The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	532206	541465	3052122	integrase	Streptococcus_phage(33.33%)	8	526287:526300	548588:548601
526287:526300	attL	CGCTGAGCCAAACT	NA	NA	NA	NA
WP_003564258.1|532206_532704_+|integrase	tyrosine-type recombinase/integrase	integrase	U5U4L5	Lactobacillus_phage	87.9	2.2e-59
WP_003564255.1|533108_533699_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003564253.1|533815_534271_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564251.1|534656_535604_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564250.1|535608_536637_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564248.1|536633_537521_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564246.1|537683_538223_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_110344262.1|538573_541465_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	5.4e-307
548588:548601	attR	AGTTTGGCTCAGCG	NA	NA	NA	NA
>prophage 2
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	940384	951092	3052122	integrase	Lactobacillus_phage(90.0%)	19	947032:947046	954971:954985
WP_019909842.1|940384_941209_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	3.0e-117
WP_110344322.1|941223_941973_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.9	4.0e-36
WP_019916966.1|941965_942280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344323.1|942356_942560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344324.1|942644_943001_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	96.6	5.9e-62
WP_045137041.1|943066_943318_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_110344326.1|943512_944040_-	hypothetical protein	NA	A0A2H4J505	uncultured_Caudovirales_phage	41.7	3.6e-15
WP_110344327.1|945133_945373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344328.1|945379_945613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344329.1|945613_945826_-	helix-turn-helix transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	95.7	1.6e-30
WP_110344330.1|946083_946410_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	97.2	3.2e-54
WP_110344331.1|946406_946811_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	94.0	2.4e-72
WP_110344332.1|946883_947663_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	91.5	3.2e-105
947032:947046	attL	TTGACAATGGTATTC	NA	NA	NA	NA
WP_162596394.1|948054_948402_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_110344334.1|948504_948693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344335.1|948856_949138_+	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	53.8	2.1e-22
WP_110344336.1|949160_949496_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_110344337.1|949550_949814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344338.1|949922_951092_+|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	94.3	1.7e-211
954971:954985	attR	TTGACAATGGTATTC	NA	NA	NA	NA
>prophage 3
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1417754	1451853	3052122	protease,bacteriocin,transposase,holin	Streptococcus_phage(40.0%)	37	NA	NA
WP_094515892.1|1417754_1418633_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562610.1|1418729_1419389_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562608.1|1419437_1420022_-	DNA-binding ferritin-like protein	NA	NA	NA	NA	NA
WP_003562606.1|1420169_1420397_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003562604.1|1420416_1422273_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	9.8e-68
WP_003562602.1|1422309_1422495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659053.1|1422618_1422840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344362.1|1422905_1423559_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562598.1|1424179_1425433_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003568628.1|1425435_1426065_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|1426076_1427006_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003562592.1|1427005_1427668_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562589.1|1427881_1428142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562586.1|1428392_1428995_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568624.1|1428991_1432303_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003582875.1|1432483_1432807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562582.1|1432984_1434358_+	MFS transporter	NA	NA	NA	NA	NA
WP_003562580.1|1434772_1436293_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	4.1e-11
WP_003562578.1|1436385_1437261_+	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	2.3e-11
WP_003562576.1|1437449_1437770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562575.1|1438467_1439160_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562571.1|1439557_1440208_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003562562.1|1440553_1441429_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003562560.1|1441775_1441991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659037.1|1442343_1442634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562558.1|1442871_1443201_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003562555.1|1443187_1443898_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003568611.1|1444231_1444570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659032.1|1444767_1445241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562550.1|1445598_1446210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562548.1|1446341_1446530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562546.1|1446698_1447010_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003562544.1|1447059_1447695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562542.1|1447889_1449332_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562540.1|1449572_1449932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562527.1|1450007_1450352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751650.1|1450608_1451853_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.0	7.4e-11
>prophage 4
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1469917	1533792	3052122	protease,tRNA,head,portal,terminase,tail,capsid	Lactobacillus_phage(20.0%)	58	NA	NA
WP_003568480.1|1469917_1470775_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568478.1|1471053_1471356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659007.1|1471568_1471964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572821.1|1472360_1472954_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568474.1|1473026_1473221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568540.1|1473247_1474267_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003568469.1|1474259_1475738_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003568467.1|1476179_1476416_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003568462.1|1476502_1477099_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	58.1	7.1e-52
WP_003568460.1|1477129_1477426_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003568458.1|1477553_1477985_-	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	1.3e-26
WP_003568456.1|1478167_1478872_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003581640.1|1478976_1481598_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.5	2.9e-113
WP_003568453.1|1481659_1483621_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.6	4.3e-146
WP_003568451.1|1483873_1484989_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003568449.1|1484985_1485198_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003568447.1|1485775_1486915_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
WP_003568444.1|1487087_1488437_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003568442.1|1489357_1489498_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003658992.1|1489826_1490183_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568431.1|1490327_1491164_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003568429.1|1491181_1491946_+	protein jag	NA	NA	NA	NA	NA
WP_003568424.1|1492458_1493847_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003568422.1|1493888_1495790_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003568420.1|1496052_1496262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568418.1|1496423_1497188_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003568415.1|1497189_1497678_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_110344363.1|1497694_1498873_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003568411.1|1499016_1500102_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013246158.1|1500825_1506786_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_003571997.1|1506942_1508133_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568404.1|1508119_1508809_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.6e-37
WP_003568402.1|1508801_1509866_-	transporter	NA	NA	NA	NA	NA
WP_003568400.1|1510436_1510613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568398.1|1510623_1510884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568396.1|1511226_1512012_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003571992.1|1512302_1513013_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_003568392.1|1513414_1515241_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_003568390.1|1515277_1517335_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_003658978.1|1517339_1517783_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_110344364.1|1517786_1518941_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003571988.1|1519058_1520015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_110344365.1|1520111_1521041_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003568380.1|1521240_1522161_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.9	1.6e-42
WP_003568377.1|1522845_1523214_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003568375.1|1523325_1523574_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003568371.1|1523589_1523730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571983.1|1524605_1524947_-|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	39.7	5.5e-09
WP_003571981.1|1524930_1525221_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_110344366.1|1525282_1526824_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.5	2.1e-39
WP_003571978.1|1526810_1527995_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.0	1.5e-61
WP_003571976.1|1527999_1528179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344367.1|1528144_1529848_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	39.9	2.5e-118
WP_003571972.1|1529844_1530315_-|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.9e-07
WP_191984568.1|1530439_1530814_-	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	38.0	1.6e-09
WP_003571970.1|1530889_1531060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571968.1|1531380_1532976_-	hypothetical protein	NA	A0A0M4RE09	Enterococcus_phage	31.3	2.6e-40
WP_032774359.1|1532979_1533792_-	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
>prophage 5
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1983534	2106536	3052122	protease,transposase,bacteriocin	Staphylococcus_phage(15.0%)	115	NA	NA
WP_013245374.1|1983534_1984779_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
WP_003567469.1|1985374_1986325_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	1.3e-12
WP_003571452.1|1986321_1987092_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003567464.1|1987095_1987875_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003571451.1|1988169_1988985_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567460.1|1988981_1989683_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.8	9.6e-32
WP_003567458.1|1989679_1990912_+	acyltransferase	NA	NA	NA	NA	NA
WP_003567456.1|1990868_1992401_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.6	7.5e-13
WP_003567455.1|1992390_1993365_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567453.1|1993744_1994548_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003567451.1|1994544_1995327_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003567449.1|1995326_1996100_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003567445.1|1997487_1999743_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.1	1.5e-38
WP_079322958.1|2001087_2001384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_110344393.1|2001380_2002244_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	1.2e-23
WP_003659617.1|2002671_2002959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567441.1|2003549_2003960_+	CrcB family protein	NA	NA	NA	NA	NA
WP_003567439.1|2003953_2004310_+	CrcB family protein	NA	NA	NA	NA	NA
WP_003567437.1|2004692_2004857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567435.1|2006054_2007242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344394.1|2007416_2009795_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003567431.1|2010399_2010549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344395.1|2010790_2011693_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567426.1|2011843_2013679_-	membrane protein	NA	NA	NA	NA	NA
WP_003567424.1|2013941_2014466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567423.1|2014622_2015255_+	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003567422.1|2015372_2016014_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003567420.1|2016253_2017171_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567418.1|2017371_2017491_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003567416.1|2017579_2017849_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003571433.1|2018049_2019516_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567413.1|2019791_2020535_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003567411.1|2020531_2021428_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567408.1|2021424_2022366_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567405.1|2022486_2022819_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567403.1|2022839_2023478_-	cation transporter	NA	NA	NA	NA	NA
WP_003567401.1|2023606_2023798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567398.1|2024043_2025573_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567396.1|2025612_2026986_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567394.1|2027139_2027505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567392.1|2027804_2030522_-	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.7	4.1e-62
WP_003567390.1|2030909_2032517_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003567386.1|2032808_2033567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567384.1|2033699_2035076_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_110344396.1|2035337_2036501_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003567380.1|2036526_2037261_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003567378.1|2037465_2038419_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	6.3e-10
WP_003567376.1|2038690_2038924_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567374.1|2038920_2039136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659595.1|2039271_2039580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567372.1|2039850_2040447_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003571419.1|2040565_2040901_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567367.1|2041213_2041405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567365.1|2041656_2041989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567363.1|2042545_2043358_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_110344397.1|2044158_2044383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567358.1|2044704_2044893_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_032675994.1|2044927_2045101_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567354.1|2045360_2045600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659579.1|2046146_2046344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567351.1|2046705_2047512_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003567349.1|2047516_2048815_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003571414.1|2049004_2049142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567347.1|2049607_2051800_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003567343.1|2051810_2053190_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003567340.1|2053363_2053714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580849.1|2053786_2054098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567335.1|2054403_2055759_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003567333.1|2055860_2056157_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2056348_2056633_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567328.1|2056656_2056935_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567326.1|2056979_2057768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567324.1|2057820_2058609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567322.1|2058605_2058935_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003659566.1|2059950_2061006_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003567314.1|2061214_2062411_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003567312.1|2062505_2063063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571401.1|2063340_2066346_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003571400.1|2066347_2067670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571398.1|2067666_2069226_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003567303.1|2069232_2070060_+	class C sortase	NA	NA	NA	NA	NA
WP_003567302.1|2070649_2071873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|2072061_2072598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567298.1|2072851_2073046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567296.1|2073362_2074196_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	2.1e-46
WP_003567294.1|2074284_2075541_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	1.6e-98
WP_003567292.1|2075619_2076852_-	MFS transporter	NA	NA	NA	NA	NA
WP_003567290.1|2077179_2077431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2077655_2077862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567286.1|2077932_2078190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567284.1|2078322_2078529_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003571392.1|2078716_2079832_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567280.1|2080022_2080307_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003567279.1|2080320_2081442_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567277.1|2081950_2082622_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003567275.1|2083122_2083746_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_032774271.1|2083907_2086538_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.4e-88
WP_003567271.1|2086694_2088749_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_003567269.1|2088910_2089789_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003576229.1|2089851_2091048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567265.1|2091044_2092145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571383.1|2092372_2093719_-	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003571381.1|2094041_2095361_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003567260.1|2095605_2095983_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003567258.1|2096099_2096390_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567256.1|2096610_2097153_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567254.1|2097169_2098534_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567252.1|2098555_2099671_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567250.1|2099773_2100670_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567248.1|2100853_2101741_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567246.1|2101758_2102535_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567244.1|2102851_2104123_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003567242.1|2104286_2104661_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567240.1|2104667_2105684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567237.1|2105696_2106536_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2489338	2549326	3052122	protease,transposase,head,portal,terminase,integrase,holin,tail,capsid	Lactobacillus_phage(68.63%)	76	2491971:2491996	2537333:2537358
WP_003566294.1|2489338_2490265_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
WP_003566292.1|2490437_2491991_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
2491971:2491996	attL	GCAACGATTGAGTGGGAATGACCGGT	NA	NA	NA	NA
WP_110344415.1|2492155_2493319_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	31.5	5.6e-45
WP_110344416.1|2493696_2494959_-	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	24.6	3.5e-16
WP_110344417.1|2495020_2495224_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	3.5e-27
WP_110344418.1|2495248_2495674_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	84.4	6.6e-60
WP_110344419.1|2495736_2496270_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_110344420.1|2496421_2497123_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	38.7	3.3e-24
WP_110344421.1|2497215_2497566_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	94.0	5.8e-54
WP_110344422.1|2497650_2498334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344423.1|2498390_2498813_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	91.3	1.3e-71
WP_003658003.1|2498802_2499141_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	1.3e-55
WP_110344424.1|2499274_2499517_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	93.8	2.3e-33
WP_004562013.1|2499513_2499672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344425.1|2499729_2500236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344426.1|2500241_2500451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344560.1|2500694_2501102_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	95.6	5.5e-72
WP_110344428.1|2501114_2501774_+	ERF family protein	NA	A0A0S2MYH3	Enterococcus_phage	33.7	4.6e-12
WP_110344429.1|2501770_2502202_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.2	6.9e-49
WP_162596389.1|2503155_2503311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032790936.1|2503307_2503532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562022.1|2503647_2503863_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
WP_110344430.1|2503859_2504309_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.9	2.8e-69
WP_110344431.1|2504311_2504695_+	DUF1064 domain-containing protein	NA	A0A0P0IJU5	Lactobacillus_phage	95.3	2.1e-65
WP_110344432.1|2504706_2505417_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	96.5	6.3e-124
WP_110344433.1|2505403_2506327_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	42.4	2.4e-67
WP_110344434.1|2506337_2506910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344435.1|2507046_2507550_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	68.0	4.9e-54
WP_110344436.1|2507539_2507752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344437.1|2507744_2508017_+	hypothetical protein	NA	A0A2D1GPA3	Lactobacillus_phage	77.8	4.4e-33
WP_110344438.1|2508019_2508220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658047.1|2508212_2508419_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	98.5	1.5e-33
WP_110344439.1|2508415_2508814_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	44.9	2.1e-20
WP_110344440.1|2508810_2509227_+	hypothetical protein	NA	C1KFT7	Lactobacillus_virus	56.5	4.5e-37
WP_110344441.1|2509219_2509507_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	95.8	3.7e-51
WP_110344442.1|2509576_2509849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162596390.1|2510163_2510622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162596391.1|2511274_2511916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344444.1|2512023_2513172_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	95.5	9.6e-215
WP_164507425.1|2513181_2513319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344445.1|2513318_2513969_+	helix-turn-helix domain-containing protein	NA	A0A1S5SAA7	Streptococcus_phage	48.9	4.5e-44
WP_110344446.1|2513946_2515302_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	58.6	1.4e-148
WP_110344447.1|2515306_2516734_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	92.4	4.7e-251
WP_110344448.1|2516699_2517692_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	91.2	3.3e-171
WP_003658075.1|2517816_2518455_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	96.2	4.7e-86
WP_110344449.1|2518467_2518782_+	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	93.3	4.7e-47
WP_003658079.1|2518795_2519815_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	99.1	1.2e-189
WP_003658081.1|2520042_2520417_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	1.4e-58
WP_003658082.1|2520421_2520724_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	89.0	2.0e-47
WP_003658084.1|2520720_2521086_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	1.2e-57
WP_003658086.1|2521086_2521491_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	7.8e-71
WP_003658088.1|2521502_2522102_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.9	3.4e-102
WP_003658090.1|2522188_2522524_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	99.1	1.6e-53
WP_003658091.1|2522622_2522976_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	94.0	9.0e-55
WP_003658092.1|2522968_2526298_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	75.5	3.6e-238
WP_110344450.1|2526298_2528365_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	58.2	1.7e-209
WP_110344451.1|2528365_2530801_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	73.2	0.0e+00
WP_110344452.1|2530802_2531087_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	53.2	1.1e-21
WP_093997698.1|2531083_2531215_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	8.5e-19
WP_016369921.1|2531245_2531644_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	4.4e-66
WP_110344453.1|2531815_2532262_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	1.7e-66
WP_110344454.1|2532272_2533448_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	50.5	6.4e-89
WP_013245374.1|2533630_2534875_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
WP_110344455.1|2535079_2535574_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_110344456.1|2535570_2536680_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003566290.1|2537654_2537807_-	hypothetical protein	NA	NA	NA	NA	NA
2537333:2537358	attR	GCAACGATTGAGTGGGAATGACCGGT	NA	NA	NA	NA
WP_003566288.1|2537952_2539368_+	group II intron reverse transcriptase domain-containing protein	NA	NA	NA	NA	NA
WP_003566286.1|2539805_2540030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566282.1|2540491_2540968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566280.1|2541267_2541480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245859.1|2541848_2543342_+	protein kinase	NA	M1HHG8	Acanthocystis_turfacea_Chlorella_virus	30.0	3.9e-14
WP_003566277.1|2543667_2544312_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003566275.1|2544688_2545018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566272.1|2545718_2547314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566270.1|2547622_2548390_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_110344458.1|2548564_2549326_-|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
>prophage 7
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2846715	2936116	3052122	protease,tRNA,head,portal,terminase,integrase,holin,tail,capsid	Lactobacillus_phage(70.91%)	96	2855662:2855681	2896314:2896333
WP_003564762.1|2846715_2847483_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003564764.1|2847619_2847967_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003564766.1|2848193_2848370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658561.1|2848402_2848648_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003564771.1|2848708_2848930_+	YneF family protein	NA	NA	NA	NA	NA
WP_110344474.1|2849071_2850829_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-50
WP_003564775.1|2850818_2852612_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	6.4e-40
WP_003564777.1|2852709_2853501_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_003570435.1|2853531_2854926_-	amino acid permease	NA	NA	NA	NA	NA
WP_003564783.1|2854982_2855633_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
2855662:2855681	attL	TGTGGTAAATTATACCATTG	NA	NA	NA	NA
WP_191984563.1|2855804_2856977_-|integrase	tyrosine-type recombinase/integrase	integrase	B4XYR4	Lactobacillus_phage	48.7	7.8e-103
WP_003658553.1|2857083_2857347_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	3.2e-09
WP_110344476.1|2857462_2858188_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	30.5	1.0e-20
WP_110344477.1|2858202_2858424_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	70.4	4.8e-22
WP_110344478.1|2858683_2859361_-	transcriptional regulator	NA	O64371	Lactobacillus_phage	92.0	4.8e-81
WP_110344479.1|2859425_2859848_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	39.6	8.3e-23
WP_110344480.1|2859840_2860182_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	43.1	5.5e-17
WP_110344481.1|2860440_2860686_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	95.1	1.2e-37
WP_110344482.1|2860686_2861427_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	51.7	5.7e-43
WP_110344483.1|2861427_2861643_+	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	52.1	1.4e-13
WP_110344484.1|2861605_2862100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572199.1|2862164_2862521_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_110344485.1|2862605_2862827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658526.1|2862893_2863208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344486.1|2863200_2863950_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	57.7	2.3e-36
WP_019909842.1|2863964_2864789_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	3.0e-117
WP_110344487.1|2864788_2865307_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_110344488.1|2865353_2865776_+	replication terminator protein	NA	NA	NA	NA	NA
WP_110344489.1|2865777_2866515_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	7.7e-48
WP_110344490.1|2866526_2866814_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	94.7	1.6e-49
WP_110344491.1|2866883_2867216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162596393.1|2867689_2868148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162596383.1|2869065_2869728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344494.1|2869826_2870033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344495.1|2870022_2870970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110344496.1|2871679_2872897_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.3	2.1e-236
WP_110344497.1|2872883_2873213_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	92.4	8.7e-52
WP_110344566.1|2873476_2873800_+	hypothetical protein	NA	U5U409	Lactobacillus_phage	87.2	5.0e-36
WP_191984564.1|2873801_2873966_+	hypothetical protein	NA	A8YQN6	Lactobacillus_phage	77.8	8.2e-11
WP_110344498.1|2873971_2874766_+	HNH endonuclease	NA	U5U440	Lactobacillus_phage	97.7	1.2e-147
WP_110344499.1|2874966_2875422_+|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	98.7	1.0e-79
WP_110344500.1|2875443_2877156_+|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	98.9	0.0e+00
WP_045137015.1|2877167_2877362_+	hypothetical protein	NA	U5U6Z9	Lactobacillus_phage	79.7	7.2e-22
WP_110344501.1|2877367_2878621_+|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	98.8	4.8e-236
WP_110344502.1|2878574_2879204_+|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	99.0	3.0e-117
WP_110344503.1|2879245_2880448_+|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	96.0	2.8e-209
WP_110344504.1|2880465_2880705_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	96.2	1.6e-31
WP_110344505.1|2880715_2881075_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	95.8	1.4e-58
WP_110344506.1|2881064_2881394_+|head	phage head closure protein	head	A0A2D1GPN9	Lactobacillus_phage	98.2	8.9e-57
WP_110344507.1|2881393_2881780_+	HK97 gp10 family phage protein	NA	U5U769	Lactobacillus_phage	95.3	6.1e-65
WP_110344508.1|2881779_2882166_+|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	97.7	6.3e-70
WP_110344509.1|2882199_2882808_+|tail	phage tail protein	tail	A0A2D1GPC8	Lactobacillus_phage	96.0	2.1e-107
WP_080661678.1|2882834_2883050_+	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	91.5	3.7e-19
WP_033571039.1|2883120_2883534_+	hypothetical protein	NA	U5U4K9	Lactobacillus_phage	99.3	2.4e-51
WP_110344510.1|2883656_2888519_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	94.3	0.0e+00
WP_110344511.1|2888519_2890514_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	59.8	6.1e-217
WP_110344512.1|2890514_2892950_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	72.3	0.0e+00
WP_110344513.1|2892951_2893242_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	55.2	1.5e-23
WP_110344514.1|2893234_2893366_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	95.3	5.5e-18
WP_110344515.1|2893396_2893783_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	98.4	2.1e-65
WP_041168793.1|2893763_2893973_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
WP_110344516.1|2893965_2894412_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	1.9e-65
WP_110344517.1|2894422_2895721_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	89.8	2.8e-218
WP_020967532.1|2896366_2897101_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
2896314:2896333	attR	TGTGGTAAATTATACCATTG	NA	NA	NA	NA
WP_003565812.1|2897090_2897360_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003565810.1|2897755_2898544_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003565808.1|2898628_2899510_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003565806.1|2899745_2900465_+	UMP kinase	NA	NA	NA	NA	NA
WP_003565804.1|2900464_2901022_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003570430.1|2901551_2902304_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.2	2.1e-21
WP_003565800.1|2902339_2903128_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_110344519.1|2903144_2904386_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003565796.1|2904410_2906138_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.9	1.8e-07
WP_110344520.1|2906204_2910539_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	36.0	1.5e-18
WP_003565790.1|2910793_2911273_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003565788.1|2911289_2912543_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003565786.1|2912554_2912848_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003565784.1|2912850_2913150_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_003565782.1|2913170_2916002_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	40.0	5.8e-19
WP_003565780.1|2916062_2916416_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003565760.1|2916722_2917514_+	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	44.7	1.8e-34
WP_003565758.1|2917525_2918431_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003565755.1|2918437_2919385_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003565753.1|2919386_2920532_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003565751.1|2920694_2921741_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003565749.1|2921917_2922508_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003565747.1|2922537_2924412_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	2.6e-140
WP_003565745.1|2924524_2925688_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-24
WP_003565743.1|2927790_2928699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003565741.1|2928855_2930694_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.0e-20
WP_003565739.1|2930785_2931019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565737.1|2931024_2931501_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003565736.1|2931824_2932196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565734.1|2932470_2934765_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	5.1e-74
WP_003565731.1|2934761_2935289_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.4	6.5e-25
WP_003565730.1|2935612_2936116_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP029686	Lacticaseibacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2948712	3001332	3052122	transposase,tRNA,head,portal,terminase,holin,tail	Lactobacillus_rhamnosus_Lc-Nu-like_prophage(37.93%)	58	NA	NA
WP_003565699.1|2948712_2949159_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003658142.1|2949158_2949785_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003565695.1|2949857_2951180_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	32.2	8.4e-13
WP_110344522.1|2951318_2951759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565691.1|2952004_2952880_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	1.0e-22
WP_003565689.1|2952876_2954382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565687.1|2954510_2954837_-	inorganic diphosphatase	NA	NA	NA	NA	NA
WP_003565685.1|2955357_2956641_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003565683.1|2956642_2958448_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.4	8.0e-06
WP_003565681.1|2958535_2958988_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003565679.1|2959079_2960000_+	YitT family protein	NA	NA	NA	NA	NA
WP_003565677.1|2960135_2961023_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	28.5	2.1e-23
WP_003565675.1|2961019_2961850_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003565673.1|2962153_2962330_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003565671.1|2962358_2962793_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_003565669.1|2963241_2964228_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.5	1.9e-49
WP_003565667.1|2964231_2964690_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_110344523.1|2964673_2965072_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003570376.1|2965073_2965463_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_003565663.1|2965459_2966362_+	GTPase Era	NA	NA	NA	NA	NA
WP_003658157.1|2966361_2967141_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003565659.1|2967391_2967703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565657.1|2967847_2968156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344525.1|2968990_2969857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344567.1|2970088_2970856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344526.1|2972248_2973484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344527.1|2973487_2974096_+	HNH endonuclease	NA	A0A0A7DMX6	Lactobacillus_phage	32.2	8.3e-16
WP_110344528.1|2974149_2974377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344529.1|2974369_2975227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344530.1|2975183_2975597_+	single-stranded DNA-binding protein	NA	M4W9P8	Bacillus_phage	33.6	6.3e-07
WP_191984569.1|2975590_2976133_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	45.7	3.1e-30
WP_110344532.1|2976125_2976404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344533.1|2976413_2976929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079322958.1|2977209_2977506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836596.1|2977502_2978366_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_191984565.1|2978577_2979318_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	47.7	8.3e-26
WP_110344534.1|2979776_2980244_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	38.5	1.0e-21
WP_110344535.1|2980237_2982130_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.7	9.8e-156
WP_079322958.1|2982290_2982587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836596.1|2982583_2983447_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_110344568.1|2983603_2984608_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	42.1	1.7e-69
WP_079322958.1|2986208_2986505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836596.1|2986501_2987365_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_110344536.1|2988001_2988289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110344537.1|2988278_2988623_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	79.8	2.8e-45
WP_110344538.1|2988625_2989045_+	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.8	1.9e-67
WP_110344539.1|2989041_2989422_+	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.4	9.7e-63
WP_110344540.1|2989422_2990034_+|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.1	6.7e-98
WP_110344541.1|2990196_2990547_+|tail	phage tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	79.3	7.8e-43
WP_003658477.1|2990509_2990755_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.7	5.0e-36
WP_110344569.1|2990784_2994678_+	tape measure protein	NA	Q6J1X5	Lactobacillus_phage	69.4	2.5e-254
WP_020967537.1|2994678_2996691_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	76.5	1.6e-297
WP_110344542.1|2996691_2999145_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	68.6	0.0e+00
WP_110344543.1|2999154_2999445_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	82.3	7.4e-39
WP_110344544.1|2999437_2999569_+	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	86.0	1.4e-16
WP_110344545.1|2999593_2999827_+	DNA primase	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	96.1	5.8e-34
WP_110344546.1|2999839_3000172_+|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	97.6	2.2e-31
WP_110344547.1|3000174_3001332_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	64.9	1.2e-143
