The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	71403	108913	8998893	transposase,tRNA	Cyanophage(33.33%)	29	NA	NA
WP_010036248.1|71403_72399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010036250.1|72402_74430_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010036252.1|74461_74983_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	51.0	4.4e-34
WP_029600725.1|75175_77266_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_010036257.1|77802_79215_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_033197929.1|79315_79915_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_109570712.1|80072_81200_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010036261.1|81313_81907_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_148088013.1|85005_87591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036264.1|87776_88091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036265.1|88260_89700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036266.1|89876_90281_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_010036270.1|90329_91337_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036271.1|91395_91734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033197923.1|91895_92954_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_010036275.1|92965_93892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036276.1|94044_96051_+	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	26.5	5.0e-09
WP_109570713.1|96057_96438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036279.1|96515_97556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087965.1|97560_97770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036282.1|98052_98649_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_010036284.1|98712_99084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036291.1|99134_99614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087964.1|100470_101526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036299.1|101559_101970_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_010034542.1|102976_104308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010052097.1|105152_105929_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_109570714.1|106621_107656_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|107755_108913_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	1087495	1137324	8998893	transposase	Only_Syngen_Nebraska_virus(16.67%)	34	NA	NA
WP_010046807.1|1087495_1088899_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_010046813.1|1089251_1089581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570801.1|1089657_1090716_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010045508.1|1090712_1091039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010045510.1|1090971_1092090_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010045512.1|1092224_1093859_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.0	1.5e-144
WP_081471554.1|1093945_1094314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037269.1|1094310_1095381_+|transposase	ISKra4-like element ISGob7 family transposase	transposase	NA	NA	NA	NA
WP_010045515.1|1095522_1096206_-	ATPase	NA	NA	NA	NA	NA
WP_010045517.1|1096202_1097150_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_063744622.1|1097161_1097659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045527.1|1098047_1098809_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010045529.1|1098888_1099611_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	1.3e-31
WP_010045531.1|1099603_1100773_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033199147.1|1100815_1101448_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010045535.1|1101597_1102434_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010045537.1|1103222_1103495_-	putative acyl carrier protein	NA	NA	NA	NA	NA
WP_010045541.1|1103494_1106881_-	polyketide synthase dehydratase domain-containing protein	NA	NA	NA	NA	NA
WP_109570802.1|1107218_1115000_-	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	24.7	6.5e-20
WP_109570803.1|1115340_1116426_+	S49 family peptidase	NA	NA	NA	NA	NA
WP_010050009.1|1116943_1120447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050011.1|1120594_1121752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050013.1|1121867_1122722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010049960.1|1122902_1124303_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010049962.1|1125338_1127249_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.7	9.2e-45
WP_010049964.1|1127352_1129023_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	7.8e-32
WP_148087905.1|1129261_1129618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041928.1|1129593_1129869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041931.1|1129927_1130629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041933.1|1130738_1130930_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_010041934.1|1131289_1131823_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_010041939.1|1133694_1135707_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.4	3.9e-09
WP_029600978.1|1135771_1136131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033997.1|1136328_1137324_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	1620875	1681720	8998893	transposase,tRNA	Anatid_alphaherpesvirus(33.33%)	41	NA	NA
WP_010034807.1|1620875_1622042_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_157506535.1|1622083_1622911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034810.1|1623071_1624097_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_029600672.1|1624257_1625139_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010034814.1|1625314_1627705_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_010034815.1|1628234_1629338_+	DUF444 family protein	NA	NA	NA	NA	NA
WP_010034816.1|1629358_1629706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034817.1|1629708_1630002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034818.1|1630008_1632414_+	transporter substrate-binding protein	NA	A0A0U1YWE1	Anatid_alphaherpesvirus	24.8	2.4e-05
WP_010034821.1|1632473_1634036_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_010034823.1|1633998_1634475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034826.1|1634664_1635447_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010034829.1|1635716_1639247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034832.1|1639318_1641226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034836.1|1641421_1641697_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_010033957.1|1641837_1642983_-|transposase	ISAs1-like element ISGob5 family transposase	transposase	NA	NA	NA	NA
WP_081471440.1|1643117_1643888_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010034845.1|1643914_1645630_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_157506538.1|1645530_1646103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034856.1|1646459_1647467_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_109570859.1|1649057_1650398_-	DUF4130 domain-containing protein	NA	NA	NA	NA	NA
WP_010034863.1|1650394_1651618_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_010034864.1|1652218_1652716_+	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
WP_010034870.1|1654083_1654692_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_010034876.1|1655865_1656447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034877.1|1656494_1656959_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010034879.1|1656985_1657273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034883.1|1657327_1658527_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_010034888.1|1658577_1660722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034892.1|1660735_1661098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034896.1|1663079_1664957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034899.1|1664983_1667572_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_010034901.1|1667840_1668503_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034902.1|1668517_1670629_+	serine/threonine protein kinase	NA	B5LWE2	Feldmannia_species_virus	25.4	3.4e-16
WP_148087881.1|1670661_1671297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033197819.1|1671372_1672377_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010034904.1|1673001_1674336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506541.1|1675477_1677358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|1677506_1678635_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010034914.1|1678736_1679108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570861.1|1680421_1681720_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	1952799	1972369	8998893	transposase	Paenibacillus_phage(25.0%)	16	NA	NA
WP_010045396.1|1952799_1953195_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.2	1.7e-17
WP_010045398.1|1953191_1953509_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081471823.1|1953557_1953668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010045400.1|1954034_1954646_+	DNA polymerase I (PolI)	NA	NA	NA	NA	NA
WP_010045402.1|1954715_1955345_+	hypothetical protein	NA	U3RH22	uncultured_virus	48.5	1.1e-18
WP_010045406.1|1955584_1955989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010045411.1|1956285_1957203_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	33.3	9.3e-11
WP_010033207.1|1957251_1958409_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010045413.1|1958494_1959571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045415.1|1959623_1960001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029601129.1|1960254_1960812_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010045419.1|1960911_1964175_+	protein kinase	NA	S4VV57	Pandoravirus	30.0	3.4e-15
WP_109570880.1|1964377_1969810_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_029600602.1|1969794_1969977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050790194.1|1970118_1970835_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_029600604.1|1970926_1972369_+|transposase	IS66-like element ISGob4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2014487	2046354	8998893	transposase,integrase,tail	Burkholderia_virus(33.33%)	29	2019751:2019767	2040000:2040016
WP_010033172.1|2014487_2015162_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_010033173.1|2015207_2019833_+	hypothetical protein	NA	NA	NA	NA	NA
2019751:2019767	attL	CGGGCGAGGCGAAGAAA	NA	NA	NA	NA
WP_148087868.1|2019948_2020680_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_010033176.1|2020729_2021413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600608.1|2021602_2023504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033185.1|2023714_2024164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033189.1|2024549_2025737_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010033191.1|2025726_2025978_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010033192.1|2026008_2026200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033193.1|2026279_2026609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033194.1|2026754_2027120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033195.1|2027116_2027395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033199.1|2027543_2027951_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_010033201.1|2027983_2028160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033204.1|2028200_2028374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033205.1|2028427_2028604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033207.1|2028703_2029861_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087867.1|2030000_2030264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033213.1|2030278_2032066_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_029600604.1|2032238_2033681_+|transposase	IS66-like element ISGob4 family transposase	transposase	NA	NA	NA	NA
WP_010033217.1|2033938_2034127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157506491.1|2034182_2035022_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_010033223.1|2035355_2035832_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_148087866.1|2036351_2036954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033231.1|2037041_2037680_+	class I SAM-dependent methyltransferase	NA	Q6V7L9	Burkholderia_virus	39.6	1.9e-18
WP_010033207.1|2037743_2038901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570886.1|2038870_2043070_+	DEAD/DEAH box helicase family protein	NA	I3PUW5	Vibrio_phage	38.8	6.0e-246
2040000:2040016	attR	CGGGCGAGGCGAAGAAA	NA	NA	NA	NA
WP_010033242.1|2044403_2045096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|2045226_2046354_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
>prophage 7
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2105395	2136779	8998893	transposase	Bacillus_phage(40.0%)	33	NA	NA
WP_033197688.1|2105395_2106859_-|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_071529218.1|2106889_2109622_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_010033472.1|2109611_2110028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033474.1|2110066_2112976_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0S925	Catovirus	34.6	5.6e-09
WP_010033476.1|2113432_2113714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033477.1|2113721_2114783_-	RNA ligase (ATP)	NA	A0A0F6WCT9	Sinorhizobium_phage	39.1	2.5e-55
WP_148087859.1|2114848_2115070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087858.1|2115066_2115597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033481.1|2115663_2116059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087857.1|2116078_2116441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033485.1|2116437_2116731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087856.1|2116727_2117036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033491.1|2117440_2117872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033494.1|2118121_2119279_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570712.1|2119872_2121000_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010033500.1|2121470_2121689_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109571472.1|2121897_2122506_+	hypothetical protein	NA	A0A2P1A2Z7	Mycobacterium_phage	25.9	2.2e-08
WP_010033504.1|2122557_2123037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|2123091_2124220_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010033516.1|2124280_2125006_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_010033518.1|2125002_2126358_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_010033520.1|2126359_2127304_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_010033522.1|2127320_2127959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033524.1|2127984_2128788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033531.1|2128851_2129313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033532.1|2129392_2130091_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010033536.1|2130094_2132224_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010033537.1|2132260_2132680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033539.1|2132906_2134007_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_168217240.1|2134109_2134904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071529220.1|2134869_2135475_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_010033545.1|2135643_2136114_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010033548.1|2136083_2136779_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2176303	2241523	8998893	transposase,integrase	Stx2-converting_phage(16.67%)	44	2181399:2181417	2204595:2204613
WP_010037307.1|2176303_2176966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037308.1|2176978_2177602_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_109570892.1|2177648_2178503_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	44.5	5.1e-19
WP_010037314.1|2178779_2179877_-	LicD family protein	NA	A0A1V0SAS8	Catovirus	29.1	7.2e-10
WP_010037318.1|2179962_2180892_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SLZ7	Klosneuvirus	31.3	2.1e-10
WP_010037320.1|2181189_2181489_+	hypothetical protein	NA	NA	NA	NA	NA
2181399:2181417	attL	CGCACGGGCCGACGAACTG	NA	NA	NA	NA
WP_010037323.1|2181481_2182048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037325.1|2182506_2182935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037327.1|2182931_2185832_-	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_010037329.1|2185919_2186297_-	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_010037332.1|2186394_2188407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037336.1|2188720_2190025_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010037339.1|2190451_2190688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037342.1|2190765_2194479_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010037344.1|2195988_2196969_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148087854.1|2197439_2199404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037350.1|2199619_2200693_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_010037351.1|2200707_2201286_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_109571475.1|2201358_2202960_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_050790239.1|2204351_2205221_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
2204595:2204613	attR	CAGTTCGTCGGCCCGTGCG	NA	NA	NA	NA
WP_010042184.1|2205573_2207370_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_081471709.1|2207446_2207851_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_010042186.1|2207907_2208426_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010042187.1|2208539_2208878_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010042188.1|2209088_2210141_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010042189.1|2210305_2211061_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010042192.1|2211094_2212786_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	25.9	1.7e-29
WP_010042194.1|2213035_2216110_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_010042196.1|2216294_2217692_+	Na+ dependent nucleoside transporter domain protein	NA	NA	NA	NA	NA
WP_010042198.1|2217718_2218804_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_010042200.1|2218954_2220244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042202.1|2220348_2221740_-	serine/threonine protein kinase	NA	M1HXV5	Paramecium_bursaria_Chlorella_virus	23.3	9.5e-07
WP_010042205.1|2222588_2225180_+	response regulator	NA	NA	NA	NA	NA
WP_010042209.1|2225407_2227300_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_029600993.1|2227469_2228378_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_010052708.1|2228681_2229704_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_162542134.1|2229858_2232783_+	protein kinase	NA	A0A160EPW9	Powai_lake_megavirus	26.7	2.8e-16
WP_010041060.1|2232850_2233342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041062.1|2233724_2234222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041065.1|2234423_2235788_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_109570894.1|2236451_2237369_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_010033685.1|2239405_2240128_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|2240108_2240552_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_168217264.1|2240584_2241523_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2284939	2335842	8998893	protease,transposase,tRNA	Staphylococcus_phage(16.67%)	40	NA	NA
WP_081471615.1|2284939_2285194_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039467.1|2285704_2286340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033685.1|2286513_2287236_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570897.1|2287216_2287660_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039472.1|2287713_2288763_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010039474.1|2288988_2290476_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	8.6e-14
WP_010033207.1|2290588_2291746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162542136.1|2291762_2292767_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010041392.1|2292776_2295143_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	31.4	1.3e-16
WP_010041390.1|2295244_2298754_+	caspase family protein	NA	NA	NA	NA	NA
WP_010041389.1|2298772_2300293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600955.1|2300416_2301838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041385.1|2302763_2303906_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_033198482.1|2303996_2304680_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_010041382.1|2304910_2305063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041381.1|2305197_2306025_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_010041379.1|2306086_2307277_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_029600953.1|2307667_2309035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041377.1|2309065_2310451_-	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010041376.1|2310744_2312190_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_168217263.1|2312344_2312677_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010041373.1|2312688_2313405_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010041370.1|2313456_2313963_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_010041369.1|2313966_2314434_+	YraN family protein	NA	NA	NA	NA	NA
WP_010041367.1|2314561_2315776_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010041365.1|2315806_2317207_-	amidohydrolase	NA	NA	NA	NA	NA
WP_109570900.1|2317344_2317539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570901.1|2317638_2318406_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.9e-12
WP_010047694.1|2318402_2319398_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010047696.1|2319653_2319869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047698.1|2319969_2320875_+	tyrosine recombinase XerC	NA	A0A1I9SC88	Mycobacterium_phage	31.8	9.2e-19
WP_010047700.1|2321004_2322165_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010047702.1|2322508_2324320_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.9	4.5e-41
WP_010047703.1|2324408_2325182_+	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010047705.1|2325290_2327465_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_071529272.1|2328243_2328864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162097354.1|2328794_2329379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038805.1|2331037_2332714_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010038808.1|2332823_2333405_-	response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.3e-10
WP_010038811.1|2334006_2335842_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2347744	2382173	8998893	protease,transposase	Pandoravirus(33.33%)	34	NA	NA
WP_010038826.1|2347744_2348278_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038827.1|2348303_2348453_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010038828.1|2348590_2348791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038831.1|2349375_2349621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038832.1|2349708_2350533_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010038836.1|2350555_2351383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038837.1|2351578_2351857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038845.1|2352285_2353263_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010038846.1|2353367_2353817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038849.1|2355834_2356296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038854.1|2356838_2357474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038855.1|2357605_2358202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038860.1|2358758_2359115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038863.1|2359226_2359655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038865.1|2359760_2360123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571476.1|2360215_2360560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038871.1|2360609_2360873_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038874.1|2360885_2361119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162542137.1|2361182_2361686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010038877.1|2361728_2362460_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_010038878.1|2362860_2364036_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_010038879.1|2364074_2364686_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_109570904.1|2364768_2366928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049699.1|2367205_2370091_+	serine/threonine protein kinase	NA	A0A0B5J6A8	Pandoravirus	31.1	1.0e-18
WP_010049698.1|2370199_2371078_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029601278.1|2371088_2371844_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	9.7e-06
WP_010051666.1|2372384_2373146_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010051663.1|2373264_2374137_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.2	5.5e-45
WP_010051660.1|2374287_2375709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029601164.1|2376231_2376918_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010046506.1|2377071_2378349_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_010046509.1|2378700_2380512_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_010035860.1|2381026_2381749_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|2381729_2382173_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2695232	2774221	8998893	transposase,tRNA	Leptospira_phage(14.29%)	56	NA	NA
WP_157506574.1|2695232_2696450_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010048765.1|2696852_2699180_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010053367.1|2699612_2700311_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010044089.1|2701028_2704313_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.0	6.6e-59
WP_010044087.1|2704450_2705875_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010044084.1|2705967_2707110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044082.1|2707205_2707595_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_010044080.1|2707709_2709104_+	threonine synthase	NA	NA	NA	NA	NA
WP_010044078.1|2709156_2709837_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010044075.1|2709893_2710685_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_010044073.1|2710756_2711656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044071.1|2712244_2714380_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010044069.1|2714431_2717473_+	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.2	1.0e-08
WP_010044067.1|2717829_2718261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044063.1|2718446_2720069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048418.1|2720260_2721619_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_071529346.1|2721623_2722313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048416.1|2722599_2722929_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_010048414.1|2722981_2723521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048411.1|2723563_2724403_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_010048410.1|2724519_2725833_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_010048409.1|2726015_2728946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010053624.1|2729444_2729984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010053352.1|2730300_2731116_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010042445.1|2731919_2732939_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010042444.1|2732983_2734501_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_010042442.1|2734510_2734879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042440.1|2734891_2735254_-	DsrE family protein	NA	NA	NA	NA	NA
WP_010042438.1|2735255_2735477_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010042433.1|2735903_2737475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042431.1|2737582_2738581_+	N-acetylmuramidase family protein	NA	D6QWN9	uncultured_phage	35.7	1.7e-18
WP_010042430.1|2738739_2739036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571482.1|2739205_2739901_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010042426.1|2739945_2740752_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	33.8	5.9e-09
WP_162097345.1|2742429_2743863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042417.1|2744772_2745180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042414.1|2745632_2745926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168217239.1|2746249_2747017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042408.1|2747255_2747528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042399.1|2749117_2750431_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	44.1	1.3e-82
WP_010042397.1|2750449_2751079_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033198625.1|2751155_2751977_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|2753541_2754699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010048686.1|2754995_2756264_-	lactonase family protein	NA	NA	NA	NA	NA
WP_010048684.1|2756302_2757277_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010048682.1|2757446_2758688_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_010048679.1|2759646_2762412_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	52.5	1.9e-264
WP_162542141.1|2762456_2764217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087733.1|2764418_2764805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570921.1|2764830_2766072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044632.1|2766737_2768042_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_010044635.1|2768160_2768490_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_010044637.1|2768486_2769296_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_010044639.1|2769631_2771215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|2771348_2772477_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010044642.1|2772817_2774221_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	2861662	2927041	8998893	transposase	Bacillus_phage(33.33%)	55	NA	NA
WP_010033494.1|2861662_2862820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010043196.1|2863259_2863709_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570953.1|2863862_2864471_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_010035430.1|2864549_2864954_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035442.1|2864986_2868853_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	26.6	4.6e-11
WP_010035439.1|2868926_2869148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035436.1|2869144_2869801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035434.1|2869880_2870153_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_010035430.1|2870538_2870943_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085948016.1|2871021_2871351_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_109570955.1|2871684_2872563_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	8.6e-22
WP_010035390.1|2872846_2873671_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010035418.1|2873704_2878825_-	FG-GAP repeat protein	NA	F5B3Z3	Synechococcus_phage	40.4	1.4e-07
WP_010035415.1|2879167_2879485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600695.1|2879839_2881171_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035410.1|2881315_2883121_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_029600694.1|2883153_2883819_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_010035405.1|2884004_2885351_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_029600693.1|2887118_2887982_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010035394.1|2888374_2889325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035390.1|2889556_2890381_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010035388.1|2890442_2891345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035386.1|2891250_2891973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035381.1|2892231_2892759_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035371.1|2895885_2896293_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010035368.1|2896505_2897444_-	response regulator	NA	NA	NA	NA	NA
WP_010035365.1|2897711_2899181_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010035363.1|2899410_2899725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035353.1|2900980_2902138_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010035349.1|2902324_2902495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087825.1|2902505_2902994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035343.1|2903168_2903843_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570957.1|2903730_2904315_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035390.1|2904333_2905158_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010035336.1|2905425_2906430_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_109571485.1|2906593_2907841_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_081471463.1|2907993_2908224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087824.1|2908614_2908884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035327.1|2908972_2910304_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035324.1|2910370_2910544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050790211.1|2912287_2914186_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_010035319.1|2914182_2915367_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_010035317.1|2915545_2915815_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_010035314.1|2915816_2917316_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_010035309.1|2917435_2917786_+	flagellar biosynthesis protein FlgB	NA	NA	NA	NA	NA
WP_050790216.1|2917851_2918238_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010035304.1|2918255_2918567_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_010035303.1|2918638_2920210_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_162097342.1|2920256_2921189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035300.1|2922346_2922826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570958.1|2922812_2924129_+	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_010035296.1|2924335_2924821_+	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_010035293.1|2924995_2925790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162097341.1|2926137_2926347_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010035289.1|2926492_2927041_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	3043051	3197914	8998893	transposase,integrase	Bacillus_phage(11.76%)	117	3170897:3170949	3198008:3198060
WP_157506574.1|3043051_3044269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042027.1|3044606_3046832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042025.1|3047143_3050419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042023.1|3050451_3051198_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	28.2	7.3e-06
WP_010042021.1|3051204_3051984_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010042018.1|3051980_3052943_+	NAD-dependent epimerase/dehydratase family protein	NA	M4QPK0	Synechococcus_phage	30.2	9.4e-30
WP_010042014.1|3053028_3054297_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	29.7	1.1e-41
WP_148087821.1|3054477_3055436_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.0	1.2e-11
WP_010046729.1|3056412_3058653_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010046726.1|3058740_3059208_+	RidA family protein	NA	NA	NA	NA	NA
WP_010046724.1|3059408_3060419_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.6	4.3e-41
WP_010046723.1|3060762_3062277_+	TolC family protein	NA	NA	NA	NA	NA
WP_010046722.1|3062370_3063126_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029601168.1|3063347_3064913_-	MFS transporter	NA	NA	NA	NA	NA
WP_162097390.1|3064909_3066313_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010046719.1|3066672_3067062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010046717.1|3067058_3067472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033199361.1|3067528_3068641_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_109570966.1|3068917_3071584_+	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	6.5e-12
WP_109570967.1|3071777_3072683_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	30.7	4.5e-26
WP_029600824.1|3072962_3074810_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_010038429.1|3074976_3075468_+	SprT-like domain-containing protein	NA	A0A1D8EZB9	Mycobacterium_phage	41.1	2.5e-23
WP_010038426.1|3075568_3076054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038425.1|3076362_3076818_-	response regulator	NA	NA	NA	NA	NA
WP_010038422.1|3077067_3077313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038421.1|3077364_3077799_-	response regulator	NA	NA	NA	NA	NA
WP_010038420.1|3077978_3078452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038419.1|3078501_3079161_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010038418.1|3079153_3081124_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_109571487.1|3081281_3081578_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_010038416.1|3081891_3082125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570968.1|3082261_3083413_-	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	27.1	1.6e-07
WP_148087820.1|3083656_3083884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035390.1|3084294_3085119_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109570969.1|3085459_3088807_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	33.5	4.4e-18
WP_010038411.1|3089023_3090625_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_085948040.1|3090674_3092018_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010038395.1|3092095_3094555_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_010038394.1|3094706_3096638_-	response regulator	NA	W8CYF6	Bacillus_phage	27.0	1.0e-11
WP_085948039.1|3096653_3101420_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010038392.1|3101606_3102884_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010038389.1|3103488_3105384_+	aspartate kinase	NA	NA	NA	NA	NA
WP_010038387.1|3105530_3106925_-	serine/threonine protein kinase	NA	S4VR00	Pandoravirus	32.7	1.9e-23
WP_109570970.1|3107254_3110836_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_010039849.1|3110907_3111507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542144.1|3111468_3112254_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_010039847.1|3112286_3112457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039844.1|3112458_3113877_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_010039842.1|3114415_3117118_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_109570972.1|3117203_3118646_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010039839.1|3118713_3119247_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010039830.1|3119389_3119944_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_010039823.1|3119927_3120551_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_109570973.1|3120531_3121905_+	DUF4147 domain-containing protein	NA	NA	NA	NA	NA
WP_010039819.1|3122481_3123924_-|transposase	IS66-like element ISGob1 family transposase	transposase	NA	NA	NA	NA
WP_010039815.1|3123937_3124552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010039814.1|3124700_3125618_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_010039812.1|3125668_3126052_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039810.1|3126095_3126455_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087819.1|3126858_3127809_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	26.9	1.7e-07
WP_010039806.1|3127861_3128821_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010039803.1|3129072_3129882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471624.1|3131715_3132252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039798.1|3133221_3133572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600880.1|3133689_3135087_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_162542145.1|3135432_3136368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029600879.1|3136948_3137563_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162542147.1|3138344_3140957_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010040595.1|3141022_3142039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570977.1|3142125_3144393_-	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	33.3	8.7e-18
WP_010040590.1|3144499_3145129_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_109570978.1|3145217_3148070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040584.1|3148562_3149132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040582.1|3149103_3149523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040578.1|3151193_3152240_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_010040574.1|3152243_3153104_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010040572.1|3153140_3153992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040570.1|3153988_3154942_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_148087817.1|3154941_3155988_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010040566.1|3156077_3156794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570979.1|3156911_3160712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040554.1|3160815_3162288_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010040551.1|3162287_3163817_-	integral membrane sensor signal transduction histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	25.5	5.5e-08
WP_010040549.1|3164493_3165015_+	dehydrogenase	NA	NA	NA	NA	NA
WP_010040548.1|3165027_3167739_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_010040545.1|3167728_3168688_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_010040542.1|3168692_3169556_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
3170897:3170949	attL	CGACTCAAAATCGAGCGGGGCAACCTGTGTGGGTTCGAGTCCCACCTTGGCCA	NA	NA	NA	NA
WP_010051116.1|3171096_3171750_-	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010051105.1|3171804_3172296_-	HNH endonuclease	NA	A0A0E3T8A7	Gordonia_phage	43.4	7.4e-15
WP_148087816.1|3172896_3173805_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_148087815.1|3174274_3174835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052245.1|3175213_3176962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052244.1|3176991_3177210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052241.1|3177520_3177748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570981.1|3179227_3179848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087814.1|3180071_3180644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043832.1|3180653_3181202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043829.1|3181204_3181504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035860.1|3181846_3182569_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|3182549_3182993_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010043823.1|3183823_3185092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043821.1|3185166_3185844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043819.1|3185847_3186453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570982.1|3186556_3186763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043815.1|3186979_3187558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043812.1|3187569_3187932_+	TIGR03066 family protein	NA	NA	NA	NA	NA
WP_157506845.1|3188166_3188415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029601058.1|3188517_3188772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043805.1|3189964_3190330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087813.1|3190568_3190958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043801.1|3191011_3191569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570984.1|3191720_3193274_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	29.7	2.0e-37
WP_148087812.1|3193551_3194217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043794.1|3194319_3194703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570985.1|3195015_3195627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087811.1|3196082_3196763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043789.1|3196876_3197914_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3198008:3198060	attR	CGACTCAAAATCGAGCGGGGCAACCTGTGTGGGTTCGAGTCCCACCTTGGCCA	NA	NA	NA	NA
>prophage 14
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	3966248	3979691	8998893	transposase	Acinetobacter_phage(50.0%)	8	NA	NA
WP_085948050.1|3966248_3967416_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.1	6.0e-55
WP_010039875.1|3967491_3968595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571048.1|3968656_3969328_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039874.1|3969340_3970012_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109571049.1|3973014_3974244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039866.1|3974654_3974885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571050.1|3975825_3978048_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.3	1.6e-69
WP_033197688.1|3978227_3979691_+|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	4014235	4025794	8998893	transposase	Shigella_phage(100.0%)	15	NA	NA
WP_010038927.1|4014235_4014682_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010038926.1|4014688_4014973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038923.1|4015437_4016337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038920.1|4016401_4016698_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010038918.1|4016745_4017378_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.4	4.0e-29
WP_010038916.1|4017385_4017574_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|4018429_4019587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571053.1|4019589_4020033_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010038908.1|4020013_4020736_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157506670.1|4020848_4021196_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_162097345.1|4021304_4022738_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038903.1|4022787_4023045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570957.1|4022932_4023517_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010038832.1|4023535_4024360_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109571055.1|4024411_4025794_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	4061677	4097384	8998893	transposase	Shigella_phage(66.67%)	36	NA	NA
WP_010033207.1|4061677_4062835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162097345.1|4063977_4065411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042124.1|4065725_4065902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571058.1|4065910_4067032_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010042120.1|4066931_4068104_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_010042118.1|4068197_4068578_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_010042116.1|4068665_4069700_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_010042113.1|4069743_4071426_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_010042111.1|4071894_4072233_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_010042108.1|4072310_4072664_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010042101.1|4072647_4073544_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_010042099.1|4073902_4074364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042093.1|4074649_4075096_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010042091.1|4075097_4075796_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010042089.1|4076291_4076720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087764.1|4076750_4076843_+	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010042085.1|4077206_4077593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042083.1|4077589_4077802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570712.1|4077893_4079022_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010042080.1|4079602_4080157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471705.1|4080099_4080567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471704.1|4080573_4080762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542156.1|4080947_4081088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042070.1|4081812_4082769_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_157506772.1|4085349_4085961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_050790288.1|4085988_4086291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042066.1|4086322_4087150_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	6.2e-46
WP_010038920.1|4087197_4087494_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_029600695.1|4088821_4090153_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033207.1|4090360_4091518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571062.1|4092299_4093427_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.6	7.7e-23
WP_010049053.1|4094288_4094780_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010049050.1|4094970_4095378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038920.1|4095442_4095739_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010042066.1|4095786_4096614_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	6.2e-46
WP_109571505.1|4096700_4097384_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	4493751	4520305	8998893	transposase,tRNA	Brochothrix_phage(100.0%)	22	NA	NA
WP_010048169.1|4493751_4494393_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010048168.1|4494517_4495066_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_010048167.1|4495227_4495809_+	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	33.6	6.1e-08
WP_010048166.1|4495911_4496490_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_010048035.1|4497312_4498416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087743.1|4498534_4499827_+	oxidoreductase	NA	NA	NA	NA	NA
WP_162542158.1|4499856_4500639_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_010048030.1|4500701_4501673_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010048029.1|4501875_4504959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571088.1|4505153_4505699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571089.1|4506086_4506791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044567.1|4507363_4507954_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_109571090.1|4511104_4512037_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010033548.1|4512202_4512898_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037885.1|4512867_4513338_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010044561.1|4513789_4515148_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010044560.1|4515307_4516051_+	RraA family protein	NA	NA	NA	NA	NA
WP_081471794.1|4516516_4517467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033103.1|4517470_4517653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034520.1|4517825_4518347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010044549.1|4518394_4518907_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034542.1|4518973_4520305_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	4525079	4558304	8998893	protease,transposase	Bacillus_phage(100.0%)	24	NA	NA
WP_109570712.1|4525079_4526207_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_157507029.1|4526535_4526931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048975.1|4527606_4527849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571516.1|4527961_4529341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033199793.1|4530347_4531811_+|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_081471947.1|4533189_4533726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010053942.1|4534019_4534211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600877.1|4534286_4534706_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_010039730.1|4534822_4535524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039727.1|4535852_4537016_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_010033207.1|4537079_4538237_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033198293.1|4539894_4541076_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010039724.1|4541258_4544279_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_148087741.1|4544385_4544709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039722.1|4544763_4545252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039720.1|4545371_4546187_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_010039714.1|4546279_4547098_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_109571092.1|4547680_4548616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039712.1|4548811_4551553_-	peptidase	NA	NA	NA	NA	NA
WP_010039710.1|4551834_4554693_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010039708.1|4554937_4555294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039706.1|4555409_4556033_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_010039704.1|4556036_4556240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039701.1|4556354_4558304_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 19
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	4784528	4827871	8998893	protease,transposase,integrase	Paramecium_bursaria_Chlorella_virus(25.0%)	36	4774941:4774957	4814972:4814988
4774941:4774957	attL	CTCGACCGGGTGCCCGA	NA	NA	NA	NA
WP_010039137.1|4784528_4785071_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087726.1|4785298_4785820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033997.1|4787821_4788817_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571109.1|4789282_4790374_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010050494.1|4790963_4791521_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_081471997.1|4791539_4793549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033200040.1|4793545_4794016_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033199433.1|4794552_4794846_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_010047041.1|4796507_4797485_-	glycoside hydrolase family 16 protein	NA	M1I6I5	Paramecium_bursaria_Chlorella_virus	29.6	1.4e-20
WP_010047039.1|4797938_4799501_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010047037.1|4800016_4800766_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010047034.1|4801428_4802706_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	32.8	5.2e-60
WP_010047033.1|4802804_4803578_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	40.2	2.2e-21
WP_010047032.1|4803614_4804469_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010047030.1|4804607_4805579_+	PhoH family protein	NA	W8D063	Erwinia_phage	44.7	1.5e-43
WP_109571521.1|4806104_4806329_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_109571110.1|4806335_4806572_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_109571111.1|4806637_4808899_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_029601253.1|4808905_4809091_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_010048921.1|4809165_4810878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048919.1|4810904_4811657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048917.1|4811650_4812226_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010048915.1|4812379_4812652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048913.1|4812860_4814645_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_010048911.1|4814832_4815159_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
4814972:4814988	attR	TCGGGCACCCGGTCGAG	NA	NA	NA	NA
WP_010047515.1|4815503_4815800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047513.1|4816163_4817195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047511.1|4817324_4818236_-	thiamine-monophosphate kinase	NA	NA	NA	NA	NA
WP_010047508.1|4818423_4818912_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_010047506.1|4819663_4820923_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010047504.1|4821008_4821338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035721.1|4821429_4821810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035719.1|4821898_4823059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047502.1|4823026_4825903_-	TIGR03009 domain-containing protein	NA	NA	NA	NA	NA
WP_010047500.1|4826042_4826387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037889.1|4826746_4827871_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	5000681	5051513	8998893	transposase,integrase	Acinetobacter_phage(33.33%)	43	5044557:5044574	5059028:5059045
WP_081471519.1|5000681_5002139_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010036969.1|5004609_5005266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036967.1|5005299_5006004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036965.1|5006110_5006854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036962.1|5007207_5008440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036960.1|5008610_5009699_+	EamA family transporter	NA	NA	NA	NA	NA
WP_010036958.1|5009961_5010933_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010036953.1|5011184_5011526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036952.1|5011551_5011914_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_148087719.1|5011907_5012252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081471802.1|5013347_5014343_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148087718.1|5014363_5015488_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_010044802.1|5015725_5015983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044799.1|5015982_5016480_+	Dna2/Cas4 domain-containing protein	NA	NA	NA	NA	NA
WP_010044797.1|5016574_5017480_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010044795.1|5017651_5018971_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_157506873.1|5018967_5020272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033997.1|5020684_5021680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087717.1|5021631_5022375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044788.1|5022729_5022960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044786.1|5023091_5023706_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_081471800.1|5023730_5024600_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_148087716.1|5024691_5025465_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_010044779.1|5026031_5026172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033199039.1|5026308_5026539_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010044774.1|5026535_5027039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044772.1|5027309_5027585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044770.1|5027584_5027986_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_071529320.1|5028625_5028853_-	hypothetical protein	NA	E5E420	Acinetobacter_phage	55.2	7.4e-10
WP_029600932.1|5030332_5031277_+	DUF932 domain-containing protein	NA	A0A1B1INA2	uncultured_Mediterranean_phage	30.5	1.6e-21
WP_010040982.1|5032012_5032429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040979.1|5032425_5035116_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_010040977.1|5035507_5036281_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_148087715.1|5036432_5037203_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010040974.1|5037199_5037829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040968.1|5037825_5041209_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	25.6	1.1e-45
WP_010040965.1|5041417_5042140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040963.1|5042114_5043296_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_029600931.1|5043292_5043766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600930.1|5043925_5045113_+	hypothetical protein	NA	NA	NA	NA	NA
5044557:5044574	attL	CCGACGGGGCGGAGGCGG	NA	NA	NA	NA
WP_010040957.1|5045116_5046970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040955.1|5046966_5050227_+	helicase-like protein	NA	NA	NA	NA	NA
WP_010040953.1|5050316_5051513_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
5059028:5059045	attR	CCGCCTCCGCCCCGTCGG	NA	NA	NA	NA
>prophage 22
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	6229922	6295007	8998893	protease,transposase	Synechococcus_phage(20.0%)	54	NA	NA
WP_085948097.1|6229922_6231464_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_029600653.1|6231749_6232457_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010034418.1|6232725_6233898_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_109571545.1|6234714_6236049_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010034428.1|6236109_6239070_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_010034431.1|6239224_6241744_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_148087644.1|6241777_6242131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034436.1|6242166_6242853_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_157506530.1|6243047_6243899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034440.1|6244009_6245314_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_010034442.1|6245294_6246551_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010034444.1|6246677_6247703_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	38.3	9.0e-63
WP_010034447.1|6247770_6248652_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_033197785.1|6248648_6249188_-	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	5.9e-05
WP_010034453.1|6249217_6250339_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010034456.1|6250348_6251530_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010034459.1|6251526_6252624_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010034460.1|6252620_6253832_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_109571229.1|6253828_6255295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600655.1|6255291_6256611_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010034471.1|6256607_6257678_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010034473.1|6257683_6258925_-	glycosyl transferase group 1	NA	NA	NA	NA	NA
WP_010034476.1|6258927_6260067_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010034477.1|6260155_6261121_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.5	2.0e-08
WP_010034478.1|6261117_6261939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034482.1|6261935_6262907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034488.1|6262903_6263830_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_168217275.1|6263826_6264366_-	acyltransferase	NA	NA	NA	NA	NA
WP_010034492.1|6264362_6265652_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	1.4e-12
WP_010034493.1|6265660_6266479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010034495.1|6266504_6268010_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_010034497.1|6268561_6269095_+	transcription antitermination protein NusG	NA	NA	NA	NA	NA
WP_010034499.1|6269205_6271464_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_010034502.1|6271497_6272274_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_010034505.1|6272593_6273577_+	acetylxylan esterase	NA	NA	NA	NA	NA
WP_010034508.1|6273629_6275033_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010034509.1|6275055_6276186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034510.1|6276204_6276867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034511.1|6276863_6277490_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
WP_010034512.1|6277634_6278480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034513.1|6278593_6278980_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_148087642.1|6282356_6283295_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_010034518.1|6283390_6283657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034519.1|6283807_6284362_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010034520.1|6284774_6285296_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010034521.1|6285343_6286018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168217274.1|6286629_6287568_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010034528.1|6287860_6288277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034530.1|6288292_6289204_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010034539.1|6289360_6290845_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010034540.1|6291163_6291571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571231.1|6291762_6292368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|6292442_6293570_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010034542.1|6293675_6295007_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	6457708	6524207	8998893	protease,transposase,tRNA	Tupanvirus(16.67%)	43	NA	NA
WP_010039368.1|6457708_6458023_-|tRNA	tRNA/rRNA methyltransferase (SpoU)	tRNA	NA	NA	NA	NA
WP_010039369.1|6458580_6459519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039371.1|6459706_6460738_-	HflC protein	NA	NA	NA	NA	NA
WP_033198261.1|6460761_6462951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039373.1|6463150_6464182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039374.1|6464397_6465075_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.8	6.0e-23
WP_010039376.1|6465550_6466231_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010034323.1|6467064_6467739_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157506518.1|6467674_6468211_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_148087630.1|6468216_6468717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571244.1|6469082_6471236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010051022.1|6471797_6472457_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_010051692.1|6473592_6473769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010051693.1|6473880_6474756_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_148087629.1|6476975_6477818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034237.1|6477864_6478920_-|protease	neutral metalloprotease	protease	NA	NA	NA	NA
WP_050790204.1|6479456_6481190_-	vanadium-dependent haloperoxidase	NA	A0A1V0SD32	Indivirus	29.3	3.1e-47
WP_010034245.1|6481645_6482977_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034247.1|6484140_6484842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034248.1|6484841_6487928_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.7	8.8e-05
WP_010034253.1|6487939_6488653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087628.1|6488649_6489120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034258.1|6489724_6491095_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010034265.1|6491098_6492565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034268.1|6492561_6493509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034273.1|6493607_6494324_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_081471431.1|6494323_6496705_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.5	1.5e-39
WP_010034279.1|6496877_6498485_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010034285.1|6500934_6501111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034287.1|6501222_6501363_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_168217247.1|6501492_6501828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148087627.1|6502116_6502341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600648.1|6502640_6503801_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_029600649.1|6503875_6505201_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_010034300.1|6505204_6508012_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034307.1|6508182_6511023_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162097337.1|6511145_6514022_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034310.1|6514256_6517154_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010033207.1|6517574_6518732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034311.1|6518832_6519456_-	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	45.4	4.2e-39
WP_010034315.1|6519588_6522240_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_029600650.1|6522248_6523232_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	31.1	8.2e-13
WP_010034323.1|6523532_6524207_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	6630282	6687784	8998893	transposase,integrase	Virus_Rctr41k(50.0%)	60	6635277:6635295	6646356:6646374
WP_050790225.1|6630282_6631290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033197911.1|6631389_6632853_+|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_148087617.1|6632871_6633192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036099.1|6633317_6634193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036101.1|6634290_6635163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036102.1|6635256_6635706_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
6635277:6635295	attL	GGTGCGGGTGGTCGTGGCC	NA	NA	NA	NA
WP_010036103.1|6635812_6636814_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036104.1|6636863_6637532_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_010036106.1|6637613_6639953_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_010036107.1|6639972_6640749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036109.1|6641958_6642927_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.4	2.5e-62
WP_050790226.1|6644827_6645247_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010036112.1|6647030_6647420_+	hypothetical protein	NA	NA	NA	NA	NA
6646356:6646374	attR	GGTGCGGGTGGTCGTGGCC	NA	NA	NA	NA
WP_071529248.1|6647534_6648128_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_010036114.1|6648204_6648522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036115.1|6651099_6651297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036117.1|6651443_6651974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570944.1|6652019_6652460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036122.1|6652995_6653379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036124.1|6653923_6654364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571255.1|6654442_6655027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036128.1|6655144_6655429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036130.1|6655500_6655875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036135.1|6656364_6656616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036137.1|6656693_6657032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087614.1|6658600_6659104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036141.1|6659255_6659510_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010047339.1|6660092_6660506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087613.1|6660617_6660902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036145.1|6661422_6661827_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_010036150.1|6664259_6664598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036155.1|6664889_6665273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036156.1|6665344_6665776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036160.1|6665900_6666299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036162.1|6666425_6666728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571550.1|6666817_6667237_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010036167.1|6667307_6667796_+	YfbM family protein	NA	NA	NA	NA	NA
WP_010036172.1|6668411_6668759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571551.1|6668827_6669178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036150.1|6669675_6670014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036178.1|6670129_6670537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036179.1|6670607_6671051_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_010036124.1|6671873_6672314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036182.1|6672425_6672878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036189.1|6672972_6673401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036191.1|6673579_6673849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087610.1|6674288_6674510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036145.1|6675044_6675449_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_148087609.1|6675565_6676267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|6676983_6678112_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010036198.1|6678190_6678523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036141.1|6678630_6678885_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010036203.1|6680532_6680931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571259.1|6680937_6681447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507107.1|6682475_6683390_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_029601337.1|6683711_6684080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010051613.1|6684164_6684569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571261.1|6684631_6685792_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_010049968.1|6685788_6686322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542177.1|6687184_6687784_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	8199269	8217086	8998893	transposase	Leptospira_phage(50.0%)	18	NA	NA
WP_010041153.1|8199269_8199440_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_109571379.1|8199541_8200288_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_010041159.1|8200625_8203013_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_010041162.1|8203009_8203414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041164.1|8203428_8203695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041166.1|8203942_8204674_+	sigma-70 family RNA polymerase sigma factor	NA	S5VTF2	Leptospira_phage	31.2	3.8e-07
WP_010041167.1|8204841_8205675_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010041168.1|8205676_8206429_+	endonuclease III	NA	NA	NA	NA	NA
WP_010041170.1|8206476_8207715_+	peptidase T	NA	NA	NA	NA	NA
WP_010033207.1|8207830_8208988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071529367.1|8209128_8210313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157507077.1|8210228_8210999_+	exosortase	NA	NA	NA	NA	NA
WP_010050623.1|8211131_8213381_+	Etk-like tyrosine kinase involved in Eps biosynthesis	NA	A0A1X9I5D6	Streptococcus_phage	28.7	1.0e-10
WP_010050314.1|8213550_8214198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050316.1|8214284_8214971_+	sugar transferase	NA	NA	NA	NA	NA
WP_010050317.1|8215149_8216187_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010050319.1|8216190_8216421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010050322.1|8216723_8217086_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	8364637	8440249	8998893	transposase,tRNA	Gordonia_phage(14.29%)	59	NA	NA
WP_010037255.1|8364637_8365759_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010037260.1|8367403_8368330_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010037262.1|8368329_8369268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571586.1|8370592_8372458_+	sodium/proton-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_029600771.1|8372712_8374056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037269.1|8374602_8375673_-|transposase	ISKra4-like element ISGob7 family transposase	transposase	NA	NA	NA	NA
WP_081471533.1|8375669_8376059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037277.1|8376090_8376735_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_081471534.1|8377562_8378129_-	VOC family protein	NA	NA	NA	NA	NA
WP_010033207.1|8378178_8379336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035721.1|8379526_8379907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035719.1|8379995_8381156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040886.1|8381354_8382536_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010040888.1|8382901_8384458_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_029600928.1|8384485_8385226_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010040891.1|8385784_8388469_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	31.4	6.6e-49
WP_010040892.1|8388492_8389353_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_010040894.1|8390824_8391238_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_010040896.1|8391848_8392451_-	cytochrome b	NA	NA	NA	NA	NA
WP_010040898.1|8392453_8393557_-	catalase family peroxidase	NA	NA	NA	NA	NA
WP_010040899.1|8393826_8396931_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.0	6.7e-61
WP_010040900.1|8397089_8398526_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010040901.1|8398824_8399301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040902.1|8399494_8400550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040903.1|8400729_8402130_-	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	NA	NA	NA	NA
WP_010040904.1|8402189_8403110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600929.1|8403112_8403997_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010040912.1|8404077_8405607_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010040914.1|8405682_8406123_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_109571587.1|8406718_8406961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040919.1|8407135_8407381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040922.1|8407413_8407653_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010040925.1|8407654_8407903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162542192.1|8408460_8409705_+	protein kinase	NA	G5CT46	Megavirus	30.9	6.5e-15
WP_109571392.1|8409791_8412185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048092.1|8412270_8413668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571588.1|8413664_8414660_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.7	1.1e-12
WP_010048094.1|8414770_8415325_-	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	33.7	2.0e-16
WP_029601220.1|8415514_8415841_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_010048097.1|8415910_8417164_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010048099.1|8417376_8418183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048100.1|8418255_8418747_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_029601221.1|8419086_8419380_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_010048045.1|8419488_8423073_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	40.5	1.6e-18
WP_010048046.1|8423307_8424801_-	transcription termination factor NusA	NA	NA	NA	NA	NA
WP_010048048.1|8425399_8426878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048051.1|8427379_8427898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029601218.1|8428230_8429427_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010041530.1|8429820_8431515_-	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
WP_010041531.1|8431588_8432422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571589.1|8432485_8433373_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010041533.1|8433632_8434922_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_033198501.1|8435028_8436303_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_010041540.1|8436529_8437021_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_010041541.1|8437107_8437497_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_010041542.1|8437524_8438289_-	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.3	5.7e-14
WP_010041543.1|8438369_8438858_-	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_109570720.1|8439102_8439546_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035860.1|8439526_8440249_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	8638751	8645739	8998893	transposase	Shigella_phage(100.0%)	8	NA	NA
WP_109571408.1|8638751_8639630_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	1.1e-21
WP_010033957.1|8639958_8641104_-|transposase	ISAs1-like element ISGob5 family transposase	transposase	NA	NA	NA	NA
WP_010036707.1|8641138_8641513_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_029600747.1|8641557_8642883_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_010036709.1|8643304_8643601_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010036712.1|8643648_8644281_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.3	4.1e-26
WP_010033207.1|8644331_8645489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033197982.1|8645538_8645739_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	8790804	8862251	8998893	protease,transposase,tRNA	Staphylococcus_phage(18.18%)	57	NA	NA
WP_010036633.1|8790804_8791491_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_010036635.1|8791527_8791962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033197976.1|8792715_8793918_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010036639.1|8794608_8796624_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_010036643.1|8796663_8797032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162097345.1|8797091_8798525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010036645.1|8798614_8799517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036646.1|8799638_8801036_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010036648.1|8801028_8801556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036650.1|8801629_8803915_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_029600740.1|8804238_8804937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036652.1|8805008_8807075_-	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_109571599.1|8807179_8807851_-	hypothetical protein	NA	A0A1B2LRQ5	Wolbachia_phage	27.7	8.6e-14
WP_148087977.1|8809520_8809745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036657.1|8811126_8811966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036658.1|8812042_8812885_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	26.9	1.9e-10
WP_148087976.1|8812881_8813367_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010036661.1|8813473_8814577_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_010036662.1|8814745_8815624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571419.1|8815627_8816296_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036664.1|8816362_8817112_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	9.9e-27
WP_010036665.1|8817153_8818878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036666.1|8819077_8820424_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010036667.1|8820606_8821020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036669.1|8821215_8822145_+	NAD-dependent epimerase/dehydratase family protein	NA	M4QPK0	Synechococcus_phage	30.7	1.9e-27
WP_010036670.1|8822158_8822722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036671.1|8822755_8824099_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_010036672.1|8824263_8825169_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	37.2	1.2e-07
WP_010036673.1|8825357_8827625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571420.1|8827716_8829789_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010049979.1|8829958_8832172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049981.1|8832343_8832712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087975.1|8832885_8835435_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	1.6e-15
WP_010052213.1|8835443_8836745_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_010048936.1|8837215_8838130_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	32.2	3.8e-28
WP_010048937.1|8838663_8839524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048939.1|8839549_8839756_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_010048943.1|8839752_8840793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048945.1|8840796_8842002_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109570712.1|8842033_8843161_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_050790368.1|8843381_8845235_+	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	25.1	9.1e-05
WP_010042273.1|8845503_8846388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600995.1|8846577_8847039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042275.1|8847174_8848503_+	dihydroorotase	NA	NA	NA	NA	NA
WP_010042277.1|8848608_8849025_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010042280.1|8849041_8849536_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_085948058.1|8849550_8849796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042284.1|8850597_8852109_+	trigger factor	NA	NA	NA	NA	NA
WP_010042286.1|8852224_8852851_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	41.6	2.7e-33
WP_010042289.1|8853018_8853636_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.1	8.1e-51
WP_010042292.1|8853666_8854566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042294.1|8854666_8855146_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_081471715.1|8855240_8856275_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_010042298.1|8856453_8856846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042300.1|8857111_8858743_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010042302.1|8859122_8860226_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_157506780.1|8861582_8862251_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP025958	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8998893	8926309	8994939	8998893	transposase	Acinetobacter_phage(33.33%)	48	NA	NA
WP_010033685.1|8926309_8927032_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|8927012_8927456_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010036045.1|8927597_8928206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471481.1|8928552_8931594_+	protein kinase	NA	NA	NA	NA	NA
WP_010036047.1|8931686_8932364_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_010036049.1|8932525_8932906_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_010036050.1|8932865_8934176_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_109571427.1|8936652_8936994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036056.1|8937170_8938193_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036057.1|8938541_8940794_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_109571428.1|8940765_8941002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036059.1|8941319_8943164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050790224.1|8943188_8943611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036061.1|8944072_8945341_+	MFS transporter	NA	NA	NA	NA	NA
WP_010036063.1|8945354_8946860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081471484.1|8946903_8947224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036065.1|8947765_8949190_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_148087968.1|8949280_8949793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036069.1|8949819_8950080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036070.1|8950655_8952011_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_109571603.1|8952124_8952577_-	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010036072.1|8952749_8953901_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_010036073.1|8954181_8957877_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_010036074.1|8958031_8960038_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010036075.1|8960250_8962179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036076.1|8962347_8963805_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_010036078.1|8964100_8967388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036080.1|8967460_8972200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036081.1|8972347_8972641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010036082.1|8972688_8973495_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.7	2.2e-40
WP_010036083.1|8973858_8974581_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_010036084.1|8974639_8976802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052619.1|8977009_8977513_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010052621.1|8977659_8979408_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010049370.1|8979538_8980381_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.4	1.6e-20
WP_010049371.1|8980460_8981399_+	nucleotidyltransferase domain-containing protein	NA	G3M9V9	Bacillus_virus	31.5	2.7e-21
WP_010049375.1|8981395_8981941_-	DUF2617 family protein	NA	NA	NA	NA	NA
WP_010049378.1|8982066_8982573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049379.1|8982885_8984199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010049380.1|8984312_8986229_+	HTTM domain-containing protein	NA	NA	NA	NA	NA
WP_010049381.1|8986340_8986664_+	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_109571433.1|8986890_8988516_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_010038601.1|8988837_8990877_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010038603.1|8991081_8991657_+	elongation factor P	NA	NA	NA	NA	NA
WP_010038605.1|8992100_8992604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033197911.1|8992622_8994086_-|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_081471584.1|8994185_8994647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071529269.1|8994600_8994939_-|transposase	transposase	transposase	NA	NA	NA	NA
