_365809_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370308.1|365801_366497_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209113.1|366742_367408_-	membrane protein	NA	NA	NA	NA	NA
WP_001159100.1|367620_369291_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 2
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	558229	638121	5359785	protease,head,tRNA,transposase,capsid,tail	Escherichia_phage(33.33%)	69	NA	NA
WP_000186631.1|558229_558709_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|558912_559707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|559844_560186_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|560299_562804_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|563065_563998_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|564000_565293_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|565417_565825_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|565825_566284_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|566280_567198_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|567343_568021_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|568007_568790_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|568852_569707_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|569767_570577_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|570566_571190_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|571160_571847_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|571843_574258_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|578879_579140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|580371_581466_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|581534_582461_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|582690_583173_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|583250_584066_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|584155_585937_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|585949_586726_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|586825_587704_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|587872_589327_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|589386_590748_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|590804_592106_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|592127_593273_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|593401_594187_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|594197_595433_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|595454_596504_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|596820_598488_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|598497_599757_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|599767_600583_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|600579_601473_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|601609_602677_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|602673_603183_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|603300_604023_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|604025_604520_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|604693_606079_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|606114_606636_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|606743_606956_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|606957_607824_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|608304_608847_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|609066_609759_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|609789_612399_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|613450_613966_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|613968_614601_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|615811_616144_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|616199_617225_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|617266_617662_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|617673_617973_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|617993_619206_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|619299_619878_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|619874_620270_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|620277_621018_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|621033_621456_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|621437_621872_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|621864_624045_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|624050_625263_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000239881.1|625333_626002_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|626058_626364_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|626547_628032_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|628218_629172_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|629684_630446_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|630628_631519_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|631519_634492_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|634478_636716_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|636984_638121_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	857655	891724	5359785	head,holin,integrase,transposase,capsid,tail	Enterobacteria_phage(55.26%)	43	852248:852264	884039:884055
852248:852264	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|857655_858732_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000638251.1|858745_859156_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_085948178.1|859139_860353_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075117.1|860358_860556_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_000411800.1|860555_860762_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000023272.1|861209_863060_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|863358_863517_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|863602_864346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|864530_865220_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|865234_865357_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|865696_866656_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|866867_867056_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|867052_867415_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|867411_867702_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|867694_867907_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|867899_868076_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|868075_868435_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|868437_868614_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814614.1|868610_869021_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_000344554.1|868992_869355_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000818841.1|869372_869579_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000145948.1|869651_869942_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001254039.1|871868_873374_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|873410_873758_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|873815_874844_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|874895_875270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|875262_875616_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|875630_876206_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|876202_876598_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|876605_877358_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|877371_877803_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|877829_878243_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_061104268.1|878223_880803_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000847298.1|880799_881129_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000194798.1|881836_882580_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|882525_883155_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514984.1|883395_886872_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
884039:884055	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|886939_887539_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|887603_888917_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|888918_889188_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|889293_890175_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|890398_891229_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|891352_891724_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
>prophage 4
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	1104020	1146579	5359785	protease,holin,transposase	Escherichia_phage(38.46%)	54	NA	NA
WP_000156528.1|1104020_1105781_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1105966_1106419_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1106494_1107535_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1107891_1108401_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1108673_1109249_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1109211_1111374_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1111383_1111830_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1111952_1114007_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1114038_1114497_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1114592_1115255_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1115427_1115841_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1115885_1116203_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1116260_1117451_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1117545_1117824_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1117820_1118150_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1118240_1118900_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1120300_1120543_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|1121705_1122919_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000048507.1|1122970_1124395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1124487_1124679_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1124675_1124864_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1125395_1125770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1125781_1125934_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1126206_1126923_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1126972_1127188_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1127184_1127610_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1127681_1128752_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1128792_1129215_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1129211_1129508_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1129504_1129966_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1129943_1130300_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1130350_1130563_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1130814_1131078_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1131088_1131958_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1132073_1132178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1132366_1132579_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1132746_1133007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1133026_1134076_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1134088_1134460_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1134449_1134821_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1134972_1135791_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1136077_1136275_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1136412_1137126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1137893_1139744_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1140191_1140398_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1140653_1140926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1141085_1141619_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1141839_1141953_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1142174_1142360_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1142886_1143201_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1143282_1143507_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|1143556_1144770_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|1144856_1145750_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1146195_1146579_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	1202115	1269366	5359785	transposase,protease,integrase	Escherichia_phage(23.53%)	58	1194352:1194366	1225578:1225592
1194352:1194366	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_000279869.1|1202115_1203318_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1203504_1205322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1206433_1206730_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1206956_1207154_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|1207372_1208806_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1209626_1210190_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1210344_1212705_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998045.1|1213461_1215000_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_085948178.1|1215211_1216424_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000024297.1|1217281_1217641_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591991.1|1217733_1219353_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1219577_1219853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042352357.1|1220233_1220932_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1221022_1221325_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1221333_1221654_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1221646_1223350_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1223359_1223824_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142973.1|1223824_1224499_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1224510_1225128_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1226339_1226603_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
1225578:1225592	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001135715.1|1226904_1227045_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000435663.1|1230926_1231352_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1231348_1231699_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1231729_1233343_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957251.1|1234285_1234627_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1234613_1234943_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1235203_1235671_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1235688_1236897_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1236907_1237864_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1237863_1238943_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|1238944_1239718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|1239710_1240853_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|1240862_1241921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|1242242_1242824_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|1242823_1243981_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|1244003_1244459_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|1244481_1245522_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|1245570_1246149_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|1246217_1246793_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|1247218_1247605_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|1248118_1250209_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|1251661_1251880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|1252513_1252849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|1253629_1253824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|1253875_1254049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|1254137_1254410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|1254693_1254909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|1254974_1255172_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|1255901_1257026_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|1258379_1258838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|1259295_1259805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|1259893_1260517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|1260612_1260846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|1260898_1261090_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|1261764_1262811_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001304205.1|1263564_1265733_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000502842.1|1267450_1268089_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_085948178.1|1268152_1269366_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	1375077	1461924	5359785	head,holin,terminase,integrase,transposase,capsid,tail	Stx2-converting_phage(33.33%)	99	1370171:1370185	1376652:1376666
1370171:1370185	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1375077_1376196_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1376164_1376434_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1376495_1378961_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1376652:1376666	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1379053_1379245_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1379241_1379430_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1379769_1379910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1379913_1380132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1380172_1380562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1380857_1381136_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1381137_1381329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1381349_1381721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1381818_1382121_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_085948178.1|1382317_1383530_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_162616906.1|1383514_1383856_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1383878_1384841_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151120.1|1384881_1385304_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000004322.1|1385300_1385555_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|1385547_1385859_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|1386164_1386743_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|1386702_1387800_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_085948178.1|1388434_1389648_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|1389685_1389826_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|1389993_1390266_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1390267_1391323_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1391323_1391689_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1391697_1392228_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1392469_1392667_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1392817_1393876_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|1394672_1396523_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000411802.1|1396970_1397177_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1397181_1397526_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1397576_1398110_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1398380_1398950_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1398949_1399096_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1399323_1399509_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1399933_1400161_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1400202_1400568_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1400858_1401422_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1401418_1403080_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_061104266.1|1403143_1405081_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|1405125_1405347_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1408035_1408362_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1408371_1408722_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1408718_1409165_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_110826211.1|1409161_1409506_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	2.5e-57
WP_001275472.1|1409572_1410289_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1410294_1410669_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1410764_1410974_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1411025_1414268_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1414260_1414602_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1414601_1415300_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1415316_1415637_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1415744_1415918_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1416965_1417703_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1417648_1418281_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|1418517_1421994_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|1422061_1422661_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|1422725_1424039_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1424040_1424310_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_122993429.1|1424715_1425729_+	peptidase M85	NA	NA	NA	NA	NA
WP_001079074.1|1426963_1427494_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007759.1|1427836_1428487_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240109.1|1428743_1429379_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000730130.1|1429379_1430384_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920136.1|1430492_1430906_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|1431038_1431710_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826738.1|1431709_1433068_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218214.1|1433175_1434027_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|1434617_1435781_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|1436347_1436713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365565.1|1436752_1437448_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157238.1|1437514_1438933_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|1438913_1439384_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001210913.1|1439372_1440293_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|1440465_1441383_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009309.1|1441461_1441644_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001377491.1|1441814_1443509_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000949111.1|1443505_1444321_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|1444618_1444846_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|1444954_1445197_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|1445240_1445864_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942326.1|1446153_1446939_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|1446946_1447216_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253450.1|1447225_1447963_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001302429.1|1447962_1448328_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|1448330_1448744_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|1448740_1449745_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|1449749_1450214_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620092.1|1450318_1451446_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|1451442_1451886_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213292.1|1451904_1453278_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282694.1|1453277_1453964_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|1453956_1454952_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994449.1|1454944_1456603_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|1456816_1457131_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1457464_1457797_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734033.1|1457965_1458517_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|1458526_1459324_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000826461.1|1460715_1461924_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
>prophage 7
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	1681378	1718477	5359785	head,holin,terminase,plate,portal,tRNA,capsid,tail	Enterobacteria_phage(88.57%)	44	NA	NA
WP_001144192.1|1681378_1683307_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|1683310_1683853_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1683949_1684147_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1684199_1684556_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1684678_1684723_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018594.1|1685006_1685990_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672378.1|1686004_1688392_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1688396_1688696_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078923.1|1689002_1689143_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_000488103.1|1689333_1689594_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001035742.1|1689837_1691340_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000132811.1|1691565_1692675_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_000005431.1|1692832_1694017_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290445.1|1694016_1694529_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000651581.1|1694584_1694959_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000333503.1|1694967_1695123_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853433.1|1695109_1697917_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979957.1|1697929_1698418_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000954196.1|1698574_1699147_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144026.1|1699190_1699769_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000108519.1|1699768_1701901_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000071739.1|1701903_1702434_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111942.1|1702426_1703323_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000213447.1|1703326_1703677_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271894.1|1703673_1704255_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000356341.1|1704251_1704887_-|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920593.1|1704879_1705347_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780569.1|1705484_1705892_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|1705888_1706281_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1706277_1706601_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1706603_1706804_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1706803_1707298_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|1707400_1708201_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055104.1|1708246_1709299_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262673.1|1709322_1710159_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613748.1|1710313_1712065_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_000087824.1|1712064_1713111_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000236489.1|1713125_1713650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390707.1|1714212_1714482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|1714846_1715158_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000686506.1|1715162_1716122_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000514277.1|1717655_1717898_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|1717909_1718188_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_100206497.1|1718198_1718477_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
>prophage 8
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	1841958	1944834	5359785	protease,head,holin,lysis,terminase,portal,integrase,transposase,capsid,tail	Stx2-converting_phage(30.0%)	114	1867830:1867859	1924852:1924881
WP_001260840.1|1841958_1842780_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1842879_1842963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032353667.1|1843055_1843391_-	acid shock protein	NA	NA	NA	NA	NA
WP_110826212.1|1843787_1845041_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1845147_1846041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1846175_1847396_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1847520_1848216_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071526378.1|1848168_1849461_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1849619_1850234_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1850276_1851131_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1851132_1851750_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1851760_1854184_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|1857646_1857952_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1858059_1858770_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1858772_1859333_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1859367_1859709_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1859843_1860170_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1860375_1861590_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1861601_1862621_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|1862678_1862789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876990.1|1862808_1864089_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001296941.1|1864123_1864360_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048302.1|1864447_1866919_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|1867012_1867204_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1867200_1867389_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|1867804_1868092_+	hypothetical protein	NA	NA	NA	NA	NA
1867830:1867859	attL	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_001344637.1|1868060_1868426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|1868437_1868590_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|1868782_1869190_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|1869267_1869495_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705364.1|1869478_1870000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|1869980_1870946_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_085948952.1|1871284_1872497_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.2e-168
WP_085948953.1|1872463_1872544_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.2e-06
WP_001064906.1|1872628_1873318_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_085948178.1|1873584_1874798_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344632.1|1875057_1875189_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143036.1|1875636_1877487_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411811.1|1877932_1878139_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|1878143_1878488_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|1878538_1879072_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_012578895.1|1879589_1879775_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736096.1|1879860_1880085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|1880453_1880681_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|1880722_1881088_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000958415.1|1881377_1881941_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1881937_1883599_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000173011.1|1883662_1885600_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|1885644_1885866_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012817878.1|1885811_1888391_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_000125990.1|1888393_1888720_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1888729_1889080_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1889076_1889523_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1889519_1889864_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_024222395.1|1889930_1890647_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	1.3e-124
WP_001030041.1|1890652_1891027_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001453698.1|1891122_1891332_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000937595.1|1893440_1894628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|1894627_1894993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369428.1|1895011_1896454_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000807940.1|1896446_1896788_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369426.1|1896787_1897486_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_001369422.1|1897491_1898235_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_096860308.1|1898180_1898813_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_000514717.1|1899155_1902629_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_001228290.1|1902696_1903296_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|1903447_1904752_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|1904753_1905023_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|1906137_1906260_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1906366_1907278_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_085948178.1|1907824_1909038_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303943.1|1910064_1910343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1910770_1910917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1911053_1911701_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|1911884_1912475_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001261191.1|1914980_1915334_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|1915424_1916144_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1916183_1916582_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1916686_1917226_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|1917255_1917999_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1918355_1918994_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1919039_1920170_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1920147_1920396_-	excisionase	NA	NA	NA	NA	NA
WP_000048484.1|1920460_1922932_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|1923027_1923216_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1923212_1923401_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1923800_1923968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1923961_1924195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1924172_1924580_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|1924602_1924821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1924893_1925193_-	hypothetical protein	NA	NA	NA	NA	NA
1924852:1924881	attR	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_000787428.1|1925457_1925865_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1926151_1926703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1926674_1927715_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1927626_1928169_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|1928202_1928937_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|1928933_1929098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1929796_1930555_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1930833_1931046_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1931266_1931524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|1931593_1931872_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|1931873_1932929_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1932929_1933295_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1933291_1933981_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|1935508_1937278_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_085948178.1|1937329_1938542_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064764776.1|1938508_1938631_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_001023452.1|1938632_1938902_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1939042_1939918_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|1940142_1940793_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1941388_1941703_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1941762_1943046_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1943134_1944595_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1944630_1944834_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2084056	2203245	5359785	head,holin,terminase,tRNA,integrase,transposase,capsid,tail	Escherichia_phage(41.67%)	120	2110351:2110367	2202378:2202394
WP_000826406.1|2084056_2085265_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|2085791_2086460_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2086762_2087356_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|2087352_2088345_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|2088536_2089448_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2089442_2089979_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2090041_2090266_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2090405_2092061_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|2092285_2093629_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|2093845_2094769_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|2094806_2096447_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2096845_2096995_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2097066_2097240_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2097484_2098015_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2098203_2099205_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2100745_2101546_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|2101817_2105720_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2105920_2106526_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|2106576_2107893_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|2107882_2109640_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|2109655_2110552_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2110351:2110367	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177525.1|2110551_2111157_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|2111327_2113634_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2113697_2114558_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|2114788_2115379_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|2115360_2116311_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2116411_2117725_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2117751_2118957_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2118956_2119379_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|2119368_2120796_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|2120797_2121586_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2121585_2122353_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|2122349_2123420_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2123427_2123925_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|2123939_2124686_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2124694_2124982_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2124993_2125923_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|2126207_2128253_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|2128500_2130774_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|2132553_2133459_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|2133630_2133960_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2133964_2134150_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|2134146_2136786_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2136993_2137983_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|2138093_2138516_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2138512_2138779_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|2139052_2142577_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|2142943_2144077_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|2144217_2144652_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2145232_2145874_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2145955_2146585_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2146657_2147233_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2147345_2147615_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|2147616_2148930_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|2148994_2149594_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2149664_2153162_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2153295_2153823_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2154013_2154646_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2154591_2155335_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2155345_2156044_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2156043_2156385_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212770.1|2156377_2159620_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_001453698.1|2159672_2159882_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2159977_2160352_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275480.1|2160357_2161074_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_000133393.1|2161142_2161487_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2161483_2161930_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2161926_2162277_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2162286_2162613_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2164977_2165199_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_110826213.1|2165243_2167181_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_097638330.1|2167244_2168906_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958398.1|2168902_2169466_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_000829192.1|2169754_2170120_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2170161_2170362_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2170493_2170820_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2171220_2171406_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2171628_2171760_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000285960.1|2171854_2172031_-	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_085948178.1|2172107_2173320_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344811.1|2173323_2173863_-	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_000992086.1|2174136_2174670_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2174720_2175065_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2175069_2175285_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143077.1|2175434_2177288_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2177858_2178290_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2178851_2179406_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2179402_2179693_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2179692_2180292_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2180791_2182183_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2182182_2183172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2183139_2184291_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2184722_2184968_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2185046_2185208_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2185218_2185482_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2185733_2185946_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2186051_2186474_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2186489_2187251_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2187273_2188020_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2188026_2188815_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2188892_2189315_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2189311_2189566_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2189645_2190065_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2190307_2190487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2190497_2190653_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2190649_2191138_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2191579_2191801_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2191800_2191971_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2192045_2192321_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2192422_2195023_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2195015_2195825_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2195880_2196030_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2196067_2196256_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2196355_2196571_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2196572_2197808_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2197859_2198795_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|2198923_2200297_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|2200326_2200500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2200774_2201758_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2202012_2203245_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2202378:2202394	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 10
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2263629	2337958	5359785	protease,holin,terminase,portal,transposase,tail	Enterobacteria_phage(41.82%)	82	NA	NA
WP_085948178.1|2263629_2264842_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001288368.1|2266873_2267047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088625.1|2267136_2267886_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|2268154_2268373_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|2268498_2268825_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|2268824_2269562_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|2269753_2270923_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|2270929_2271238_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256539.1|2271386_2272151_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|2272320_2272911_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099519.1|2272974_2275650_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|2275813_2275909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|2276022_2276190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|2276192_2276357_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|2276651_2277626_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001297122.1|2277835_2280433_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|2280812_2281064_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|2281099_2282149_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|2282368_2283127_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2283123_2283714_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2283753_2284626_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2284726_2285347_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2285343_2286225_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2286362_2286407_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|2286498_2288061_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2288060_2289656_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2289659_2291018_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2291029_2292223_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2292222_2293029_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2293409_2293589_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2293674_2294175_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2294220_2294727_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|2295763_2296354_-	protein kinase	NA	NA	NA	NA	NA
WP_085948178.1|2297500_2298713_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_110826214.1|2298679_2298793_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	87.1	1.7e-07
WP_001023476.1|2298802_2299072_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|2299073_2300387_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|2300451_2301051_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2301118_2304595_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2304831_2305464_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001344666.1|2305409_2306153_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_000847298.1|2306860_2307190_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918237.1|2307186_2309832_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2309875_2310184_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2310210_2310633_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2310646_2311399_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_001444799.1|2311406_2311697_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
WP_085948178.1|2311751_2312964_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|2312967_2313114_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_000974958.1|2313126_2313750_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|2313752_2314034_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|2314026_2314353_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2314440_2316465_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2316409_2317912_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|2317911_2318124_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|2318120_2320244_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2320240_2320717_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012578895.1|2321192_2321378_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992150.1|2321896_2322430_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_136833288.1|2322466_2322820_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.5	5.3e-47
WP_032350783.1|2322806_2323022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072901.1|2323025_2323241_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290214.1|2323318_2323564_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|2323604_2323784_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142980.1|2323921_2325868_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000483498.1|2326462_2327521_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000917735.1|2327671_2327869_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2328095_2328917_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904137.1|2328913_2329288_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001344904.1|2329300_2330350_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_001447497.1|2330351_2330630_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001260976.1|2330765_2331023_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_000220602.1|2331028_2331328_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_000610381.1|2331533_2331887_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000137950.1|2331883_2332255_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000403788.1|2332350_2332707_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_001209477.1|2332684_2333146_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_001444682.1|2333142_2333439_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_072127369.1|2333435_2333717_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_000075578.1|2333749_2334286_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_085948178.1|2334349_2335563_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000268365.1|2337409_2337958_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
>prophage 11
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2439174	2510802	5359785	head,holin,terminase,portal,tRNA,integrase,transposase,capsid,tail	Escherichia_phage(32.26%)	81	2483730:2483789	2516402:2517712
WP_001297484.1|2439174_2440281_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2440316_2440958_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2440961_2442332_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2442499_2443171_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2443170_2444631_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2444706_2445828_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359442.1|2445973_2447203_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2447452_2448589_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799400.1|2448572_2449436_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938117.1|2449799_2451161_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_001303921.1|2451221_2451497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|2451576_2451702_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_000145590.1|2451724_2452303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001369471.1|2452471_2455873_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_001301673.1|2456463_2458812_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2458831_2458921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|2459027_2459297_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_071925134.1|2459298_2460621_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.3	3.7e-77
WP_001230459.1|2460685_2461285_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000514853.1|2461351_2464831_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_122996286.1|2465077_2465710_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2465655_2466399_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2466404_2467103_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2467102_2467432_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|2467428_2470041_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|2470021_2470435_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2470461_2470884_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2470897_2471650_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2471657_2472053_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2472049_2472583_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2472598_2472952_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2472944_2473328_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2473379_2474408_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2474465_2474813_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2474849_2476355_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2476344_2477937_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2477933_2478140_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2478123_2480052_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2480023_2480530_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2480956_2481181_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2481262_2481577_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2482104_2482290_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2482807_2483341_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000638258.1|2483383_2483788_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
2483730:2483789	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|2483771_2484985_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000284516.1|2485216_2485432_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2485508_2485781_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2485821_2486001_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_061104286.1|2486135_2488073_-	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	96.9	0.0e+00
WP_000466957.1|2488551_2488983_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2489070_2489496_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2489492_2489843_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2489873_2491487_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2491972_2492686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2492820_2493018_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2493241_2493796_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2493804_2494164_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2494176_2495226_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2495227_2495500_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2495621_2495966_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2496085_2496298_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2496531_2497089_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2497090_2497309_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2497436_2497748_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2497740_2497968_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2497964_2498246_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2498278_2498995_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2499016_2499763_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2499769_2500840_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2500911_2501337_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2501320_2501602_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2501701_2502121_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2502386_2502539_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2502550_2503189_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2503189_2503399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2503969_2504158_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2504154_2504346_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_078163380.1|2504438_2505923_+	exonuclease	NA	NA	NA	NA	NA
WP_085948178.1|2505928_2507141_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001300307.1|2508374_2509172_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2509527_2510802_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2516402:2517712	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGACATTATTATAACAATCCACTAATACCCTGGCTTTATCTTCCCCTTTTGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTGAATTTTTGCTATTAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAATTAAGCGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCTCACTTAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAAATGCCCATGTCATGGGTACGGGAGCCCGGAGATTCTGATCCATCCGGGACGCGTTCTTGCACAAAGGGGAGTAGCACTTCATGGTTAAATCAACAACCTGAAAATTCGTTTTTGCTTTCAACTGACTGATAAATATCATCGTTTTCAGGTTCTTTTTACGCATCGCCTCTATACAAAGATCCGGCGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTGCGTGATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTTTTCAAGTTTAAGTGCATTAAACACTTCTAAATTAATTGTCGACGTAACAATTAAAAGATGCTTAATTTTATGCAATTCAAGCGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGGTCGGGAATATGGATGACAACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAAATGCAATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTATAATACAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTATGTTTCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCCTGCGCTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAAACATTTGCAGATGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAGTTACCTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACGCTCATCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCGTTAGGCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACCGCCGCACTGGTGT	NA	NA	NA	NA
>prophage 12
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2515205	2582953	5359785	head,holin,coat,lysis,terminase,portal,integrase,transposase,tail	Enterobacteria_phage(46.38%)	87	2517131:2517145	2584632:2584646
WP_085948178.1|2515205_2516418_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2517131:2517145	attL	AGCATCGCCAATCTG	NA	NA	NA	NA
WP_001060244.1|2518957_2520412_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532913.1|2520754_2521471_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011007.1|2523860_2524811_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011461.1|2524912_2525830_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986337.1|2526287_2527223_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193804.1|2527284_2528364_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|2528375_2529119_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_096861628.1|2531959_2532721_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_000775497.1|2532856_2533540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2533555_2533966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234505.1|2534186_2535008_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
WP_000860076.1|2535089_2535569_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2535584_2536061_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2536129_2536351_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285585.1|2536424_2536793_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988599.1|2537251_2537446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2537458_2537572_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016348.1|2538060_2538243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2538343_2538673_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001105393.1|2540101_2540575_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001369224.1|2540689_2541856_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
WP_001345271.1|2542709_2543618_+	acyltransferase	NA	NA	NA	NA	NA
WP_000129903.1|2543658_2545596_-|tail	tail spike protein	tail	A0A140G5Z9	Enterobacteria_phage	88.9	1.9e-271
WP_001084290.1|2545774_2546710_-	phage antirepressor Ant	NA	A0A2H4FRZ6	Salmonella_phage	99.0	2.2e-177
WP_000677939.1|2546778_2546940_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_000090241.1|2547030_2547282_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000821222.1|2547298_2547718_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_001334102.1|2547855_2548224_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_001345269.1|2548248_2550087_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.6	4.7e-248
WP_000382045.1|2550086_2551493_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.2	1.2e-126
WP_000964882.1|2551502_2552195_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000627632.1|2552197_2552653_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
WP_000785561.1|2552652_2553354_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	97.0	5.1e-118
WP_000947776.1|2553346_2553880_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	48.3	1.1e-35
WP_001122404.1|2553901_2555320_-	Packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	91.5	5.3e-255
WP_001140510.1|2555329_2555791_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001444886.1|2555771_2555960_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	3.2e-27
WP_000013275.1|2556001_2557255_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.6	1.7e-233
WP_000372576.1|2557273_2558167_-	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	3.7e-129
WP_032353816.1|2558257_2560456_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
WP_000200766.1|2560457_2561873_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_001436504.1|2561869_2562292_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000205033.1|2562315_2562495_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
WP_000139136.1|2562504_2562792_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
WP_000807789.1|2562795_2563038_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_000999693.1|2563141_2563522_-	hypothetical protein	NA	Q716B1	Shigella_phage	96.8	6.7e-64
WP_001059339.1|2563753_2564278_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_000092296.1|2564478_2564916_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229402.1|2564912_2565389_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	98.7	4.9e-88
WP_000783734.1|2565372_2565696_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000512813.1|2566157_2566676_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.7	5.0e-94
WP_001271131.1|2566666_2567338_-	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	98.2	2.1e-129
WP_000144614.1|2567315_2567522_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001223932.1|2567518_2568121_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	96.6	9.8e-94
WP_001108084.1|2568095_2568662_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000566872.1|2568654_2568825_-	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	1.2e-25
WP_001254257.1|2568821_2569004_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000153271.1|2569000_2569528_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
WP_001303571.1|2569524_2569971_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2569927_2570164_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2570174_2570390_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2570522_2570801_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|2570870_2571140_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131499.1|2571139_2572576_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.8	1.4e-274
WP_024222284.1|2572565_2573465_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	98.7	3.0e-163
WP_000166207.1|2573457_2573604_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438527.1|2573636_2573933_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000067727.1|2574074_2574290_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_016242500.1|2574365_2575061_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000088201.1|2575406_2575679_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000214161.1|2575807_2576008_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	6.0e-32
WP_000167579.1|2576073_2576544_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	8.2e-88
WP_000050554.1|2576984_2577155_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031374.1|2577165_2577771_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	2.1e-107
WP_000951320.1|2577770_2578154_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_001111307.1|2578177_2578471_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	3.2e-50
WP_032353655.1|2578481_2578649_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	94.5	1.4e-21
WP_000109677.1|2578645_2578945_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.1e-56
WP_001033097.1|2578946_2579501_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	87.7	1.0e-57
WP_000797282.1|2579673_2579862_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000951710.1|2579863_2580073_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_000208130.1|2580069_2580873_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	50.6	2.2e-48
WP_000002108.1|2580865_2581150_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	9.1e-50
WP_000227131.1|2581221_2581521_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	3.0e-51
WP_000132739.1|2581602_2581794_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007947.1|2581774_2582953_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
2584632:2584646	attR	AGCATCGCCAATCTG	NA	NA	NA	NA
>prophage 13
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2777396	2846261	5359785	protease,holin,lysis,terminase,integrase,transposase,capsid	Enterobacteria_phage(20.0%)	63	2815339:2815374	2847201:2847236
WP_000101907.1|2777396_2778638_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2779134_2779341_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2779295_2781104_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_024174018.1|2781319_2781766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2781758_2781992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2781997_2782297_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2782293_2783694_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2783895_2784141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2784271_2784466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2784469_2784631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2784758_2785247_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2785409_2786333_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2789709_2790357_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2790391_2791444_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2791440_2791998_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2791994_2793938_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|2793934_2794414_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2794410_2794620_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2794616_2795354_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2795395_2796058_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2796054_2796672_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2796690_2797293_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2797302_2797752_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2797748_2798612_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2798598_2799294_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2799300_2801787_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2801783_2802047_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2802036_2802531_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2802939_2803428_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2803576_2805223_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2805440_2807084_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2807159_2807810_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2807809_2808874_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2808947_2810003_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2810114_2811206_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2811944_2814617_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2814633_2815284_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2815339:2815374	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2815483_2818333_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2818607_2819384_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2819388_2821038_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|2821038_2825433_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2826234_2827557_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2828250_2828889_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_085948178.1|2828926_2830139_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000881316.1|2830179_2830704_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2830853_2831291_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2831287_2831785_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2831784_2832000_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2832142_2832541_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2832621_2832780_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2833872_2834496_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2834492_2835158_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2835154_2835757_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2835731_2836298_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2836821_2837754_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2837792_2838620_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2839123_2839306_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2839462_2839807_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2839912_2840131_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2840108_2841179_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2841173_2841800_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2841796_2843485_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2843633_2846261_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2847201:2847236	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 14
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	2934936	3027007	5359785	protease,bacteriocin,lysis,holin,terminase,portal,tRNA,integrase,transposase,capsid,tail	Escherichia_phage(38.75%)	106	2966488:2966512	3027202:3027226
WP_001283576.1|2934936_2935749_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2935748_2936762_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2936827_2937964_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2938062_2939058_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2939054_2940233_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2940516_2941737_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|2941895_2943902_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2944022_2944301_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2944334_2944883_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2944882_2945692_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2945691_2946516_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2946519_2947605_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2947639_2948572_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2948737_2949289_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2949361_2950213_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2950214_2950754_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2950750_2951239_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2951235_2951745_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032353769.1|2951760_2952513_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112824.1|2952532_2955178_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2955259_2955823_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2956506_2956992_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2957194_2959339_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2959338_2960649_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2960828_2961113_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2961484_2962825_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2963191_2964250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2964431_2965187_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2965480_2966413_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2966488:2966512	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000331702.1|2966635_2974987_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	100.0	0.0e+00
WP_000012437.1|2975056_2976322_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|2976332_2976584_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|2976594_2977041_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|2977043_2977697_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|2977790_2978192_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_001135718.1|2978247_2978388_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	2.0e-18
WP_000835365.1|2978621_2979356_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q08J76	Stx2-converting_phage	100.0	5.7e-136
WP_001447645.1|2979446_2980064_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	100.0	8.8e-122
WP_001369201.1|2980069_2980351_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|2980365_2981634_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001146318.1|2981630_2983256_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	100.0	0.0e+00
WP_000276175.1|2983578_2983806_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	100.0	1.2e-39
WP_000537687.1|2983818_2984364_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	100.0	6.8e-94
WP_061104281.1|2984439_2986704_-|tail	phage tail protein	tail	Q08J84	Stx2-converting_phage	89.3	1.1e-76
WP_000207915.1|2986700_2987351_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	100.0	7.8e-121
WP_000829199.1|2987350_2987914_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	98.9	3.5e-101
WP_001447720.1|2987897_2988359_-	hypothetical protein	NA	Q08J87	Stx2-converting_phage	100.0	6.6e-74
WP_001140444.1|2988408_2988798_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|2988852_2990067_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345014.1|2990090_2991098_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	100.0	1.8e-180
WP_015983544.1|2991255_2993400_-|portal	phage portal protein	portal	Q08J91	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|2993399_2995106_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|2995086_2995893_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001301714.1|2995948_2996152_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|2996301_2996595_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|2996626_2997091_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|2997098_2997248_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2997247_2997817_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|2998091_2998625_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|2998629_2998845_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|2998921_2999194_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|2999234_2999414_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_085948178.1|3000841_3002054_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_032353896.1|3002094_3002799_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	5.1e-134
WP_000738068.1|3003284_3003554_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3003565_3004525_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3004907_3005060_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204844.1|3005308_3005743_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|3005735_3005930_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108022.1|3005926_3006532_-	recombination protein NinG	NA	G9L693	Escherichia_phage	100.0	8.6e-98
WP_001292290.1|3006531_3007254_-	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_000566871.1|3007246_3007417_-	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_001254257.1|3007413_3007596_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_015983551.1|3007592_3008120_-	phage N-6-adenine-methyltransferase	NA	Q08J31	Stx2-converting_phage	100.0	1.2e-100
WP_000573864.1|3008116_3008719_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3008711_3009128_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3009301_3009517_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_000818843.1|3009661_3009868_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036031.1|3009940_3010210_-	hypothetical protein	NA	Q08J36	Stx2-converting_phage	100.0	4.9e-45
WP_000131492.1|3010209_3011646_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3011635_3012535_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3012527_3012674_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_001535912.1|3012706_3013003_-	phage regulatory protein CII	NA	Q9EYB4	Enterobacteria_phage	98.0	5.8e-47
WP_000247282.1|3013122_3013353_-	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	100.0	2.1e-36
WP_077792758.1|3013500_3014193_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	100.0	4.5e-135
WP_032346936.1|3014517_3014961_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	61.9	2.4e-44
WP_085948178.1|3015319_3016533_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000065374.1|3017030_3017399_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3017471_3017636_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|3017604_3017748_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3017823_3018120_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000186866.1|3018905_3019586_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682304.1|3019582_3019765_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|3019737_3019929_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|3019939_3020221_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|3020319_3020541_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289935.1|3020537_3021311_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000797281.1|3021462_3021651_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|3021652_3021862_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000203836.1|3023329_3023953_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3023995_3024163_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000163445.1|3024389_3025022_+	adenine methylase	NA	Q08J66	Stx2-converting_phage	100.0	3.3e-124
WP_106898674.1|3025030_3025189_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.1	1.1e-20
WP_000994801.1|3025224_3025593_+	DUF1627 domain-containing protein	NA	A0A0P0ZCA9	Stx2-converting_phage	100.0	8.8e-53
WP_000453637.1|3025671_3025854_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3025837_3027007_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
3027202:3027226	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 15
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	3256695	3341995	5359785	protease,terminase,portal,tRNA,tail	Enterobacteria_phage(75.0%)	88	NA	NA
WP_001298974.1|3256695_3257433_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3257564_3258899_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3259108_3259990_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3260093_3260681_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3260736_3261120_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3261423_3262113_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3262160_3263198_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3263404_3263824_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3263892_3264591_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3264622_3267283_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3267396_3268752_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3268776_3269121_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3269117_3270416_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3276268_3278842_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3278971_3279703_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3279699_3280680_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3280814_3281552_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3281822_3282164_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3282267_3282315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3282413_3283574_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3283616_3284738_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3284748_3285819_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3286028_3286394_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3286543_3287062_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3287051_3288278_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3288293_3288776_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3288852_3289200_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3289241_3290009_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3290039_3290588_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3290606_3290855_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3291103_3292465_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189267.1|3292556_3293423_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3293443_3294730_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3294784_3295378_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3295500_3296379_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3296464_3298126_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3298274_3298616_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3298677_3298968_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3298957_3299434_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3299565_3300048_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3300896_3301145_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3301512_3301782_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000279058.1|3301783_3303106_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001230455.1|3303170_3303770_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|3303837_3307314_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|3307560_3308193_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3308138_3308882_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3308887_3309586_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3309585_3309915_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|3309911_3312557_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|3312600_3312909_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3312935_3313358_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3313371_3314124_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3314131_3314530_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3314542_3315166_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3315168_3315450_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3315442_3315769_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3315856_3317881_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3317825_3319328_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|3319327_3319540_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3319536_3321660_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|3321656_3322133_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3322607_3322793_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|3323796_3324066_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3324075_3325023_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3325529_3325964_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3325956_3326151_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3326147_3326753_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000211413.1|3327550_3328255_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001254256.1|3328529_3328712_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3328708_3329236_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3329232_3329679_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3329635_3329872_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3329882_3330098_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3330230_3330509_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|3330578_3330848_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131492.1|3330847_3332284_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3332273_3333173_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3333165_3333312_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_001177653.1|3333346_3333625_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000335772.1|3334500_3335124_+	hypothetical protein	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
WP_000532424.1|3335124_3335637_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_001111331.1|3335650_3335944_+	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_001214463.1|3335954_3336122_+	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_110826215.1|3336118_3336718_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	99.5	2.0e-110
WP_000448925.1|3338037_3338454_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3338526_3340275_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3340276_3341995_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
>prophage 16
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	3413523	3420663	5359785		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3413523_3416085_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3416190_3416847_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272549.1|3416897_3417695_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3417860_3418769_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3418765_3420028_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3420024_3420663_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	3656463	3711125	5359785	protease,transposase,tRNA,integrase	Staphylococcus_phage(25.0%)	49	3689982:3689997	3708022:3708037
WP_001297457.1|3656463_3657222_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|3657277_3658021_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000193113.1|3658007_3659117_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160333632.1|3659120_3659981_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|3659977_3660727_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|3660752_3661238_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|3661248_3661677_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252647.1|3661795_3664594_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|3664852_3665773_-	agmatinase	NA	NA	NA	NA	NA
WP_000758903.1|3665908_3666640_-	membrane protein	NA	NA	NA	NA	NA
WP_001344776.1|3666785_3668762_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001338822.1|3668770_3668902_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3669037_3669253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3669556_3670711_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3671146_3672541_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3672617_3673115_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3673209_3673917_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3673996_3674728_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3674740_3675691_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3675727_3676363_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3676362_3676779_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055633.1|3676954_3677935_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3677952_3678657_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3678674_3679241_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3679237_3679528_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3679535_3680129_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239919.1|3680121_3681258_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3681571_3682558_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|3682602_3683106_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378946.1|3683105_3684407_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745216.1|3684462_3685470_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394117.1|3685586_3686633_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3686808_3687528_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3687711_3688038_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3688037_3688757_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3688917_3689970_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
3689982:3689997	attL	ATAAAGAGGATGATTT	NA	NA	NA	NA
WP_000091700.1|3689997_3690273_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3690337_3691417_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3691618_3692875_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839773.1|3692924_3695060_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234516.1|3695457_3696165_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218764.1|3696543_3697803_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	8.4e-79
WP_085948178.1|3698246_3699459_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001121747.1|3701498_3703148_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000609741.1|3704793_3705468_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000823907.1|3707384_3708203_-	YjiK family protein	NA	NA	NA	NA	NA
3708022:3708037	attR	AAATCATCCTCTTTAT	NA	NA	NA	NA
WP_001358534.1|3708330_3709476_-	type III secretion system LEE effector EspG	NA	NA	NA	NA	NA
WP_000878223.1|3709962_3710829_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.9e-51
WP_000169527.1|3710825_3711125_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	4947450	4992366	5359785	head,holin,terminase,tRNA,capsid,tail	Stx2-converting_phage(39.53%)	47	NA	NA
WP_000956557.1|4947450_4947984_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|4948401_4948683_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4948719_4949292_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4949291_4950026_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4950028_4950220_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829414.1|4950272_4950689_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
WP_000145671.1|4950835_4951309_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4951305_4951656_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4951646_4952183_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4952310_4953135_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4953200_4953563_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4954266_4954959_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4955056_4955317_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4955309_4955861_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4957373_4958126_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4958435_4958588_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4959405_4961256_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|4961704_4961911_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4961910_4962408_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4962624_4962810_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4963337_4963652_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958380.1|4964552_4965116_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|4965112_4966774_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_110826213.1|4966837_4968775_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063025.1|4968819_4969041_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|4971405_4971732_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|4971741_4972092_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|4972088_4972535_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|4972531_4972876_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275480.1|4972944_4973661_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_001030060.1|4973666_4974041_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|4974136_4974346_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212770.1|4974397_4977640_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_000807964.1|4977632_4977974_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|4977973_4978672_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|4978682_4979426_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4979371_4980004_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000514845.1|4980239_4983716_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|4983784_4984408_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4984472_4985786_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4985787_4986057_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4986217_4986640_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4986769_4987828_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4987906_4988557_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4988739_4989330_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4989831_4990080_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4991328_4992366_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP029692	Escherichia coli strain SD134209 chromosome, complete genome	5359785	5107002	5170865	5359785	protease,transposase,tRNA,integrase	Vibrio_phage(12.5%)	60	5148741:5148770	5174232:5174261
WP_000811566.1|5107002_5107278_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|5107394_5109020_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|5109103_5110267_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|5110269_5110908_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5110917_5111316_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|5111333_5111993_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5112043_5112742_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5112760_5113162_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|5113288_5114020_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|5114199_5116560_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|5116598_5117024_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5117228_5118527_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5118630_5118828_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5118909_5119914_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5119916_5121176_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460353.1|5121261_5122542_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|5122618_5122927_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|5123012_5123963_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|5123955_5125803_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|5125812_5127150_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|5127168_5127630_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|5127601_5129149_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|5129147_5130287_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|5130269_5130323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|5131186_5131732_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|5131826_5132879_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|5132975_5133944_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|5133965_5137289_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|5137317_5137632_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|5137628_5137943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|5137994_5139497_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|5139715_5140693_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|5141017_5142826_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|5142818_5143553_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|5143563_5143959_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|5143969_5144329_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|5144391_5145525_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|5145613_5146147_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|5146143_5146461_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|5146642_5146789_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|5146899_5147025_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|5147076_5147643_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|5147684_5148713_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
5148741:5148770	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
WP_001008073.1|5149102_5149972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|5150175_5150529_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|5150666_5152313_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|5152356_5152650_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|5152925_5154182_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|5154197_5154674_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|5155010_5156447_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|5156564_5157866_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|5157981_5158320_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|5158295_5159993_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|5160029_5160605_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|5160984_5162250_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000631719.1|5163911_5164259_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|5166580_5167129_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001453071.1|5167701_5167875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|5169267_5170481_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254202.1|5170574_5170865_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5174232:5174261	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_CP029690	Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence	188342	38083	79881	188342	integrase,transposase	Escherichia_phage(40.0%)	46	59770:59786	90135:90151
WP_085948178.1|38083_39296_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000045554.1|40113_40989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120823.1|41047_41425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000810456.1|41485_42472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000180136.1|42531_43584_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_000129110.1|43622_43892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143798.1|43962_45090_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000667080.1|45167_47180_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000192122.1|47251_47473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113001.1|47566_48820_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
WP_001019609.1|49094_49619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351467.1|49696_50575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691116.1|50645_51581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644670.1|51658_52579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351466.1|52651_53587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185349.1|53763_54720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111914.1|55132_55402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351465.1|55456_56047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072212.1|56054_56312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351464.1|56385_56922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|57016_58230_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000232334.1|58314_58707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000550467.1|58924_59200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135563.1|59288_60248_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
59770:59786	attL	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_001198597.1|60258_61167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418845.1|61102_61447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086279.1|61471_62653_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|62867_63080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356349.1|63386_63662_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	5.0e-45
WP_162616904.1|63706_63841_+	hypothetical protein	NA	Q71TF0	Escherichia_phage	100.0	3.8e-14
WP_000055351.1|63837_64083_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	100.0	2.5e-40
WP_000807689.1|64664_65420_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|66904_67978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077870188.1|68234_68723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|69380_69773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493077.1|70185_70389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255860.1|70543_71749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778959.1|71918_72410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|72848_73655_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_001178596.1|73772_74180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000097904.1|74487_74937_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.3	4.9e-05
WP_001287388.1|75702_76107_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_016695105.1|76368_76641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|77005_77842_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|77841_78645_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_085959879.1|78751_79881_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
90135:90151	attR	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP029691	Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence	78329	2288	65758	78329	transposase	Escherichia_phage(21.43%)	57	NA	NA
WP_000937595.1|2288_3476_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|3475_3841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997720.1|3875_4130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034091.1|4636_8602_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_085952195.1|8921_10135_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001172748.1|11160_11550_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445936.1|12509_12905_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921961.1|12904_13864_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_077629034.1|14136_15039_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086162.1|15423_15795_+	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_000937595.1|15901_17089_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|17088_17454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072106536.1|17826_18129_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271680.1|18175_18598_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|18594_18786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013279293.1|19061_19286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|19823_20054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170683.1|20105_21467_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_071600428.1|22227_22488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175643.1|22538_22733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290792.1|22960_23488_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
WP_000006004.1|23543_23777_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145472.1|23835_25794_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
WP_000845949.1|25848_26283_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|26279_26999_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|27010_27199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|27278_27437_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001427866.1|27790_28015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032351767.1|27937_28126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|28358_28646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|28766_29588_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_001151524.1|30807_31191_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283394.1|31377_32067_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001309237.1|32165_32561_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994781.1|32593_32953_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012104.1|32967_33279_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399800.1|33300_33867_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|33877_34582_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146670.1|34581_36009_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002783.1|35998_36589_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001369729.1|36575_36698_+	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|38479_39693_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000628099.1|41409_41919_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850424.1|41932_42664_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001369365.1|42916_45070_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000986985.1|45069_50340_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205714.1|50359_51106_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
WP_000704529.1|51164_52025_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139321.1|52127_52688_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001171554.1|52837_53218_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000998093.1|53612_55151_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
WP_001213544.1|55969_57409_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|57412_59533_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_032350743.1|59582_62579_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|62580_63096_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000091308.1|64205_64571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|64570_65758_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
