The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	214701	224175	5255790	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|214701_216423_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_072145323.1|216449_217169_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|217522_217741_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|217871_220151_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|220181_220499_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|220824_221046_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|221122_223063_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|223059_224175_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 2
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	705547	756931	5255790	integrase,terminase,tRNA,lysis,head	Cronobacter_phage(27.08%)	74	705030:705076	754002:754048
705030:705076	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040181289.1|705547_705787_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|705892_706693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186451.1|708778_711256_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|711242_711638_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|711634_712105_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|712104_712581_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|712694_713108_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|713127_713307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|713347_716788_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|716882_717386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|717488_717716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|717810_718128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|718179_718500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|718982_719456_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|719492_719924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|719934_720300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|720296_720602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|720906_721590_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|721642_722395_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|722463_722856_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|722852_723278_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|723280_723643_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|723642_723816_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|723815_724196_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|724198_724474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|724484_725579_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|725590_726019_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|726022_727408_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|727480_727831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|727930_728944_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|728876_730340_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|730352_731651_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_048294303.1|731634_732102_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_058842816.1|732132_732759_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|733608_734067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087760209.1|734500_734638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|734640_735108_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|735104_735635_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|735637_735886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322094.1|736313_736838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|737182_737872_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|737868_738009_-	YlcG family protein	NA	NA	NA	NA	NA
WP_058842819.1|738005_738641_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_032431555.1|738633_738804_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|738784_739252_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|739442_739700_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|740028_740226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|740218_740485_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|741496_742015_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|742517_742715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|742707_742971_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|742967_743390_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|743386_743689_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|743685_744423_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_040181719.1|744419_745385_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181694.1|745444_746242_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|746327_746549_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|746588_746822_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|746926_747616_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_032434121.1|747956_748673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|748663_749209_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|749257_749461_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_074183191.1|749770_749896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|749888_750083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|750172_750457_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|750473_751220_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|751216_751840_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|751868_752396_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|752392_752611_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|752612_752948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|752824_753988_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|754419_755286_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
754002:754048	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|755287_755500_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|755545_756931_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 3
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	3420440	3479919	5255790	integrase,holin,terminase,protease,tRNA,portal,tail,capsid,head	Enterobacteria_phage(15.56%)	67	3443440:3443463	3483185:3483208
WP_004145598.1|3420440_3421859_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|3421910_3422303_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|3422306_3422660_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023301631.1|3423281_3425453_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|3425501_3426704_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|3427050_3428292_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_004899719.1|3428349_3428703_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|3428833_3429826_-	oxidoreductase	NA	NA	NA	NA	NA
WP_023301633.1|3430006_3431668_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|3431664_3432900_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|3433163_3434129_+	glucokinase	NA	NA	NA	NA	NA
WP_004145587.1|3434182_3434935_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|3434931_3436629_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|3436627_3436741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409803.1|3436737_3436923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|3437011_3438226_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|3438296_3438368_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|3438706_3439903_-	MFS transporter	NA	NA	NA	NA	NA
WP_023301635.1|3439899_3440358_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|3440490_3441399_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|3441408_3442290_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|3442656_3443139_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3443440:3443463	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_040181793.1|3443657_3444827_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.0	4.3e-202
WP_040181795.1|3444859_3445798_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_040181798.1|3446006_3446654_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.3	1.2e-44
WP_040181799.1|3446653_3446866_-	hypothetical protein	NA	R9TNC2	Aeromonas_phage	97.1	8.6e-37
WP_040181802.1|3447457_3448534_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.8	1.5e-148
WP_040181805.1|3448533_3449319_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	7.6e-62
WP_040181807.1|3449318_3449618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408726.1|3450464_3451112_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|3451216_3451414_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|3451439_3451901_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_071557781.1|3452138_3452351_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_060618150.1|3452307_3453222_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_040181816.1|3453218_3454028_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	1.3e-109
WP_040181820.1|3454037_3454415_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_040181823.1|3454427_3455408_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	8.4e-135
WP_040181825.1|3455421_3456000_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_040181828.1|3456106_3456712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|3456951_3457338_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|3457324_3457606_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_040181832.1|3457605_3458235_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	2.5e-87
WP_040181834.1|3458237_3458513_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.6	1.0e-05
WP_040181839.1|3458773_3458962_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	77.0	3.2e-19
WP_077256034.1|3458999_3459125_+	hypothetical protein	NA	M1FJ79	Enterobacteria_phage	66.7	2.4e-07
WP_040181841.1|3459160_3459616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181844.1|3459688_3460039_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	4.1e-52
WP_001119413.1|3460197_3460695_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_064162524.1|3460698_3462450_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	3.3e-251
WP_000923127.1|3462597_3463824_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|3463816_3464416_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_040181854.1|3464425_3465664_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	3.9e-153
WP_019705272.1|3465741_3466059_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_019705271.1|3466067_3466406_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705270.1|3466402_3466852_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|3466848_3467196_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_040181857.1|3467252_3467957_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_021313622.1|3467987_3468392_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|3468394_3468700_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|3468773_3469007_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_040181859.1|3469067_3472454_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	4.7e-302
WP_004884312.1|3472475_3472949_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_040181862.1|3472935_3473412_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	63.9	3.4e-49
WP_040181864.1|3473424_3473805_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_040181865.1|3473801_3476879_+	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_040181868.1|3478924_3479725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074177881.1|3479736_3479919_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
3483185:3483208	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 4
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	3704828	3711733	5255790	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3704828_3705692_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|3705702_3706476_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|3706716_3707613_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3707855_3709217_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3709535_3710258_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3710254_3711733_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	3981227	4050881	5255790	integrase,lysis,terminase,plate	Salmonella_phage(25.81%)	89	3979398:3979415	4018096:4018113
3979398:3979415	attL	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_004175494.1|3981227_3982523_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_074183181.1|3982534_3983344_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312745.1|3983584_3984847_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|3984889_3985135_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_016529283.1|3985138_3985357_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_040181675.1|3985353_3985563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181676.1|3985559_3985865_-	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	35.6	7.4e-05
WP_040181677.1|3985861_3986053_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	1.6e-13
WP_040181678.1|3986049_3986814_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.7	2.7e-72
WP_040181679.1|3987030_3987801_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_040181681.1|3987797_3988325_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|3988321_3988480_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|3988476_3989163_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_124072215.1|3989155_3989605_-	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.6	1.0e-18
WP_040181685.1|3989772_3990618_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|3990633_3990918_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_004151303.1|3991007_3991202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181689.1|3991194_3991305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181691.1|3991646_3992279_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	9.2e-34
WP_023284762.1|3992378_3992594_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_040181693.1|3992643_3992964_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
WP_040181694.1|3993050_3993848_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_040181719.1|3993907_3994873_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181695.1|3994869_3995607_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|3995603_3995906_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|3995902_3996325_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_040181701.1|3996321_3996582_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|3997113_3997326_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|3997954_3998368_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_040181178.1|3998868_3999324_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
WP_040181180.1|3999323_3999494_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
WP_040181182.1|3999486_4000125_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_040181184.1|4000121_4000262_+	YlcG family protein	NA	NA	NA	NA	NA
WP_040181186.1|4000258_4001068_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_004146347.1|4002253_4002568_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_040181191.1|4002570_4003074_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|4003070_4003538_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|4003540_4003678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441335.1|4004034_4004523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|4004473_4005874_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|4006111_4007563_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|4007618_4008167_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|4008212_4008407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|4008416_4009619_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|4009622_4010117_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181207.1|4010128_4011070_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
WP_040181209.1|4011109_4011391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181211.1|4011359_4011779_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.1e-40
WP_040181213.1|4011775_4012282_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	2.4e-16
WP_023312779.1|4012281_4012668_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|4012762_4013203_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_040181215.1|4013206_4014352_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	6.3e-166
WP_023312781.1|4014361_4014805_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_040181217.1|4014808_4015228_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	8.8e-41
WP_016244729.1|4015269_4015422_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_040181220.1|4015411_4017331_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	72.3	3.0e-192
WP_024191492.1|4017516_4017930_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.1	1.8e-30
WP_074183180.1|4018005_4018233_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.7e-19
4018096:4018113	attR	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_040181225.1|4018235_4019267_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
WP_087760196.1|4019367_4019601_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	8.9e-19
WP_040181227.1|4019639_4020146_+	hypothetical protein	NA	A0A0M3ULK2	Salmonella_phage	47.6	3.1e-32
WP_040181228.1|4020184_4020940_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.0	4.0e-84
WP_023312790.1|4020939_4021293_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
WP_040181231.1|4021292_4022492_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	75.3	1.3e-161
WP_040181232.1|4022488_4023262_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_023284799.1|4023261_4024035_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
WP_087750251.1|4024053_4026033_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	28.0	6.9e-27
WP_072040613.1|4026042_4026843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181236.1|4026948_4027188_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	1.1e-16
WP_040181238.1|4027187_4027505_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
WP_040181240.1|4028479_4028962_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4029153_4029852_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|4029877_4030417_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|4030531_4030861_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032411811.1|4031028_4031190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009307582.1|4031426_4032767_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004175498.1|4032763_4033417_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307583.1|4033420_4035118_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009307584.1|4035576_4038204_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_023342696.1|4038206_4040234_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_004148791.1|4040248_4041145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413757.1|4041637_4042045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|4042070_4042328_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181245.1|4042332_4043544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029498250.1|4044008_4046975_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181246.1|4047108_4048872_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|4048901_4049918_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004184604.1|4049898_4050435_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|4050437_4050881_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	4721487	4730902	5255790		Escherichia_phage(87.5%)	9	NA	NA
WP_162557934.1|4721487_4723122_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	56.0	3.6e-183
WP_004176258.1|4723176_4724442_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|4724472_4725561_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|4725647_4725908_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|4726205_4727066_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|4727086_4727848_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4728109_4729012_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|4729023_4730289_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|4730281_4730902_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	5001175	5022418	5255790	tail,holin,terminase	Pseudomonas_phage(30.0%)	26	NA	NA
WP_077264109.1|5001175_5004091_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.2	4.9e-90
WP_129693861.1|5004670_5005069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967913.1|5005136_5005334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967912.1|5005471_5005954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289860.1|5006008_5007181_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_012967910.1|5007204_5007597_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|5007593_5008145_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_048289859.1|5008146_5008530_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	1.6e-20
WP_072072127.1|5008516_5008750_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	6.4e-09
WP_048289858.1|5008759_5009014_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	3.0e-20
WP_048289857.1|5009015_5009411_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	4.3e-13
WP_133060713.1|5009451_5009724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289856.1|5009732_5010686_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	6.5e-132
WP_048289855.1|5010696_5011476_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.0	2.7e-67
WP_048289854.1|5011988_5013101_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	1.6e-110
WP_048267898.1|5013084_5014485_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_016946682.1|5014486_5015800_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_048289853.1|5015783_5016779_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190672.1|5017867_5018143_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_048289852.1|5018139_5018484_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	2.6e-38
WP_004184488.1|5018480_5019020_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024176410.1|5019016_5019316_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_048289851.1|5020073_5020895_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
WP_086528373.1|5020891_5021032_-	YlcG family protein	NA	NA	NA	NA	NA
WP_048289850.1|5021028_5021610_-	protein ninG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
WP_086528372.1|5021818_5022418_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	3.8e-90
>prophage 8
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	5026850	5042481	5255790	integrase	Salmonella_phage(52.94%)	20	5025608:5025621	5042770:5042783
5025608:5025621	attL	GATATTCCGGCGCT	NA	NA	NA	NA
WP_032445505.1|5026850_5027051_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	57.5	3.2e-09
WP_032445503.1|5027526_5027763_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	90.7	7.1e-32
WP_019705292.1|5027755_5027959_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_032423776.1|5027955_5028324_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_004215885.1|5028316_5029060_-	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
WP_032445502.1|5030326_5030863_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.9	6.3e-60
WP_023320775.1|5030865_5031093_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_050485525.1|5031197_5031632_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_004179600.1|5032020_5032212_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|5032220_5032376_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_048289849.1|5032513_5035552_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.2	1.0e-292
WP_048289848.1|5035564_5036674_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_004190719.1|5036708_5037047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160779.1|5037039_5037651_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_048289847.1|5037647_5037956_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
WP_004892750.1|5037963_5038203_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_048289846.1|5038423_5039641_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	4.3e-120
WP_004151901.1|5039787_5040678_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|5040677_5041670_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|5041671_5042481_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
5042770:5042783	attR	AGCGCCGGAATATC	NA	NA	NA	NA
>prophage 9
NZ_CP029587	Klebsiella pneumoniae strain DA33141 chromosome, complete genome	5255790	5161853	5207991	5255790	integrase,terminase,tRNA,portal,tail,plate,capsid,head	Enterobacteria_phage(54.55%)	54	5167081:5167098	5204257:5204274
WP_004892876.1|5161853_5162354_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|5162470_5162917_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|5162900_5163695_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|5163802_5164978_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|5165009_5165702_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|5165847_5166357_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|5166361_5166700_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|5166689_5166929_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
5167081:5167098	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|5167193_5167445_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|5167488_5168628_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|5168782_5169955_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|5169954_5170470_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|5170515_5170833_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_075604421.1|5170832_5170991_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040181412.1|5170977_5173953_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|5173968_5174442_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|5174905_5175568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|5175585_5176809_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|5177408_5178506_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|5178505_5178718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110047733.1|5178714_5181741_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|5181730_5182654_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|5182655_5183006_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|5183002_5183590_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|5183586_5184222_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|5184218_5184686_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_158246032.1|5184686_5185022_-	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_023339943.1|5185208_5185754_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|5185750_5186035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|5186025_5186226_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|5186225_5186741_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|5186853_5187711_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|5187760_5188795_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|5188804_5189644_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|5189800_5191528_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|5191521_5192583_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|5193427_5194219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|5194218_5196489_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181444.1|5199378_5200335_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|5200567_5201134_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|5201130_5201355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|5201423_5201696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|5201711_5202089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|5202104_5202323_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|5202343_5202622_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|5202742_5203042_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|5203157_5204141_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|5204405_5205419_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
5204257:5204274	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|5205476_5205578_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|5205577_5205652_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|5205769_5205895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|5205954_5206218_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|5206348_5206987_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|5207076_5207991_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 1
NZ_CP029588	Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence	216772	974	62757	216772	transposase,protease	uncultured_Caudovirales_phage(29.41%)	57	NA	NA
WP_011977741.1|974_1943_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|2615_2873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|3492_4929_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|5911_7189_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|7251_9249_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|10288_11496_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|12924_13356_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|13606_15082_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|15074_15755_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|15944_17330_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|17358_17712_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|17825_19118_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|19128_22275_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|22361_22802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|22928_25376_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|25416_25614_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|25647_26385_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|26673_27123_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|27356_29174_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|29173_30070_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|30109_30490_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|30494_31424_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|31478_32159_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|32155_33556_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|33772_34207_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|34438_34618_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|36360_36870_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|36919_37417_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|37748_38075_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014386151.1|38071_38785_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	76.6	2.4e-91
WP_004182005.1|38793_39339_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|39414_39777_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|41673_42210_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|42242_42668_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|42680_43970_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|44017_45769_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|45786_46149_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|46198_46549_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|46906_47176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|47163_47739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|47769_48264_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|48307_48676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|48709_48913_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|48961_49219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|49294_49549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|49724_49991_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|49978_50461_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|50672_52019_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|53861_54824_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|54810_55560_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|55797_55995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|55994_58790_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|58904_59474_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|59508_59790_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|60033_60297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|60311_60575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014386148.1|61776_62757_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
>prophage 2
NZ_CP029588	Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence	216772	69226	106005	216772	transposase,protease,integrase	Escherichia_phage(37.5%)	34	78468:78527	101368:102187
WP_004217321.1|69226_69931_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|71234_71903_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_032409011.1|71932_72457_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	34.4	8.8e-14
WP_001351729.1|73233_73626_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|73763_74648_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|74679_75879_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|75984_76635_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|76666_76909_-	hypothetical protein	NA	NA	NA	NA	NA
78468:78527	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|78530_79235_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|79866_80697_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|80827_81382_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_004217321.1|81525_82230_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001393253.1|84551_84884_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|84930_85806_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|86061_87324_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|87887_88445_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|88627_89488_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_110082633.1|92108_92570_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.3e-49
WP_001389365.1|92594_93359_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|93585_93891_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|93901_95107_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|95262_95466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|95593_96433_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|96426_96774_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|96937_97729_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|97734_98025_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|98136_98634_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|98778_99792_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|99994_100345_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|100659_101364_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|101633_104531_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
101368:102187	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCCACCACGTCGTAGCCGGCACAGCCGGCGAAGGCTCGCAGATCAAATTCCTGGCGTTCACAAGACTGATCCGCTGTTGAAACCCGGCAGTAAATGGCGGCACGATGTCCCAATTGAACCCTCCTGGATTTTTGTATCGGAACGCCCTGATTTATATGGGCTGGCTGTTGTCCAAAACAGACTATACTTCAAAAGGGACGAATTTGTATGTCACGACGCCATATTTTCACCGAACGGCAGCGAGCAGCGCTGTTCGATCTGCCCACGGACGAACTGTCGCTACTGAAGTTCTACACGCTGGGCGATGATGACCTGGAAAACATTAGGCAGCGCCGCAGACCGGAAAACAGGATTGGCTTTGCCCTGCAACTTTGTGCCTTACGATATCCGGGCCGTGCACTGGCTCCTGGTGAGATGATCCCGCGTGAAGTCCTTTCCTTCGTCGGTGCTCAGCTTGGAGTTCCGGCTGATGCGCTTCTCACTTATGCCACACGGCGCCAAACCCGTCAGCAGCACATGGACACGCTGCGCGAAATTTACGGCTACAAGACCTTCACGGGCCGTGGTGCCCGTGATCTGCGGGAGTGGACTTTCGGCCAGGCCGAAGATGCCAGATCAAACGAGGATCTTGCTCATCGTTTTATTGTGCGGTGTCGGGAAACTTCCACCATTCTGCCCGCAGTATCGACAATCGAGCGCTTGTGCGCGGATGCTCTGGTCGCCGCTGAGCGGCGGATTGAAACGCGGATTGCGGAAAATTT	NA	NA	NA	NA
WP_001398199.1|104667_105069_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|105001_105259_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|105351_106005_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
