The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	836280	868179	5022609	protease,transposase	Stx2-converting_phage(38.46%)	24	NA	NA
WP_000997995.1|836280_837819_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|838946_839297_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|839293_839719_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|840090_840228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|840379_841297_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_110204451.1|841330_842206_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|842254_843727_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|843730_844561_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|844606_845317_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|845329_846439_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|846500_847424_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|847459_848194_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|848293_849280_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|849431_850659_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|851159_853250_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|854081_854354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|854644_855004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|855007_855223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|858541_858967_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|858963_859314_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|859344_860958_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_032212789.1|861640_862495_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|862543_863695_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|864291_868179_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 2
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1173899	1181039	5022609		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1173899_1174538_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1174534_1175797_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1175793_1176702_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001272542.1|1176867_1177665_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141293.1|1177715_1178372_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_110204455.1|1178477_1181039_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1773962	1783407	5022609		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1773962_1774889_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1774893_1775625_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1775605_1775713_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1775772_1776504_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1776725_1778411_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1778407_1779127_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1779173_1779644_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1779684_1780146_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1780270_1782274_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1782270_1783407_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 4
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1877583	1883886	5022609		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1877583_1878978_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1879152_1880046_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1880418_1881504_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1881503_1882403_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1882460_1883339_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1883343_1883886_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 5
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1907033	1943331	5022609	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
WP_001531805.1|1907033_1907492_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|1907602_1909030_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|1909238_1910405_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|1910523_1910997_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|1911194_1912253_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1912424_1912754_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|1912854_1913037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1913525_1913639_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1913651_1913846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|1913842_1914217_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|1914305_1914674_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|1914689_1915334_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1915352_1915574_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1915636_1916113_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1916128_1916602_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1916695_1916941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1916940_1917759_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1917979_1918390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1918838_1919585_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1919599_1921141_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1921255_1921669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1921804_1922875_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1922871_1923777_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_105494061.1|1923773_1924616_-	vimentin yjdA	NA	NA	NA	NA	NA
WP_000080195.1|1924659_1926273_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1926303_1926654_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1926650_1927076_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001069649.1|1928915_1929350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1929778_1931944_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|1931954_1932944_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|1932962_1934021_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|1934017_1934785_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|1934838_1935096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|1935626_1936772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|1937971_1938151_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|1938296_1939319_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|1939318_1940011_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000813432.1|1941036_1941639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|1941732_1942011_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|1942134_1943331_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2066474	2148984	5022609	terminase,plate,portal,capsid,integrase,tail,holin,tRNA	Escherichia_phage(24.39%)	95	2066289:2066348	2108901:2109025
2066289:2066348	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|2066474_2067491_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2067459_2067723_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2067932_2068115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2068114_2068684_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2068680_2070897_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2070927_2071248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2072258_2072672_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2072770_2073001_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2073059_2073536_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2073575_2073800_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2073796_2074552_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2074541_2075957_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2075995_2076406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2076407_2076644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2076640_2076952_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2076948_2077173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2077854_2078643_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2078817_2079741_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2080929_2081628_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2082090_2082696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2082705_2083194_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2083592_2083826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2084069_2084711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2084862_2085042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2085119_2085716_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2085712_2086006_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2086005_2086677_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2086789_2087173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2087172_2087445_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2087444_2087924_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2087931_2088126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2088185_2088431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2088799_2089366_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2089352_2091215_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2091214_2091448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2091444_2093019_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2093018_2094326_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2094325_2094655_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2094713_2095748_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2095782_2096202_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2096198_2096579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2096610_2097291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2097287_2097824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2097804_2098707_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2098709_2099051_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2099047_2099968_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2099970_2100597_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2100589_2101774_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2101773_2102163_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2102159_2103662_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2103679_2104192_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2104204_2104486_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2104594_2106235_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2106270_2106660_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2106821_2107046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|2108260_2108680_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2109151_2109817_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2108901:2109025	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|2109867_2111079_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2111269_2111509_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2111546_2112044_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2112215_2112539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2112802_2112889_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2113003_2113255_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2113332_2113836_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2114630_2115620_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|2115689_2117204_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000987895.1|2117215_2118205_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2118371_2119172_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2119146_2120571_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2120577_2121006_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2121785_2122136_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2122138_2122717_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2122843_2123731_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2123727_2124654_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2124658_2126623_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2126643_2127147_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2127291_2128953_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2129243_2130104_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2130106_2131156_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2131170_2131560_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|2131570_2132215_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2132403_2133552_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2133544_2135623_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2135622_2136015_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2136067_2137801_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2138016_2138583_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2138596_2139343_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2139730_2140831_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2140855_2143285_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|2143320_2144292_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2144288_2145032_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2145072_2145468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|2145520_2146339_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|2146335_2146902_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2147211_2148984_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2646640	2718896	5022609	terminase,transposase,portal,capsid,integrase,head,tail,protease,holin	Stx2-converting_phage(27.12%)	80	2697685:2697699	2719161:2719175
WP_000422062.1|2646640_2647690_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2647909_2648668_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2648664_2649255_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2649311_2649620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|2649629_2650616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296033.1|2651910_2653806_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2653833_2654454_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2654450_2655332_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2655469_2655514_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2655605_2657168_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|2657167_2658763_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|2658766_2660125_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2660136_2661330_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2661329_2662136_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2662511_2662787_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2662783_2663341_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|2663752_2664022_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2664078_2664747_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2664945_2665128_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|2665253_2666222_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|2666237_2666765_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|2666795_2667329_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|2667330_2670156_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|2670617_2671364_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2671378_2672920_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|2673560_2677034_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_061089814.1|2677376_2678009_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|2677954_2678698_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|2678708_2679407_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2679406_2679748_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2679740_2682983_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2683030_2683240_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2683335_2683710_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2683724_2684441_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2684507_2684852_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2684848_2685295_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2685291_2685642_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2685651_2685978_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2685974_2688560_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2688505_2688727_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2688771_2690709_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2690772_2692434_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2692430_2692994_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2693284_2693650_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2693691_2693892_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2694090_2694306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2694391_2694577_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2694798_2694885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2695439_2695973_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000422741.1|2696141_2696567_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2696563_2696914_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|2696944_2698558_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
2697685:2697699	attL	AATGACACCGGTGAA	NA	NA	NA	NA
WP_000369850.1|2698618_2698891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2698856_2699201_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2699205_2699421_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2699571_2701425_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2701685_2702021_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2702301_2702433_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2703234_2704284_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2704435_2704633_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2704859_2705681_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2705677_2706058_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2706058_2707114_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2707115_2707388_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2707555_2707768_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2707948_2708614_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2708788_2709214_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2709229_2710000_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2710021_2710768_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2710774_2711737_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2711759_2712185_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2712181_2712397_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2712446_2713163_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2713435_2713591_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2713750_2713969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2714534_2714723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2714719_2714911_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2715003_2717475_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2717539_2717788_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2717765_2718896_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2719161:2719175	attR	TTCACCGGTGTCATT	NA	NA	NA	NA
>prophage 8
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2856855	2902564	5022609	terminase,lysis,portal,capsid,integrase,head,tail,holin,tRNA	Enterobacteria_phage(56.0%)	58	2875639:2875653	2904233:2904247
WP_000654172.1|2856855_2857134_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|2857130_2859152_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|2859210_2862693_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|2862753_2863356_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|2863292_2864036_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|2864040_2864739_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|2864738_2865068_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|2865064_2867626_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|2867618_2868053_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|2868034_2868457_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|2868472_2869213_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|2869220_2869616_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|2869612_2870191_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|2870202_2870556_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|2870567_2870966_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|2871007_2872033_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|2872088_2872421_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2872430_2873750_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2873730_2875332_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2875328_2875535_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_110204485.1|2875531_2877457_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
2875639:2875653	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|2877431_2877977_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|2878540_2878723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2878929_2879256_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2879736_2880030_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2880120_2880303_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2880519_2880996_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2880982_2881288_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|2881609_2882299_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|2882295_2882436_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|2882432_2882795_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|2882791_2883082_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|2883074_2883245_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|2883244_2883700_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|2883696_2883798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2884147_2885191_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|2885227_2889493_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|2889742_2890444_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|2890440_2891370_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|2891456_2891996_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|2892065_2892296_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_110204486.1|2892334_2893090_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.6	4.0e-92
WP_000233576.1|2893685_2893892_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|2893967_2894264_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|2894269_2895055_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2895051_2895732_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2895728_2895911_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2895883_2896075_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|2896085_2896367_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|2896465_2896687_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2896686_2897013_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2896996_2897236_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2897375_2897612_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2897601_2898744_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2898857_2900108_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|2900279_2900933_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2900942_2901404_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2901457_2902564_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2904233:2904247	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 9
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	3099672	3226221	5022609	terminase,plate,transposase,capsid,portal,integrase,head,tail,protease,holin,tRNA	Enterobacteria_phage(42.0%)	145	3169600:3169619	3208257:3208276
WP_001295930.1|3099672_3100458_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3100593_3101373_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3101349_3102243_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3102396_3103143_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3103139_3103322_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3103373_3104606_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|3104642_3105629_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3105625_3107374_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3107410_3109675_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3109880_3110165_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3110324_3111998_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3112108_3112792_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|3112964_3113747_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|3113890_3114280_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|3114251_3114701_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|3114702_3114909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|3114898_3115129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|3115125_3115809_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|3115805_3116021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3116035_3116332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|3116341_3116614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3116902_3117433_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|3117460_3117730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|3117732_3118899_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|3118909_3120679_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|3120694_3121012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|3121011_3121932_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|3121942_3122251_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3122303_3122492_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3122585_3122942_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3123058_3123823_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3124013_3124229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3124227_3124632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|3124607_3125336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3125466_3125817_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|3125819_3126560_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|3126543_3127194_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|3127190_3127517_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|3127516_3127828_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|3127827_3128373_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000422741.1|3128752_3129178_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3129174_3129525_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3129555_3131169_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000090684.1|3132504_3134001_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|3133981_3134803_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|3134805_3135264_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|3135478_3136594_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|3136608_3137562_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|3137571_3137910_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|3137911_3138358_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|3138357_3138822_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|3138818_3139073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|3139062_3140490_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|3140489_3141011_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|3141013_3141295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|3141392_3141728_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|3141651_3141810_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|3141885_3144837_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|3144836_3145721_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|3145717_3145933_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|3145920_3147075_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|3147071_3147668_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|3147722_3148070_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|3148060_3149164_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|3149156_3149735_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_023363137.1|3149737_3150985_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_023142129.1|3150995_3151457_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|3151463_3152078_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_063269479.1|3152077_3152602_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000904922.1|3152661_3153234_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|3153489_3154773_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3154843_3155932_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3156130_3156823_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|3156952_3158713_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|3159118_3159976_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3160030_3162313_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3162504_3163245_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|3163341_3164490_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3164803_3165430_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|3165465_3166329_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3166330_3166948_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3166958_3169403_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
3169600:3169619	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023739.1|3169702_3170695_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|3170764_3171106_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|3171210_3171732_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|3171736_3172159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|3172165_3172357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|3172494_3172845_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|3172855_3173134_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|3173145_3173388_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|3173384_3173498_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|3173591_3174002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3174025_3174229_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|3174225_3174492_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|3174488_3174788_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|3174799_3175417_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000599382.1|3175413_3175779_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|3175785_3178608_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|3178684_3179644_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|3179648_3179963_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|3180046_3180889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|3180928_3181426_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|3182149_3182674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|3182688_3183735_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|3183734_3185486_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|3185640_3186477_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|3186500_3187553_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|3187598_3188399_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|3188500_3188995_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|3188994_3189195_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|3189197_3189521_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|3189517_3189910_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|3189906_3190302_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|3190440_3192318_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|3192341_3192809_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|3192801_3193437_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|3193433_3194015_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|3194011_3194362_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|3194365_3195262_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|3195254_3195785_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_032140708.1|3195787_3198010_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_001554335.1|3198011_3198539_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|3198567_3199101_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_032142265.1|3199103_3199661_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000905061.1|3199879_3200479_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|3200507_3200996_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|3201008_3203816_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|3203802_3203958_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|3203966_3204341_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|3204396_3204909_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|3204908_3206093_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|3206250_3207360_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|3207400_3207661_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3207852_3207993_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|3208298_3209591_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
3208257:3208276	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_110204490.1|3209681_3211025_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_001295343.1|3211035_3211647_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|3211805_3215912_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001385255.1|3217083_3218049_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|3218171_3219938_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|3219938_3221660_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|3221701_3222406_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3222690_3222909_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3223593_3225870_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3225900_3226221_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 10
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	3983044	4026872	5022609	bacteriocin,tRNA,transposase	Salmonella_phage(25.0%)	43	NA	NA
WP_000937399.1|3983044_3983971_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174644.1|3984009_3985428_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000215152.1|3985424_3985904_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000038431.1|3986251_3986836_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000465941.1|3986932_3987673_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000153158.1|3987707_3990308_+	Yad fimbria usher protein HtrE	NA	NA	NA	NA	NA
WP_000598298.1|3990324_3990897_+	fimbrial protein	NA	NA	NA	NA	NA
WP_110204501.1|3990911_3991544_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000608644.1|3991696_3992959_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_014342101.1|3993106_3993229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|3993208_3994084_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000553751.1|3994584_3995181_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000846606.1|3995232_3996486_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_000805472.1|3996598_3997393_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905361.1|3997404_3998256_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000404123.1|3998337_3998535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000339933.1|3998603_3999524_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
WP_000621515.1|3999797_4000178_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000277941.1|4000181_4001411_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000901994.1|4001474_4001915_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000972203.1|4002019_4002790_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150638.1|4002786_4003713_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4003821_4004484_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|4004524_4005061_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001295777.1|4005266_4007657_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189632.1|4007703_4009254_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
WP_001295568.1|4009419_4009767_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000818414.1|4009872_4010739_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734300.1|4010754_4011549_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000384306.1|4011586_4011949_-	YacL family protein	NA	NA	NA	NA	NA
WP_001295775.1|4012123_4014721_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_000784417.1|4015075_4016839_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_000102485.1|4016909_4018334_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000963539.1|4018541_4020434_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000003820.1|4020448_4023112_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000331776.1|4023272_4024037_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000282229.1|4024492_4024783_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311382.1|4024783_4025023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000543776.1|4025190_4025481_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|4025534_4025723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282227.1|4025889_4026180_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311381.1|4026180_4026420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471924.1|4026587_4026872_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	4282061	4338859	5022609	transposase	Stx2-converting_phage(28.57%)	51	NA	NA
WP_085949154.1|4282061_4283209_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000788354.1|4283371_4283626_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085949154.1|4286277_4287424_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000504875.1|4288051_4289338_+	McrC family protein	NA	NA	NA	NA	NA
WP_000781649.1|4289447_4291187_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_001295727.1|4291199_4292390_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_001332039.1|4292382_4294023_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001467148.1|4295335_4295494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|4295593_4295770_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|4295786_4296275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|4296271_4296649_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|4296738_4297107_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|4297269_4297491_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|4297553_4298030_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|4298045_4298519_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234738.1|4298860_4299679_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001323397.1|4299833_4299992_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_021526504.1|4300062_4302909_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001553935.1|4303281_4304154_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250227.1|4304238_4305156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|4306356_4306959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430772.1|4307054_4307315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|4308034_4308184_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001547002.1|4308516_4308714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|4308913_4309483_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4309742_4310144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4310131_4310566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4310920_4311301_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4311297_4311645_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|4311694_4313080_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|4313318_4314677_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|4316238_4316760_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068908.1|4316756_4317710_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|4317796_4320121_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|4320165_4321068_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4321064_4322063_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4322059_4323016_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4323016_4323784_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4324340_4324598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|4325531_4325834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|4325869_4326688_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001545177.1|4326842_4328840_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_001296707.1|4328902_4330180_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_110204503.1|4330427_4331084_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000527665.1|4331264_4331372_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|4332497_4332596_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4332597_4333380_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4333685_4334606_+	ribokinase	NA	NA	NA	NA	NA
WP_000998348.1|4334633_4335950_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107487.1|4335961_4336975_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000080195.1|4337245_4338859_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 1
NZ_CP028484	Escherichia coli strain E41-1 plasmid p1, complete sequence	128911	889	58708	128911	transposase,protease	Escherichia_phage(35.71%)	55	NA	NA
WP_000080195.1|889_2503_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_023144756.1|2938_3073_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083850.1|3369_3624_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_031943482.1|3860_3935_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001617855.1|3927_4785_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|5724_6378_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|6470_6728_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|6660_7062_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|7346_8657_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|8933_9794_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|10154_10859_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065897011.1|11375_12287_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|12318_13518_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|13623_14250_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|14281_14518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|14571_15408_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|15407_16211_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|16271_17087_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_024192851.1|17394_17607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|17631_18336_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|18457_19363_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|19359_20598_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|20597_21182_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|21674_22439_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|22665_22971_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|22981_24187_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|24342_24546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|24673_25513_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|25506_25854_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|26059_26848_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|26978_27452_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067858.1|28417_29122_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000449408.1|29271_29430_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|29419_29926_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|30108_30924_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|31270_33157_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|33197_33725_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|33828_35208_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|35210_36494_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|36483_37614_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|37618_38314_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|38300_38786_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|38810_39296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391954.1|40535_40703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020413.1|42953_44129_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_110204511.1|44197_46459_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|46627_47404_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|47411_48287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545741.1|50737_51073_-	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_000194542.1|51567_52077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|52073_52334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189113.1|53847_55356_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|55857_56262_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|56258_56606_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|57685_58708_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
>prophage 2
NZ_CP028484	Escherichia coli strain E41-1 plasmid p1, complete sequence	128911	75075	81115	128911	transposase	Escherichia_phage(71.43%)	8	NA	NA
WP_012372828.1|75075_76092_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|76319_76637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|76923_77283_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|77310_77490_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|77494_77875_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|77874_78096_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|78278_79835_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001617890.1|79831_81115_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
