The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	47264	107121	5261695	capsid,terminase,portal,lysis,head,tail,integrase,transposase	Enterobacteria_phage(45.28%)	79	78117:78132	111817:111832
WP_000527786.1|47264_48725_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_001523332.1|48813_50097_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|50700_50814_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|50882_51116_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|51432_52023_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|52250_52544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|52554_53259_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|53268_53550_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_110074589.1|53546_55946_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001542091.1|56010_56610_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|56677_60157_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|60217_60820_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_162543933.1|60756_61149_-	C40 family peptidase	NA	A5LH41	Enterobacteria_phage	96.9	1.1e-72
WP_162543934.1|61145_61499_-	cell wall hydrolase	NA	K7PLW1	Enterobacteria_phage	98.0	9.9e-54
WP_001551186.1|61504_62203_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|62202_62532_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|62528_65090_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|65082_65517_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|65498_65921_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|65936_66677_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|66684_67080_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|67076_67655_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|67666_68020_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|68031_68430_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|68471_69497_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|69551_69884_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|69893_71213_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|71193_72795_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|72791_72998_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|72994_74920_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|74894_75440_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_110074590.1|75828_76062_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	1.9e-21
WP_000373090.1|76119_76530_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|76681_76855_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|77026_77182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|77261_77327_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|77329_77518_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|77528_77741_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|78103_78601_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
78117:78132	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|78597_79131_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|79127_79439_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|79443_79659_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|80412_80628_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|80928_81141_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|81195_81285_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|81562_82315_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|82328_83378_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|83379_83658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|83724_83976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|84192_84348_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|84419_84707_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|84706_84946_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|84970_85276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|85478_85811_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|86247_87561_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001345551.1|88044_89073_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|89069_89684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|89892_90558_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|90760_91159_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|91199_92165_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|92145_92667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|92650_92878_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|92958_93366_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|93534_93690_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|93691_94267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|94753_94942_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|94938_95130_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|95223_97695_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001296941.1|97782_98019_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_021523105.1|98053_99334_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|99335_99464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|99521_100541_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|100552_101767_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|101972_102299_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|102433_102775_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|102809_103370_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|103372_104083_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|104190_104496_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|104694_107121_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
111817:111832	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	456175	525903	5261695	capsid,portal,terminase,holin,plate,head,tail,integrase,transposase,protease	Shigella_phage(36.73%)	87	493706:493721	530863:530878
WP_001347174.1|456175_456700_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879825.1|456856_457654_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|457663_458215_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|458383_458716_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001301376.1|459059_459374_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_021518742.1|459588_461247_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|461239_462235_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282678.1|462227_462914_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|462913_464287_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|464305_464749_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000618061.1|464745_465873_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|465977_466442_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|466446_467451_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|467447_467861_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|467863_468229_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|468228_468966_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|468975_469245_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983972.1|469253_470039_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_020233537.1|470328_470952_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|470995_471238_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|471346_471574_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949112.1|471871_472687_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_020233536.1|472683_474378_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|474615_474798_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|474876_475794_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|475966_476887_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|476875_477346_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|477326_478745_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|480853_482212_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|482211_482883_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|483015_483429_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_021523130.1|483537_484542_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240090.1|484542_485178_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007754.1|485434_486085_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_021562679.1|487544_489920_-|tail	tail fiber domain-containing protein	tail	O22004	Shigella_phage	71.8	1.1e-47
WP_001566758.1|489923_490508_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	4.6e-112
WP_001566759.1|490498_491557_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	2.5e-201
WP_000424732.1|491543_491969_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_021562678.1|491968_492517_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_001566762.1|492516_493596_-	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	7.7e-206
WP_001566763.1|493592_494966_-|tail	phage tail/DNA circulation protein	tail	U5P4I0	Shigella_phage	97.3	1.5e-243
493706:493721	attL	GCACCAGCGCGGGTAA	NA	NA	NA	NA
WP_001566765.1|495022_495511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001566766.1|495575_497477_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
WP_000571713.1|497561_497885_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|497881_498238_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_042092009.1|498237_499734_-|tail	tail sheath protein	tail	S5FKL0	Shigella_phage	98.6	1.7e-275
WP_000497751.1|499717_499888_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001566768.1|499896_500457_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.8	9.8e-104
WP_000224835.1|500453_500960_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_001566769.1|500934_501345_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	92.6	2.2e-68
WP_000924830.1|501341_501665_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_001566770.1|501742_502960_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	2.2e-161
WP_000999828.1|502974_503574_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001566771.1|503566_504793_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	95.3	3.0e-230
WP_064760988.1|504940_506437_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	4.1e-290
WP_001566775.1|506670_507165_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	97.6	1.6e-86
WP_001566776.1|507290_507641_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_071593474.1|507712_508057_-	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	47.3	2.7e-27
WP_122992407.1|508467_508674_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	82.4	3.1e-23
WP_110074593.1|508890_509367_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.2e-83
WP_001120503.1|509370_509706_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	5.7e-59
WP_021562676.1|509802_511194_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_021562675.1|511333_511912_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	6.2e-45
WP_110074594.1|511926_512919_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	80.3	2.5e-155
WP_001405664.1|512920_513199_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_110074595.1|513265_513517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|513733_513889_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_072130110.1|514147_514366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289994.1|514447_514963_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_001224662.1|515128_515311_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403778.1|515404_515761_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209471.1|515738_516200_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_001266130.1|516196_516493_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|516489_516882_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_042091266.1|516897_517668_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.8	1.8e-87
WP_001309414.1|517701_518244_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020541.1|518155_519196_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|519167_519719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|519702_519930_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|520007_520415_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_001345283.1|520604_520757_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_016237926.1|520768_521143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|521675_521864_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|521860_522049_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_110074596.1|522144_524616_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	58.2	2.7e-57
WP_000096344.1|524674_524878_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_110074597.1|524877_525903_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
530863:530878	attR	GCACCAGCGCGGGTAA	NA	NA	NA	NA
>prophage 3
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	633808	641326	5261695		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|633808_634357_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|634361_635240_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|635297_636197_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|636196_637282_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|637653_638547_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|638778_639774_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|639931_641326_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 4
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	688731	748777	5261695	capsid,terminase,holin,portal,lysis,plate,tRNA,head,tail,integrase	Escherichia_phage(41.51%)	62	701656:701671	739412:739427
WP_000675148.1|688731_690135_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|690131_690854_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|691033_691366_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|691513_692875_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
WP_000468308.1|693147_693366_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|693447_694611_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_001565024.1|694610_695090_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_021523174.1|695104_697552_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|697544_697664_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_020233494.1|697696_697972_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251412.1|698028_698547_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233495.1|698559_699750_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_032142943.1|700079_700673_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_021523177.1|700894_701422_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|701423_703445_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
701656:701671	attL	TTGCCAGGAATAACTT	NA	NA	NA	NA
WP_001285325.1|703455_703986_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|703978_704887_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|704891_705239_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|705235_705871_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_021523179.1|705954_706740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|706811_707264_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|707256_707724_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|707686_707860_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001512906.1|707831_708257_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_000736608.1|708244_708670_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|708684_709182_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|709181_709463_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|709466_709670_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|709669_710179_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203455.1|710278_711022_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_020233501.1|711025_712099_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|712157_713012_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156861.1|713185_714958_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_048219351.1|714957_715992_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_023148838.1|716504_717869_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
WP_023148839.1|717977_718928_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
WP_016239054.1|718893_719214_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
WP_023148841.1|719822_722111_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_000027664.1|722100_722376_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_023148842.1|722372_722597_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
WP_001277957.1|722596_722899_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|722898_723123_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|723187_723688_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000022051.1|723865_724222_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|724326_724638_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|724731_725727_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|725758_726556_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918505.1|726765_728196_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109288.1|728405_729554_-	MFS transporter	NA	NA	NA	NA	NA
WP_001522756.1|729868_730495_+	hydrolase	NA	NA	NA	NA	NA
WP_000534633.1|730530_731394_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|731395_732013_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850305.1|732023_734468_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|734706_735999_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|736089_737433_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001522754.1|737443_738055_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001522753.1|738213_742281_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
739412:739427	attR	TTGCCAGGAATAACTT	NA	NA	NA	NA
WP_000228473.1|742415_742910_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522752.1|743454_744420_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043595.1|744542_746309_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522751.1|746309_748031_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001241678.1|748072_748777_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	1933404	2001825	5261695	transposase,protease,tRNA	uncultured_Caudovirales_phage(17.65%)	57	NA	NA
WP_000998019.1|1933404_1934790_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|1935028_1936387_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|1937137_1937395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|1939144_1939666_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068913.1|1939662_1940616_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|1940702_1943027_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|1943071_1943974_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1943970_1944969_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684855.1|1944965_1945922_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000175457.1|1945922_1946690_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1947246_1947504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|1948437_1948740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162543936.1|1948775_1949594_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	9.0e-66
WP_001293436.1|1949747_1951745_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|1951807_1952221_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|1952155_1953323_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|1953636_1953894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|1953946_1954072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|1954114_1955233_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_110074614.1|1955244_1956462_-	MFS transporter	NA	NA	NA	NA	NA
WP_024166525.1|1957070_1958417_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001318460.1|1962974_1963994_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000896738.1|1963997_1964561_-	gluconokinase	NA	NA	NA	NA	NA
WP_001197411.1|1964777_1965809_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000998695.1|1965832_1966597_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128347.1|1966659_1967979_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_001309159.1|1968045_1969044_+	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_021523335.1|1969121_1970624_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001295681.1|1970784_1971867_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|1971866_1972967_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|1973233_1974745_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|1975098_1975542_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416387.1|1975541_1978397_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_016245205.1|1978452_1979649_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059412.1|1979841_1980345_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1980390_1980807_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|1980968_1981973_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000036448.1|1982028_1983624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326836.1|1983746_1984199_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|1984343_1984937_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|1985007_1985721_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|1985851_1986247_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|1986527_1986662_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|1986665_1987601_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|1987613_1988075_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1988147_1988534_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471850.1|1988739_1991436_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_001387276.1|1991576_1991630_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|1991814_1992762_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_110074615.1|1992880_1994302_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_021523332.1|1994351_1996007_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187798.1|1996400_1998539_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001009182.1|1998723_1999188_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_001105433.1|1999188_1999479_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_000212715.1|1999468_1999711_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001232246.1|1999902_2000289_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162173.1|2000472_2001825_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 6
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	2190922	2230429	5261695	capsid,portal,terminase,holin,plate,tRNA,head,tail,integrase,protease	Shigella_phage(45.83%)	53	2181682:2181697	2231763:2231778
2181682:2181697	attL	GCTGATTAACGACACA	NA	NA	NA	NA
WP_110074617.1|2190922_2191960_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_021518084.1|2192048_2193146_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	3.3e-212
WP_001217553.1|2193207_2193456_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_021562679.1|2193951_2196327_-|tail	tail fiber domain-containing protein	tail	O22004	Shigella_phage	71.8	1.1e-47
WP_001566758.1|2196330_2196915_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	4.6e-112
WP_023277896.1|2196905_2197964_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	3.6e-200
WP_000424732.1|2197950_2198376_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|2198375_2198924_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_023277895.1|2198923_2200003_-|tail	phage tail protein	tail	U5P0H6	Shigella_phage	99.7	4.5e-206
WP_162543937.1|2199999_2201328_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	8.4e-247
WP_110074619.1|2201388_2203224_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	1.3e-306
WP_000661047.1|2203365_2203635_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090997.1|2203634_2203991_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_021576722.1|2203990_2205487_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	1.0e-272
WP_000497751.1|2205470_2205641_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779294.1|2205649_2206210_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|2206206_2206713_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_110074620.1|2206687_2207098_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	92.6	6.3e-68
WP_110074621.1|2207094_2207418_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	98.1	5.0e-52
WP_016240455.1|2207496_2208726_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.0	2.2e-225
WP_110074622.1|2208736_2209339_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	2.0e-110
WP_110074623.1|2209331_2210558_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.3	6.4e-241
WP_096859749.1|2210705_2212202_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	1.1e-290
WP_000929181.1|2212435_2212930_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_109104771.1|2213060_2213411_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	81.0	7.1e-52
WP_109104760.1|2213751_2213982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085008125.1|2214122_2214392_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	1.9e-20
WP_109104761.1|2214399_2215014_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	6.5e-93
WP_072161075.1|2215013_2215295_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
WP_094317934.1|2215281_2215668_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	2.0e-60
WP_001569330.1|2215747_2216005_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_001047102.1|2216155_2216908_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	3.1e-137
WP_001061380.1|2217918_2218728_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_032178913.1|2218747_2219137_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	98.4	3.9e-67
WP_110074624.1|2219133_2219787_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.6	2.1e-126
WP_024145951.1|2219881_2220250_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	5.1e-69
WP_001250270.1|2220830_2221043_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000514174.1|2221218_2221803_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_000205494.1|2221840_2222041_-	cell division protein	NA	NA	NA	NA	NA
WP_000450740.1|2222138_2222765_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000196298.1|2223120_2223615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|2224183_2224546_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_110074625.1|2224611_2225436_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	8.6e-149
WP_032296865.1|2225563_2226100_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	99.4	4.8e-100
WP_110074661.1|2226096_2226501_+	hypothetical protein	NA	K7P7C5	Enterobacteria_phage	49.4	8.8e-22
WP_001735527.1|2226497_2226992_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	5.8e-68
WP_110074626.1|2226978_2227536_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	60.9	2.4e-70
WP_001014294.1|2227537_2227729_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_110074627.1|2227731_2228466_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.4	1.6e-138
WP_001061345.1|2228465_2229038_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093914.1|2229074_2229347_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_000900143.1|2229380_2229842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535325.1|2229847_2230429_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
2231763:2231778	attR	GCTGATTAACGACACA	NA	NA	NA	NA
>prophage 7
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	3818824	3825964	5261695		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3818824_3819463_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|3819459_3820722_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|3820718_3821627_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001272546.1|3821792_3822590_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141345.1|3822640_3823297_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|3823402_3825964_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 8
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4447583	4457026	5261695		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569374.1|4447583_4448510_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|4448514_4449246_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4449226_4449334_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|4449393_4450125_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|4450346_4452032_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|4452028_4452748_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4452794_4453265_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4453306_4453768_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|4453892_4455893_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001520842.1|4455889_4457026_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 9
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4468465	4566720	5261695	capsid,terminase,portal,holin,lysis,plate,tRNA,head,tail,integrase	Escherichia_phage(39.22%)	96	4450039:4450056	4574586:4574603
4450039:4450056	attL	CAATCCGTAACGCCTCTG	NA	NA	NA	NA
WP_001520834.1|4468465_4470499_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|4470630_4471740_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001328276.1|4472002_4472284_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|4472579_4473122_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677340.1|4473202_4473877_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001520833.1|4473892_4476373_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000702203.1|4476388_4477423_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|4477504_4477843_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|4478061_4478886_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|4479006_4479279_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195594.1|4479501_4480290_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|4480286_4481087_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|4481151_4481970_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|4482021_4482768_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|4482741_4483707_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|4483703_4484708_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|4484704_4485982_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|4486238_4487291_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|4487520_4488375_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182900.1|4489670_4490123_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|4490153_4490438_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|4490441_4491797_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|4491844_4492885_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|4492984_4493764_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|4493845_4494745_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|4495159_4495477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|4495753_4496767_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001306384.1|4496882_4497182_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4497296_4497572_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217662.1|4497749_4498250_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_000557701.1|4498313_4498538_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_020233503.1|4498537_4498840_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	98.0	1.5e-45
WP_001113264.1|4498839_4499064_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|4499060_4499336_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_016235238.1|4499325_4501611_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_015979593.1|4501607_4501937_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	98.7	5.1e-36
WP_015979594.1|4501975_4502737_-	hypothetical protein	NA	P79670	Escherichia_phage	100.0	3.2e-142
WP_015979595.1|4502911_4504672_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001533791.1|4505054_4506089_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_000156847.1|4506088_4507861_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085952.1|4508034_4508889_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_020233501.1|4508947_4510021_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_000203455.1|4510024_4510768_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_000988636.1|4510867_4511377_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|4511376_4511580_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|4511583_4511865_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4511864_4512362_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|4512376_4512802_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|4512789_4513215_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|4513186_4513360_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|4513322_4513790_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_048237882.1|4513782_4514235_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_023148831.1|4514337_4515411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176299.1|4515497_4516127_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
WP_000127163.1|4516123_4516471_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|4516475_4517384_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_023148828.1|4517376_4517907_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	3.9e-102
WP_023148827.1|4517917_4519942_+|tail	phage tail fiber repeat-containing domain protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
WP_023148826.1|4519943_4520471_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_023148825.1|4520761_4521988_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
WP_020233495.1|4522274_4523465_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|4523477_4523996_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|4524052_4524328_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4524360_4524480_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|4524472_4526920_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|4526934_4527414_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|4527413_4528577_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|4528659_4528878_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292809.1|4529197_4531480_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|4531534_4532392_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001328457.1|4532797_4534558_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|4534687_4535380_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|4535578_4536667_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_001522761.1|4536737_4538021_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001313710.1|4538190_4538955_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001522762.1|4539127_4539811_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|4539921_4541595_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|4541754_4542039_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_021523053.1|4542245_4544510_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4544546_4546295_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570527.1|4546291_4547278_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001522765.1|4547314_4548547_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|4548598_4548781_+	protein YcaR	NA	NA	NA	NA	NA
WP_021523054.1|4548777_4549524_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|4549677_4550571_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_001522767.1|4550547_4551327_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|4551462_4552248_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|4552244_4553567_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|4553547_4554252_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_021523055.1|4554251_4558712_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020232980.1|4558972_4560820_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|4561000_4561549_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|4561575_4562223_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|4562273_4563464_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977905.1|4563648_4564722_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000117881.1|4565319_4566720_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
4574586:4574603	attR	CAATCCGTAACGCCTCTG	NA	NA	NA	NA
>prophage 10
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4738549	4813343	5261695	capsid,terminase,holin,lysis,tRNA,head,tail,integrase,transposase	Enterobacteria_phage(38.0%)	86	4738402:4738461	4812737:4813454
4738402:4738461	attL	TTTTTGTGCACAGAAAACCCCCAGCTAGGCTGGGGGTTCCGGAAAGCTTTCAGCTTTAAG	NA	NA	NA	NA
WP_000526135.1|4738549_4739008_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001300895.1|4739129_4740092_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_024166502.1|4740235_4743682_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|4743809_4744883_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|4745143_4746343_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|4746335_4747037_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|4747036_4748281_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|4748309_4749221_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4749236_4750058_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|4750194_4750980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|4750976_4751438_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|4751495_4752542_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|4752538_4753333_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|4753499_4754618_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4754586_4754856_-	excisionase	NA	NA	NA	NA	NA
WP_000048273.1|4754917_4757389_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001365098.1|4757482_4757674_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|4757670_4757859_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|4758259_4758463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4758427_4758646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|4758738_4758939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362153.1|4759343_4759763_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4759863_4760145_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|4760128_4760554_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|4760576_4761539_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001468623.1|4761579_4762002_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000761441.1|4762002_4762416_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|4762509_4762692_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_011076332.1|4763305_4763524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|4763726_4763939_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|4764106_4764385_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|4764386_4765445_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|4765445_4765826_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|4765822_4766644_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|4767038_4767125_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|4767613_4767826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|4767896_4768232_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|4768492_4768681_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|4768677_4768839_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000284506.1|4768988_4769204_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|4769208_4770099_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|4770135_4770669_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|4770825_4771008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|4771022_4771154_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|4771156_4771624_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|4771934_4772261_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|4772383_4772737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|4773219_4773729_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|4773700_4775629_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|4775612_4775819_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001253888.1|4777396_4778902_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|4778938_4779286_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|4779343_4780372_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|4780423_4780798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096940914.1|4780790_4781144_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975005.1|4781159_4781735_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|4781731_4782127_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|4782134_4782887_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|4782900_4783332_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|4783358_4783772_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|4783752_4786314_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|4786310_4786640_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|4786639_4787338_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|4787348_4788092_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|4788037_4788670_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514726.1|4789013_4792706_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_001233148.1|4792773_4793373_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|4793524_4796551_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|4796550_4797135_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|4797189_4797858_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|4797914_4798181_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|4798412_4799276_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4799259_4800396_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|4800645_4801872_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4801920_4803042_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4803117_4804578_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4804577_4805249_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4805418_4806789_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4806792_4807434_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|4807469_4808576_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001522894.1|4808629_4809091_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|4809100_4809739_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|4810071_4810407_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|4810406_4810856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|4811438_4812689_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|4812884_4813343_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
4812737:4813454	attR	TTTTTGTGCACAGAAAACCCCCAGCTAGGCTGGGGGTTCCGGAAAGCTTTCAGCTTTAAGCCAGTTATTAAAACCCCTTTTGATTTGTTAAAACACCTTGCGGTCTGGCAACTGCAAGTGTCAAACAAGAAATCAAAAGGGGGTCCCAATGGGGAACGAAAAGAGCTTAGCGCACACCCGATGGAACTGTAAATATCACATAGTTTTTGCGCCAAAATACCGAAGACAGGTGTTCTACAGAGAGAAGCGTAGAGCAATAGGCAGTATTTTGAGAAAGCTGTGTGAGTGGAAAAGTGTACGGATTCTGGAAGCTGAATGCTGTGCAGATCATATCCATATGCTTGTGGAGATCCCGCCCAAAATGAGCGTATCCGGCTTTATGGGATATCTGAAAGGGAAAAGCAGTCTGATGCTTTACGAGCAGTTTGGTGATTTGAAATTCAAATACAGGAACAGGGAGTTCTGGTGCAGAGGGTACTACGTCGATACGGTGGGTAAGAACACGGCGAAGATACAGGATTACATAAAGCACCAGCTTGAAGAGGATAAAATGGGAGAGCAGTTATCGATTCCCTATCCGGGCAGCCCGTTTACGGGCCGTAAGTAACGAAGTTGGATGCAAATGTCAGATCGTGTGCGCCTGTTAGGGCGCGGCTGGTAAGAGAGCCTTATAGGCGCATTTGAAAAACCTCCGGCTATGCCGGAGGATATTTATTTT	NA	NA	NA	NA
>prophage 11
NZ_CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	5032062	5083947	5261695	terminase,holin,lysis,tRNA,tail,integrase	Escherichia_phage(53.19%)	58	5022958:5022973	5065942:5065957
5022958:5022973	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_100190652.1|5032062_5033010_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
WP_000387388.1|5034326_5035310_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|5035787_5037161_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|5037289_5038225_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|5038276_5039512_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|5039513_5039729_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|5039828_5040017_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|5040054_5040204_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|5040259_5041069_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_110074659.1|5041061_5043662_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.9e-248
WP_001344816.1|5043763_5044039_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|5044113_5044284_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|5044283_5044505_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|5044946_5045435_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|5045431_5045587_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233319.1|5046019_5046439_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|5046518_5046773_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|5046769_5047192_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|5047269_5048058_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|5048064_5048811_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|5048833_5049595_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|5049610_5050033_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|5050194_5050698_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|5050818_5051592_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|5052114_5052240_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|5052322_5052664_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|5053531_5054131_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|5054130_5054421_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|5054417_5054960_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|5055181_5055751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|5055719_5056022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|5056098_5056440_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|5056443_5056920_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|5057136_5057322_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|5057518_5058976_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|5059113_5059905_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|5059897_5060830_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000126788.1|5060807_5061017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|5061020_5062115_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|5062095_5063397_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|5063399_5064806_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|5064789_5065902_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|5066006_5066771_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
5065942:5065957	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_020233804.1|5066869_5068009_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000634214.1|5068231_5068627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|5068626_5069010_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|5069010_5069391_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|5069387_5069780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|5069806_5070769_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|5070919_5071279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|5071386_5071587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|5071750_5074984_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|5074976_5075315_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|5075314_5076013_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|5076018_5076762_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_021523093.1|5077360_5080840_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|5080907_5081507_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_042099016.1|5081571_5083947_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
>prophage 1
NZ_CP029580	Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence	178078	2169	72015	178078	integrase,transposase	Escherichia_phage(42.86%)	56	35982:36001	72146:72165
WP_000608644.1|2169_3432_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_014342101.1|3579_3702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|3681_4557_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_013362812.1|4591_5560_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067845.1|7310_8015_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001067845.1|8144_8849_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001067858.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_110074664.1|9969_10503_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
WP_000951934.1|10984_11176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|11199_11427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|11477_12614_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|12580_12730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|14056_14761_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001104873.1|14814_15036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|15036_15720_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|16104_17007_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|17873_18845_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|18844_20011_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|20598_21354_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|22073_22880_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|22880_23186_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|23187_23406_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|24113_25109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|25112_26045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553854.1|27092_30209_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|30330_31614_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|31610_33167_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|33349_33571_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|33570_33951_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|33955_34135_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|34162_34522_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|34808_35126_-	hypothetical protein	NA	NA	NA	NA	NA
35982:36001	attL	TAGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_012372828.1|36130_37147_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|37354_38758_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|38744_39677_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000361610.1|43019_43997_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|44281_45022_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_042347974.1|45142_45322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|45688_46858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|47704_47977_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|49219_51190_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|51196_51988_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|52726_53506_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|53505_54528_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|55607_55955_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|55951_56356_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|56857_58366_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001020413.1|60631_61807_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|61875_64137_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|64305_65082_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|65089_65965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|68415_68751_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|68879_69227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|69246_69756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|69752_70013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|71526_72015_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
72146:72165	attR	GCTTATTCGCACCTTCCCTA	NA	NA	NA	NA
>prophage 2
NZ_CP029580	Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence	178078	84189	132342	178078	protease,transposase	Escherichia_phage(58.33%)	47	NA	NA
WP_001067858.1|84189_84894_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|85859_86333_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|86463_87252_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|87457_87805_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|87798_88638_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|88765_88969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|89124_90330_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|90340_90646_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|90872_91637_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|92129_92714_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|92713_93952_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|93948_94854_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|94975_95680_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362819.1|95814_95910_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_013362818.1|96035_96773_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_162543939.1|97402_97828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|97874_98579_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|99541_100402_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|100414_100957_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|101166_101871_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063628527.1|101995_103528_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|104157_104862_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|105160_106021_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001262765.1|106297_107608_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|107892_108294_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|108226_108484_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|108576_109230_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001617855.1|110169_111027_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|111019_111094_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|111330_111585_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|111881_112016_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_013023861.1|112886_113099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|113229_113790_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|113844_114591_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_001617867.1|114610_119881_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_086908463.1|119880_122115_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000199914.1|122111_122891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000850429.1|123093_123825_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000605862.1|123856_124354_-	entry exclusion protein	NA	NA	NA	NA	NA
WP_001007062.1|124372_127192_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000944328.1|127188_128562_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001348758.1|128548_128974_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071571857.1|128921_129269_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059829.1|129198_129744_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001617873.1|129730_130015_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001348757.1|130141_130462_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000019450.1|131361_132342_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
