The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	1157073	1197780	4656282	coat,capsid,terminase,lysis	Enterobacteria_phage(28.3%)	65	NA	NA
WP_110108179.1|1157073_1157313_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	71.8	2.4e-27
WP_165835087.1|1157290_1157962_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	47.8	1.4e-43
WP_110108810.1|1157958_1158417_-	AP2 domain-containing protein	NA	A0A142IE12	Pseudomonas_phage	46.3	2.3e-26
WP_110108180.1|1158619_1158838_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	60.6	1.1e-15
WP_110108181.1|1158929_1159160_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	6.5e-06
WP_045357106.1|1159156_1159378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006176198.1|1159374_1159593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108182.1|1159589_1161503_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.3	5.9e-116
WP_110108183.1|1161499_1161652_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	2.8e-05
WP_110108184.1|1161648_1162077_-	regulator	NA	G8C7S8	Escherichia_phage	95.1	2.2e-71
WP_110108185.1|1162085_1162568_-	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	98.1	5.5e-79
WP_110108186.1|1162564_1163479_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	97.7	3.2e-168
WP_110108187.1|1163488_1163767_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	77.4	3.1e-34
WP_110108188.1|1163774_1164746_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.2	6.7e-84
WP_110108189.1|1164816_1165026_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	8.2e-32
WP_165835088.1|1165022_1165181_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	2.6e-22
WP_110108190.1|1165177_1165687_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.0	1.1e-88
WP_110108191.1|1165846_1166284_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	1.4e-76
WP_110108192.1|1166785_1167139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108193.1|1167163_1167802_-	LexA family transcriptional regulator	NA	K7PH71	Enterobacterial_phage	78.2	1.6e-94
WP_032676295.1|1167906_1168122_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
WP_110108194.1|1168152_1168698_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	82.3	2.1e-79
WP_015571544.1|1168787_1168934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047748420.1|1168926_1169826_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	1.4e-80
WP_110108195.1|1169815_1171249_+	AAA family ATPase	NA	Q716D2	Shigella_phage	87.1	1.8e-231
WP_110108196.1|1171248_1171548_+	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
WP_110108197.1|1171544_1172081_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	35.2	1.5e-05
WP_110108198.1|1172077_1172305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108199.1|1172301_1172670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108200.1|1173328_1173583_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.6	1.0e-07
WP_023330682.1|1173728_1174010_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	53.8	3.2e-23
WP_110108201.1|1174220_1174670_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.5	2.5e-33
WP_110108202.1|1174662_1174833_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	89.3	4.5e-20
WP_110108203.1|1174829_1175498_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	91.9	1.9e-122
WP_110108204.1|1175490_1176132_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	93.9	2.7e-105
WP_058671429.1|1176128_1176329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108205.1|1176428_1177118_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.3e-57
WP_064138273.1|1177850_1178075_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	2.0e-31
WP_110108206.1|1178052_1178547_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	96.3	1.6e-89
WP_110108207.1|1178543_1179005_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	70.6	8.7e-50
WP_110108208.1|1179039_1179312_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	67.8	6.7e-26
WP_110108209.1|1179462_1179681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108210.1|1179677_1179884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108211.1|1179887_1180538_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	97.7	1.1e-111
WP_110108212.1|1180534_1182097_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	1.3e-302
WP_165835094.1|1182125_1183583_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	61.6	5.2e-157
WP_110108214.1|1183509_1184520_+|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	67.3	2.7e-112
WP_094312733.1|1184520_1184868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108215.1|1184920_1186291_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.9	1.8e-122
WP_110108216.1|1186290_1186752_+	hypothetical protein	NA	R9TR06	Aeromonas_phage	47.6	2.2e-29
WP_110108217.1|1186748_1187804_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.8	1.2e-102
WP_032668716.1|1187836_1188070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332637.1|1188072_1188453_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_045341957.1|1188452_1188626_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	47.4	5.1e-11
WP_110108218.1|1188625_1188982_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
WP_032652844.1|1188984_1189353_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	77.0	1.6e-46
WP_110108219.1|1189349_1189733_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	60.6	1.1e-37
WP_110108220.1|1189797_1190577_+	hypothetical protein	NA	F1C5E5	Cronobacter_phage	62.4	1.2e-54
WP_110108221.1|1190637_1191309_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	46.9	1.7e-49
WP_110108222.1|1191350_1193684_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	51.2	2.0e-150
WP_045344867.1|1193694_1193922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300373.1|1193963_1194467_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	85.0	2.5e-82
WP_015571561.1|1194466_1194937_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_110108223.1|1194950_1195316_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.6	3.3e-60
WP_110108224.1|1195302_1197780_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.8	0.0e+00
>prophage 2
NZ_CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	1835917	1884683	4656282	tail,tRNA,integrase,head,holin,capsid,terminase,portal	Enterobacterial_phage(30.19%)	61	1831742:1831756	1891714:1891728
1831742:1831756	attL	CGCCCACCGCAATCG	NA	NA	NA	NA
WP_022650816.1|1835917_1836418_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_006809195.1|1836637_1837780_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_022650818.1|1837754_1838018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687783.1|1838053_1838323_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	86.7	6.5e-13
WP_058687784.1|1838333_1838597_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	85.1	4.3e-38
WP_096928926.1|1838599_1839121_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	84.7	1.7e-49
WP_058687785.1|1839107_1840130_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	90.4	2.7e-168
WP_058687786.1|1840129_1840543_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	81.6	1.1e-51
WP_058687787.1|1840816_1841008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634713.1|1841348_1842005_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
WP_032634882.1|1842104_1842302_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
WP_032634711.1|1842327_1842798_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_072203184.1|1843038_1843245_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	3.8e-13
WP_058687708.1|1843207_1844134_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	83.4	4.9e-68
WP_058687709.1|1844130_1844625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687710.1|1844624_1845377_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.0	2.0e-136
WP_058687711.1|1845381_1846047_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.8	5.6e-98
WP_023293907.1|1846043_1846271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305906.1|1846267_1846588_+	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	77.4	1.9e-43
WP_058687712.1|1846584_1846974_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.9e-66
WP_045332650.1|1846989_1847715_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	2.2e-55
WP_058687713.1|1847711_1848701_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.1	1.2e-178
WP_053504493.1|1848713_1849292_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
WP_015570939.1|1849513_1849939_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|1849935_1850091_+	DUF3927 family protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_023296244.1|1850201_1850588_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.2e-52
WP_063419965.1|1850574_1850856_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
WP_058687714.1|1850855_1851485_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	3.5e-102
WP_058685277.1|1851492_1851762_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.5	3.2e-28
WP_058687715.1|1852750_1853617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087654025.1|1853810_1854635_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	77.4	2.9e-19
WP_032667396.1|1854647_1854875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059443714.1|1854891_1856349_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	4.6e-270
WP_063159276.1|1856360_1856696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058687853.1|1856649_1856907_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
WP_059443713.1|1857072_1857666_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.7	5.1e-95
WP_072203232.1|1857658_1858027_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	87.7	5.9e-57
WP_000954404.1|1858132_1858627_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_088566981.1|1858623_1860285_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
WP_058687880.1|1860343_1862278_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
WP_048243836.1|1862480_1863839_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	97.8	4.6e-256
WP_048243841.1|1863835_1864879_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	77.8	9.7e-89
WP_048243843.1|1864875_1865202_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	86.1	1.9e-46
WP_048243845.1|1865210_1865561_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	93.1	6.8e-55
WP_058687881.1|1865557_1866007_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	97.3	3.8e-74
WP_048243848.1|1866003_1866351_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	94.8	2.1e-56
WP_048243850.1|1866405_1866876_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	9.7e-81
WP_110108321.1|1866930_1867332_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	94.7	2.9e-65
WP_032622502.1|1867355_1867619_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
WP_058687882.1|1867654_1870936_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	93.8	0.0e+00
WP_058687883.1|1870938_1871277_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.5e-62
WP_023305932.1|1871273_1872032_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	6.5e-143
WP_045347509.1|1872033_1872744_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.5	6.5e-145
WP_032622495.1|1872776_1873124_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	1.5e-06
WP_072203234.1|1873130_1873466_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	48.6	5.6e-22
WP_110108322.1|1874173_1877755_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	91.6	0.0e+00
WP_058687885.1|1877756_1878722_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
WP_165835090.1|1878781_1879918_+|tail	tail fiber domain-containing protein	tail	K7P6X7	Enterobacteria_phage	77.5	2.6e-71
WP_063619166.1|1880298_1882278_+	acyltransferase	NA	C6ZR20	Salmonella_phage	31.0	8.9e-67
WP_045329653.1|1882817_1883138_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.6	5.5e-27
WP_023299884.1|1883399_1884683_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
1891714:1891728	attR	CGCCCACCGCAATCG	NA	NA	NA	NA
>prophage 3
NZ_CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	2452872	2514734	4656282	tail,tRNA,plate,integrase,holin,terminase	Escherichia_phage(23.4%)	65	2501289:2501304	2515656:2515671
WP_071785691.1|2452872_2453073_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_110108420.1|2454175_2454493_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.1	1.5e-21
WP_110108422.1|2455031_2457011_-	acyltransferase	NA	C6ZR20	Salmonella_phage	30.7	1.7e-65
WP_110108423.1|2457391_2458528_-|tail	tail fiber domain-containing protein	tail	K7P6X7	Enterobacteria_phage	79.6	1.4e-72
WP_017382566.1|2458586_2458820_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_110108424.1|2458927_2459599_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	9.9e-87
WP_110108425.1|2459599_2459914_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	68.6	7.8e-34
WP_110108426.1|2459956_2463508_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	87.7	0.0e+00
WP_110108427.1|2463560_2464184_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	2.1e-54
WP_110108428.1|2464271_2464931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108429.1|2464968_2465682_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	84.1	6.8e-126
WP_110108430.1|2465683_2466439_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	79.2	5.0e-119
WP_110108431.1|2466435_2466783_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	2.9e-37
WP_063149549.1|2466844_2467201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108432.1|2467321_2470234_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	38.7	3.1e-153
WP_032618388.1|2470230_2470545_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.7	5.1e-17
WP_110108433.1|2470541_2470853_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	67.0	5.3e-35
WP_049136381.1|2470918_2471590_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.7	2.6e-50
WP_110108434.1|2471658_2472069_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	51.4	2.5e-32
WP_110108435.1|2472065_2472650_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	1.2e-48
WP_110108436.1|2472651_2473002_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	1.6e-32
WP_047363536.1|2473003_2473486_-	hypothetical protein	NA	A0A2I7RR81	Vibrio_phage	31.3	5.1e-08
WP_165835095.1|2473522_2473822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108437.1|2473803_2474757_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	2.6e-133
WP_022651278.1|2474768_2475539_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_110108438.1|2475619_2476717_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	2.3e-117
WP_110108439.1|2476718_2478107_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.9	1.5e-124
WP_110108440.1|2478108_2479416_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.5	1.3e-143
WP_058659700.1|2479393_2480392_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_032645635.1|2480438_2480888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645710.1|2482608_2482884_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_058652917.1|2482891_2483521_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	4.6e-102
WP_022651286.1|2483520_2483802_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_015570936.1|2483788_2484175_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_110108442.1|2484960_2485152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110108443.1|2485677_2486511_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.3	2.8e-123
WP_032645711.1|2486507_2486870_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_110108444.1|2487077_2487680_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.0	4.4e-94
WP_022651294.1|2488068_2488293_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651295.1|2488663_2489110_-	VOC family protein	NA	NA	NA	NA	NA
WP_058674972.1|2489596_2490778_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_014832179.1|2491642_2492092_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_110108445.1|2492368_2493055_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	1.2e-82
WP_165835091.1|2493051_2493969_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	72.0	5.5e-112
WP_110108447.1|2494053_2494596_-	regulator	NA	M9NZI6	Enterobacteria_phage	85.6	1.6e-82
WP_110108448.1|2494625_2494877_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	53.3	9.9e-16
WP_110108449.1|2495004_2495697_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	4.1e-59
WP_110108450.1|2495710_2496085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046885673.1|2496662_2497154_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	29.3	5.3e-13
WP_110108451.1|2497657_2500795_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	62.8	0.0e+00
WP_110108452.1|2500804_2501890_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.6	7.4e-124
2501289:2501304	attL	TGCTGGCTCAGGCCCG	NA	NA	NA	NA
WP_020882485.1|2501928_2502171_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_014884030.1|2502235_2502448_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_110108453.1|2502449_2503688_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	3.5e-170
WP_003856923.1|2503737_2504673_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_110108454.1|2504716_2506090_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	3.6e-51
WP_015570430.1|2506147_2506300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023324756.1|2506574_2507558_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_022651306.1|2507648_2508779_-	methyl-accepting chemotaxis sensory transducer	NA	NA	NA	NA	NA
WP_110108456.1|2509095_2509584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663422.1|2509612_2510929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663421.1|2510952_2511408_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032648436.1|2511407_2511953_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_110108457.1|2511930_2513016_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_110108458.1|2512979_2514734_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2515656:2515671	attR	CGGGCCTGAGCCAGCA	NA	NA	NA	NA
>prophage 4
NZ_CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	2990903	2997181	4656282		Enterobacteria_phage(50.0%)	6	NA	NA
WP_110108543.1|2990903_2991440_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.6	1.4e-51
WP_045341336.1|2991443_2992322_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.9e-107
WP_045617132.1|2992374_2993274_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.0	9.7e-29
WP_032659367.1|2993273_2994359_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	3.7e-99
WP_017383282.1|2994718_2995615_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_110108544.1|2995789_2997181_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.8e-19
>prophage 5
NZ_CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	3435508	3514652	4656282	tail,tRNA,plate,integrase,head,lysis,capsid,terminase,portal	Salmonella_phage(70.83%)	84	3480450:3480499	3514861:3514910
WP_045894642.1|3435508_3436246_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|3436378_3437707_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3437759_3438143_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045349762.1|3438458_3439148_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.6	1.8e-54
WP_022651671.1|3439187_3440273_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3440477_3440897_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|3440967_3441666_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023325080.1|3441701_3444365_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_026094276.1|3444474_3445830_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3445876_3446200_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|3446196_3447504_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|3447655_3448108_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_003863168.1|3453640_3456214_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_003863167.1|3456343_3457075_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023314684.1|3457071_3458052_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3458183_3458921_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3459188_3459530_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3459635_3459683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108611.1|3459790_3460951_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_023323575.1|3460947_3461820_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_022649060.1|3461880_3463002_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_110108612.1|3463012_3464083_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	3.4e-89
WP_023323612.1|3464295_3464670_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863149.1|3464823_3465360_+	YfiR family protein	NA	NA	NA	NA	NA
WP_110108614.1|3465352_3466573_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_047654140.1|3466585_3467071_+	OmpA family protein	NA	NA	NA	NA	NA
WP_110108616.1|3467073_3468444_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_045346112.1|3468482_3468887_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3469019_3469367_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_058659737.1|3469410_3470178_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3470209_3470749_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3470764_3471013_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3471129_3472491_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_020883913.1|3472582_3473449_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3473468_3474755_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3474807_3475401_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003863124.1|3475523_3476402_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_045337470.1|3476487_3478149_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3478123_3478306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3478287_3478626_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3478687_3478975_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3478964_3479441_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3479558_3480041_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
3480450:3480499	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
WP_045334934.1|3480611_3480830_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
WP_110108618.1|3480898_3481999_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.5	4.6e-182
WP_045356110.1|3481995_3482481_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	91.9	1.0e-72
WP_110108620.1|3482483_3485924_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.0	0.0e+00
WP_007848878.1|3485916_3486036_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_014884889.1|3486050_3486353_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
WP_007848874.1|3486407_3486923_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_007848866.1|3486932_3488105_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
WP_110108621.1|3488185_3488743_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.2	5.9e-85
WP_032665794.1|3489289_3489763_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	6.6e-53
WP_110108622.1|3491246_3491852_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	2.3e-111
WP_110108623.1|3491844_3492753_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.6e-143
WP_110108660.1|3492739_3493099_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.9e-53
WP_033487479.1|3493095_3493674_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	1.6e-104
WP_110108661.1|3493794_3494898_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	1.9e-18
WP_110108662.1|3494900_3495386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108663.1|3495406_3495856_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.9	2.4e-52
WP_110108664.1|3495848_3496280_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	86.7	1.5e-67
WP_110108666.1|3496375_3496804_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.9	4.4e-56
WP_110108667.1|3496800_3497316_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	4.5e-71
WP_110108668.1|3497296_3497512_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	64.8	4.4e-20
WP_110108669.1|3497515_3497719_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_110115476.1|3497718_3498183_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_110108670.1|3498276_3498927_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	96.3	1.1e-111
WP_110108671.1|3498930_3500013_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	3.4e-185
WP_110108672.1|3500029_3500863_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	83.4	2.5e-111
WP_110108673.1|3501005_3502772_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_110108674.1|3502771_3503806_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.7	2.2e-173
WP_110108675.1|3503808_3504513_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_110108676.1|3506252_3508646_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.7	0.0e+00
WP_110108677.1|3508642_3509494_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.6	4.8e-118
WP_110108678.1|3509490_3509718_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	2.4e-21
WP_110108679.1|3509717_3509945_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	65.3	1.6e-17
WP_110108680.1|3510012_3510354_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	82.3	1.5e-46
WP_110108681.1|3510317_3510518_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	78.5	2.1e-24
WP_110108682.1|3510525_3511035_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	6.0e-84
WP_032636666.1|3511067_3511310_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	4.0e-38
WP_110108683.1|3511429_3512062_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	91.9	1.1e-106
WP_110108684.1|3512063_3513089_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.2	2.6e-187
WP_110108685.1|3513109_3513892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110108686.1|3513884_3514652_+	FAD-dependent thymidylate synthase	NA	A0A0E3T7Y3	Gordonia_phage	34.0	2.5e-25
3514861:3514910	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
>prophage 1
NZ_CP021163	Enterobacter hormaechei strain 234 plasmid p234, complete sequence	68573	2236	57892	68573	transposase,integrase	Escherichia_phage(33.33%)	55	6080:6110	66288:66318
WP_000050481.1|2236_3778_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001749993.1|4242_5151_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	52.3	2.5e-77
WP_001749994.1|5242_5887_-	quinolone resistance pentapeptide repeat protein QnrB6	NA	NA	NA	NA	NA
6080:6110	attL	CGTGCATAATAAGCCCTACACAAATTGGGAG	NA	NA	NA	NA
WP_000679427.1|6117_6465_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|6458_7298_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|7425_7926_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|8432_9197_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|9457_10672_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|10705_12109_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|12520_12727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|12731_13244_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_020324562.1|13268_13973_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001039463.1|14735_15122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|15130_15322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|16319_17075_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_094686392.1|18741_19923_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_032621004.1|21239_22286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413492.1|22282_24091_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000493378.1|24715_25066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|25116_25860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|25856_26633_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|26690_26948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|27076_27181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|27715_28582_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|28938_29208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|29622_30828_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064120.1|30827_31802_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|31883_33155_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|33154_33586_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|33991_35479_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|35948_36914_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|37393_37825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|37857_38385_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|38644_39100_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|39171_39537_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|39552_39828_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|39855_40281_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|40319_42005_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|42022_42388_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|42384_42621_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|42604_42724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|42686_42899_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|43024_43585_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|43587_46539_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|46547_46949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|47033_47738_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|48662_49547_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|49763_50978_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_000743213.1|51251_51476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|51472_52210_-	recombinase family protein	NA	NA	NA	NA	NA
WP_020324562.1|52841_53546_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_000113282.1|53557_54214_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_108996614.1|54309_55494_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|55588_56698_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_020324562.1|57187_57892_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
66288:66318	attR	CGTGCATAATAAGCCCTACACAAATTGGGAG	NA	NA	NA	NA
