The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	281475	332859	5257213	tRNA,terminase,head,integrase,lysis	Cronobacter_phage(27.08%)	74	280958:281004	329930:329976
280958:281004	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040181289.1|281475_281715_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|281820_282621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186451.1|284706_287184_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|287170_287566_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|287562_288033_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|288032_288509_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|288622_289036_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|289055_289235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|289275_292716_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|292810_293314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|293416_293644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|293738_294056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|294107_294428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|294910_295384_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|295420_295852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|295862_296228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|296224_296530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|296834_297518_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|297570_298323_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|298391_298784_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|298780_299206_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|299208_299571_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|299570_299744_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|299743_300124_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|300126_300402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|300412_301507_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|301518_301947_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|301950_303336_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|303408_303759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|303858_304872_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|304804_306268_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|306280_307579_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_048294303.1|307562_308030_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_058842816.1|308060_308687_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|309536_309995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087760209.1|310428_310566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|310568_311036_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|311032_311563_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|311565_311814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322094.1|312241_312766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|313110_313800_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|313796_313937_-	YlcG family protein	NA	NA	NA	NA	NA
WP_058842819.1|313933_314569_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_032431555.1|314561_314732_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|314712_315180_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|315370_315628_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|315956_316154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|316146_316413_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|317424_317943_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|318445_318643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|318635_318899_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|318895_319318_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|319314_319617_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|319613_320351_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_040181719.1|320347_321313_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181694.1|321372_322170_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|322255_322477_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|322516_322750_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|322854_323544_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_032434121.1|323884_324601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|324591_325137_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|325185_325389_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_074183191.1|325698_325824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|325816_326011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|326100_326385_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|326401_327148_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|327144_327768_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|327796_328324_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|328320_328539_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|328540_328876_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|328752_329916_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|330347_331214_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
329930:329976	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|331215_331428_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|331473_332859_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 2
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	2997567	3057046	5257213	tRNA,terminase,tail,portal,head,integrase,protease,holin,capsid	Enterobacteria_phage(15.56%)	67	3020567:3020590	3060312:3060335
WP_004145598.1|2997567_2998986_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|2999037_2999430_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|2999433_2999787_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023301631.1|3000408_3002580_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|3002628_3003831_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|3004177_3005419_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_004899719.1|3005476_3005830_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|3005960_3006953_-	oxidoreductase	NA	NA	NA	NA	NA
WP_023301633.1|3007133_3008795_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|3008791_3010027_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|3010290_3011256_+	glucokinase	NA	NA	NA	NA	NA
WP_004145587.1|3011309_3012062_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|3012058_3013756_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|3013754_3013868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409803.1|3013864_3014050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|3014138_3015353_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|3015423_3015495_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|3015833_3017030_-	MFS transporter	NA	NA	NA	NA	NA
WP_023301635.1|3017026_3017485_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|3017617_3018526_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|3018535_3019417_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|3019783_3020266_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3020567:3020590	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_040181793.1|3020784_3021954_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.0	4.3e-202
WP_040181795.1|3021986_3022925_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_040181798.1|3023133_3023781_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.3	1.2e-44
WP_040181799.1|3023780_3023993_-	hypothetical protein	NA	R9TNC2	Aeromonas_phage	97.1	8.6e-37
WP_040181802.1|3024584_3025661_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.8	1.5e-148
WP_040181805.1|3025660_3026446_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	7.6e-62
WP_040181807.1|3026445_3026745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408726.1|3027591_3028239_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|3028343_3028541_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|3028566_3029028_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_071557781.1|3029265_3029478_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_060618150.1|3029434_3030349_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_040181816.1|3030345_3031155_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	1.3e-109
WP_040181820.1|3031164_3031542_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_040181823.1|3031554_3032535_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	8.4e-135
WP_040181825.1|3032548_3033127_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_040181828.1|3033233_3033839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|3034078_3034465_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|3034451_3034733_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_040181832.1|3034732_3035362_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	2.5e-87
WP_040181834.1|3035364_3035640_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.6	1.0e-05
WP_040181839.1|3035900_3036089_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	77.0	3.2e-19
WP_077256034.1|3036126_3036252_+	hypothetical protein	NA	M1FJ79	Enterobacteria_phage	66.7	2.4e-07
WP_040181841.1|3036287_3036743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181844.1|3036815_3037166_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	4.1e-52
WP_001119413.1|3037324_3037822_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_064162524.1|3037825_3039577_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	3.3e-251
WP_000923127.1|3039724_3040951_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|3040943_3041543_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_040181854.1|3041552_3042791_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	3.9e-153
WP_019705272.1|3042868_3043186_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_019705271.1|3043194_3043533_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705270.1|3043529_3043979_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|3043975_3044323_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_040181857.1|3044379_3045084_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_021313622.1|3045114_3045519_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|3045521_3045827_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|3045900_3046134_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_040181859.1|3046194_3049581_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	4.7e-302
WP_004884312.1|3049602_3050076_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_040181862.1|3050062_3050539_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	63.9	3.4e-49
WP_040181864.1|3050551_3050932_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_040181865.1|3050928_3054006_+	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_040181868.1|3056051_3056852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074177881.1|3056863_3057046_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
3060312:3060335	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 3
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	3281955	3288860	5257213	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3281955_3282819_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|3282829_3283603_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|3283843_3284740_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3284982_3286344_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3286662_3287385_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3287381_3288860_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	3558354	3628008	5257213	terminase,lysis,integrase,plate	Salmonella_phage(25.81%)	89	3556525:3556542	3595223:3595240
3556525:3556542	attL	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_004175494.1|3558354_3559650_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_074183181.1|3559661_3560471_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312745.1|3560711_3561974_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|3562016_3562262_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_016529283.1|3562265_3562484_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_040181675.1|3562480_3562690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181676.1|3562686_3562992_-	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	35.6	7.4e-05
WP_040181677.1|3562988_3563180_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	1.6e-13
WP_040181678.1|3563176_3563941_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.7	2.7e-72
WP_040181679.1|3564157_3564928_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_040181681.1|3564924_3565452_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|3565448_3565607_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|3565603_3566290_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_129693859.1|3566282_3566903_-	hypothetical protein	NA	A0A076GAP8	Staphylococcus_phage	43.8	5.5e-23
WP_040181685.1|3566899_3567745_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|3567760_3568045_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_004151303.1|3568134_3568329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181689.1|3568321_3568432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181691.1|3568773_3569406_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	9.2e-34
WP_023284762.1|3569505_3569721_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_040181693.1|3569770_3570091_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
WP_040181694.1|3570177_3570975_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_040181719.1|3571034_3572000_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181695.1|3571996_3572734_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|3572730_3573033_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|3573029_3573452_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_040181701.1|3573448_3573709_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|3574240_3574453_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|3575081_3575495_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_040181178.1|3575995_3576451_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
WP_040181180.1|3576450_3576621_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
WP_040181182.1|3576613_3577252_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_040181184.1|3577248_3577389_+	YlcG family protein	NA	NA	NA	NA	NA
WP_040181186.1|3577385_3578195_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_004146347.1|3579380_3579695_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_040181191.1|3579697_3580201_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|3580197_3580665_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|3580667_3580805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441335.1|3581161_3581650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|3581600_3583001_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|3583238_3584690_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|3584745_3585294_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|3585339_3585534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|3585543_3586746_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|3586749_3587244_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181207.1|3587255_3588197_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
WP_040181209.1|3588236_3588518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181211.1|3588486_3588906_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.1e-40
WP_040181213.1|3588902_3589409_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	2.4e-16
WP_023312779.1|3589408_3589795_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|3589889_3590330_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_040181215.1|3590333_3591479_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	6.3e-166
WP_023312781.1|3591488_3591932_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_040181217.1|3591935_3592355_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	8.8e-41
WP_016244729.1|3592396_3592549_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_040181220.1|3592538_3594458_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	72.3	3.0e-192
WP_024191492.1|3594643_3595057_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.1	1.8e-30
WP_074183180.1|3595132_3595360_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.7e-19
3595223:3595240	attR	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_040181225.1|3595362_3596394_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
WP_087760196.1|3596494_3596728_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	8.9e-19
WP_040181227.1|3596766_3597273_+	hypothetical protein	NA	A0A0M3ULK2	Salmonella_phage	47.6	3.1e-32
WP_040181228.1|3597311_3598067_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.0	4.0e-84
WP_023312790.1|3598066_3598420_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
WP_040181231.1|3598419_3599619_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	75.3	1.3e-161
WP_040181232.1|3599615_3600389_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_023284799.1|3600388_3601162_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
WP_087750251.1|3601180_3603160_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	28.0	6.9e-27
WP_072040613.1|3603169_3603970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181236.1|3604075_3604315_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	1.1e-16
WP_040181238.1|3604314_3604632_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
WP_040181240.1|3605606_3606089_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|3606280_3606979_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|3607004_3607544_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|3607658_3607988_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032411811.1|3608155_3608317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009307582.1|3608553_3609894_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004175498.1|3609890_3610544_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307583.1|3610547_3612245_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009307584.1|3612703_3615331_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_023342696.1|3615333_3617361_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_004148791.1|3617375_3618272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413757.1|3618764_3619172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|3619197_3619455_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181245.1|3619459_3620671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029498250.1|3621135_3624102_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181246.1|3624235_3625999_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|3626028_3627045_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004184604.1|3627025_3627562_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|3627564_3628008_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	4298615	4308030	5257213		Escherichia_phage(87.5%)	9	NA	NA
WP_162557934.1|4298615_4300250_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	56.0	3.6e-183
WP_004176258.1|4300304_4301570_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|4301600_4302689_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|4302775_4303036_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|4303333_4304194_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|4304214_4304976_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4305237_4306140_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|4306151_4307417_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|4307409_4308030_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	4578303	4599546	5257213	tail,holin,terminase	Pseudomonas_phage(30.0%)	26	NA	NA
WP_077264109.1|4578303_4581219_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.2	4.9e-90
WP_129693861.1|4581798_4582197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967913.1|4582264_4582462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967912.1|4582599_4583082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289860.1|4583136_4584309_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_012967910.1|4584332_4584725_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|4584721_4585273_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_048289859.1|4585274_4585658_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	1.6e-20
WP_072072127.1|4585644_4585878_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	6.4e-09
WP_048289858.1|4585887_4586142_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	3.0e-20
WP_048289857.1|4586143_4586539_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	4.3e-13
WP_133060713.1|4586579_4586852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289856.1|4586860_4587814_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	6.5e-132
WP_048289855.1|4587824_4588604_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.0	2.7e-67
WP_048289854.1|4589116_4590229_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	1.6e-110
WP_048267898.1|4590212_4591613_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_016946682.1|4591614_4592928_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_048289853.1|4592911_4593907_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190672.1|4594995_4595271_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_048289852.1|4595267_4595612_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	2.6e-38
WP_004184488.1|4595608_4596148_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024176410.1|4596144_4596444_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_048289851.1|4597201_4598023_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
WP_086528373.1|4598019_4598160_-	YlcG family protein	NA	NA	NA	NA	NA
WP_048289850.1|4598156_4598738_-	protein ninG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
WP_086528372.1|4598946_4599546_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	3.8e-90
>prophage 7
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	4603978	4619610	5257213	integrase	Salmonella_phage(50.0%)	21	4602736:4602749	4619899:4619912
4602736:4602749	attL	GATATTCCGGCGCT	NA	NA	NA	NA
WP_032445505.1|4603978_4604179_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	57.5	3.2e-09
WP_032445503.1|4604654_4604891_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	90.7	7.1e-32
WP_019705292.1|4604883_4605087_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_032423776.1|4605083_4605452_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_004215885.1|4605444_4606188_-	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
WP_004215886.1|4606184_4607105_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_032445502.1|4607455_4607992_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.9	6.3e-60
WP_023320775.1|4607994_4608222_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_050485525.1|4608326_4608761_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_004179600.1|4609149_4609341_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|4609349_4609505_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_048289849.1|4609642_4612681_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.2	1.0e-292
WP_048289848.1|4612693_4613803_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_004190719.1|4613837_4614176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160779.1|4614168_4614780_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_048289847.1|4614776_4615085_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
WP_004892750.1|4615092_4615332_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_048289846.1|4615552_4616770_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	4.3e-120
WP_004151901.1|4616916_4617807_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|4617806_4618799_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|4618800_4619610_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
4619899:4619912	attR	AGCGCCGGAATATC	NA	NA	NA	NA
>prophage 8
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	4738982	4785120	5257213	tRNA,terminase,tail,portal,head,integrase,plate,capsid	Enterobacteria_phage(54.55%)	54	4744210:4744227	4781386:4781403
WP_004892876.1|4738982_4739483_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|4739599_4740046_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|4740029_4740824_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|4740931_4742107_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|4742138_4742831_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|4742976_4743486_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|4743490_4743829_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|4743818_4744058_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
4744210:4744227	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|4744322_4744574_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|4744617_4745757_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|4745911_4747084_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|4747083_4747599_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|4747644_4747962_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_075604421.1|4747961_4748120_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040181412.1|4748106_4751082_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|4751097_4751571_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|4752034_4752697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|4752714_4753938_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|4754537_4755635_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|4755634_4755847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110047733.1|4755843_4758870_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|4758859_4759783_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|4759784_4760135_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|4760131_4760719_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|4760715_4761351_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|4761347_4761815_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_158246032.1|4761815_4762151_-	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_023339943.1|4762337_4762883_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|4762879_4763164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|4763154_4763355_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|4763354_4763870_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|4763982_4764840_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|4764889_4765924_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|4765933_4766773_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|4766929_4768657_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|4768650_4769712_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|4770556_4771348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|4771347_4773618_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181444.1|4776507_4777464_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|4777696_4778263_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|4778259_4778484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|4778552_4778825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|4778840_4779218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|4779233_4779452_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|4779472_4779751_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|4779871_4780171_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|4780286_4781270_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|4781534_4782548_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
4781386:4781403	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|4782605_4782707_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|4782706_4782781_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|4782898_4783024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|4783083_4783347_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|4783477_4784116_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|4784205_4785120_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 9
NZ_CP029590	Klebsiella pneumoniae strain DA33144 chromosome, complete genome	5257213	5047620	5057094	5257213	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|5047620_5049342_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_072145323.1|5049368_5050088_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|5050441_5050660_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|5050790_5053070_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|5053100_5053418_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|5053743_5053965_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|5054041_5055982_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|5055978_5057094_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP029591	Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence	219996	46102	69270	219996	transposase,protease,integrase	Salmonella_phage(30.0%)	23	50681:50740	76805:77624
WP_000616807.1|46102_46756_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|46848_47106_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|47038_47440_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|47576_50474_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
50681:50740	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|50743_51448_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|51569_52475_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|52471_53710_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|53709_54294_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|54786_55551_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|55777_56083_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|56093_57299_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|57454_57658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|57785_58625_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|58618_58966_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|59129_59921_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|59926_60217_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|60328_60826_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|60970_61984_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|62186_62537_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|62662_63223_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000027057.1|65843_66704_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|66886_67444_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|68007_69270_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
76805:77624	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCCACCTATGTGCTCGACGG	NA	NA	NA	NA
>prophage 2
NZ_CP029591	Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence	219996	73101	104659	219996	transposase,protease	Escherichia_phage(50.0%)	27	NA	NA
WP_004217321.1|73101_73806_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063840321.1|73949_74504_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|74634_75465_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|76096_76801_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|78422_78665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|78696_79347_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|79452_80652_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|80683_81568_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|81705_82098_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_032409011.1|82874_83399_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	34.4	8.8e-14
WP_044117068.1|83428_84097_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004217321.1|85400_86105_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014386147.1|86960_87788_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_004152695.1|87784_88648_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|88656_89484_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|89492_90503_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|90496_91366_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386148.1|92574_93555_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004118209.1|94756_95020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|95034_95298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|95541_95823_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|95857_96427_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|96541_99337_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|99336_99534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|99771_100521_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|100507_101470_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|103312_104659_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
