The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	801	56751	3197727	capsid,protease,tRNA,terminase,head,portal,tail	Lactobacillus_phage(81.25%)	55	NA	NA
WP_024971545.1|801_996_+	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	71.4	4.5e-16
WP_109365539.1|1150_1804_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	75.0	9.4e-82
WP_109365537.1|1821_2220_+	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	60.6	1.5e-34
WP_079111805.1|2661_3087_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.2	7.2e-67
WP_162551024.1|4263_5061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063485443.1|5143_5323_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	66.1	3.6e-12
WP_063487070.1|6021_6483_+|terminase	phage terminase small subunit P27 family	terminase	A0A286QRF4	Streptococcus_phage	57.5	3.2e-44
WP_063487071.1|8365_8560_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	89.1	3.8e-23
WP_063487072.1|8562_9759_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	90.2	2.2e-206
WP_063487073.1|9736_10495_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.0	5.5e-126
WP_072534789.1|10494_11727_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.9	5.0e-209
WP_016058329.1|11799_12138_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_016058330.1|12121_12484_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	100.0	5.2e-66
WP_063722567.1|12473_12914_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	99.3	5.0e-79
WP_063722568.1|12910_13294_+	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	98.4	9.4e-66
WP_063722569.1|13294_13933_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	99.5	1.1e-116
WP_063722570.1|14134_14518_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	97.6	7.4e-63
WP_016058335.1|14514_14706_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_079111804.1|14718_19887_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	98.0	0.0e+00
WP_079111803.1|19958_21731_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	97.3	0.0e+00
WP_079111802.1|21794_24164_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	96.1	0.0e+00
WP_079111801.1|24180_26946_+	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	50.4	1.8e-195
WP_016058340.1|26938_27193_+	hypothetical protein	NA	E9LUR5	Lactobacillus_phage	100.0	1.4e-30
WP_016058341.1|27196_27358_+	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	100.0	1.2e-19
WP_063487082.1|27341_28226_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	99.7	1.7e-139
WP_016058343.1|28241_29414_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	100.0	3.1e-216
WP_003644510.1|29413_29677_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_016058344.1|29689_30220_+	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
WP_003644508.1|31460_32672_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_079111800.1|33150_34893_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645638.1|34911_35703_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|35683_36868_+	LCP family protein	NA	NA	NA	NA	NA
WP_003645636.1|37019_37592_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003640752.1|38343_39285_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003644503.1|39730_40123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640750.1|40286_40679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355614.1|40714_41884_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645631.1|41933_42563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079111799.1|42957_43098_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|43187_43820_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|43971_44211_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|44308_44545_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|44601_45237_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003644499.1|45348_46107_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003640742.1|46090_46396_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|46480_47479_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640740.1|47767_48490_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|48714_49518_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003644498.1|49620_50499_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_079111798.1|50699_51422_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|51423_51987_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640735.1|52106_52886_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640734.1|52901_53687_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640733.1|53724_55002_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640732.1|55041_56751_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	567858	580636	3197727		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355474.1|567858_568803_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
WP_079111784.1|568827_569493_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|570202_570895_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_022638019.1|570887_572255_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_013355470.1|572645_573086_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_013355469.1|573156_573717_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_022638021.1|573804_576243_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|576245_576860_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|577202_578150_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_013355468.1|578335_579307_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_013355467.1|579397_580636_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 3
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	1227319	1235943	3197727		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|1227319_1228315_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|1228453_1229239_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|1229242_1230139_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|1230237_1230585_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|1230609_1231629_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|1231645_1231975_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003643941.1|1231971_1232637_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|1233034_1233286_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|1233300_1233900_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1233915_1234224_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|1234245_1235943_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 4
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	1369431	1423209	3197727	protease,tRNA,bacteriocin	uncultured_Mediterranean_phage(22.22%)	50	NA	NA
WP_003646511.1|1369431_1370703_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|1371169_1372783_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|1372955_1373564_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|1373608_1374049_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_027821488.1|1374411_1375344_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|1375352_1376711_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|1376730_1377540_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_015825144.1|1377709_1378696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|1378778_1379801_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|1380089_1381070_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_011101017.1|1381435_1382260_-	serine hydrolase	NA	NA	NA	NA	NA
WP_027821489.1|1382495_1383878_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	7.4e-28
WP_003642030.1|1383946_1384783_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003646500.1|1385138_1385936_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|1385928_1386627_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|1386895_1387840_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|1388149_1389016_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|1389148_1389400_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|1389504_1390395_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|1390391_1390955_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|1390941_1391718_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_079111768.1|1391840_1392773_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|1393005_1395057_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_024971611.1|1395378_1395768_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027821490.1|1396362_1397205_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_027821491.1|1397204_1397909_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_027821492.1|1397930_1398890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|1398882_1400157_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|1400202_1401120_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_027821493.1|1401561_1402575_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|1402687_1403434_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|1403583_1404480_-	ROK family protein	NA	NA	NA	NA	NA
WP_027821494.1|1404560_1405997_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	1.3e-30
WP_003643816.1|1406014_1407370_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|1407592_1408015_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|1408004_1408193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|1408199_1409561_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|1409633_1410344_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825134.1|1410749_1411766_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_027821495.1|1412204_1412981_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003646480.1|1413239_1415549_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027821496.1|1415643_1415847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821497.1|1415984_1416671_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821498.1|1416764_1417445_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821499.1|1417531_1418200_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821500.1|1418267_1418957_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821501.1|1419046_1420423_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027821502.1|1420439_1422590_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_003641985.1|1422855_1423026_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|1423050_1423209_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	2631013	2639524	3197727		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|2631013_2631496_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_024521791.1|2631479_2632610_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_021356104.1|2632612_2633344_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_003642588.1|2633345_2633600_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|2633599_2634280_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|2634272_2636492_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_027821844.1|2636476_2637931_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.3e-50
WP_027821845.1|2637927_2638953_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	9.3e-60
WP_003645867.1|2638945_2639524_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 6
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	2833453	2884702	3197727	capsid,terminase,integrase,head,portal,tail	Lactobacillus_phage(36.36%)	67	2822713:2822727	2892782:2892802
2822713:2822727	attL	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821884.1|2833453_2834611_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	5.0e-54
2822713:2822727	attL	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_050482352.1|2834661_2835312_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	46.5	3.6e-09
WP_027821885.1|2835489_2835672_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021357488.1|2835942_2836173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821886.1|2836186_2836987_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_027821888.1|2838526_2839006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821889.1|2839021_2839213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821890.1|2839199_2839538_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	1.3e-07
WP_027821891.1|2839530_2839920_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	3.0e-19
2839577:2839591	attR	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821892.1|2840930_2841404_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
2839577:2839591	attR	TGGTTGCCTATGACA	NA	NA	NA	NA
WP_027821893.1|2841400_2843104_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.1	2.2e-122
WP_027821894.1|2843258_2844359_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	1.4e-48
WP_027821895.1|2844355_2845900_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.6	8.2e-44
WP_027821896.1|2845988_2846258_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027821897.1|2846417_2846786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821898.1|2846864_2847338_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_027821899.1|2847343_2847925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642774.1|2848338_2848545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821349.1|2848895_2850017_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	33.0	2.0e-47
WP_027821900.1|2850282_2851902_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	47.9	3.1e-94
WP_016511204.1|2852059_2852236_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	3.9e-11
WP_162551031.1|2852846_2853473_-	Ltp family lipoprotein	NA	A0A173G9H4	Propionibacterium_phage	60.0	7.3e-07
WP_027821901.1|2853754_2854177_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	7.8e-13
WP_027821902.1|2854191_2854710_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	1.6e-15
WP_033608054.1|2854851_2855106_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_050482353.1|2855262_2855544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821903.1|2855602_2855785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608056.1|2855781_2856180_-	DUF2513 domain-containing protein	NA	A0A1P8L6H1	Staphylococcus_phage	38.4	5.1e-14
WP_003642789.1|2856179_2856410_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_027821904.1|2856551_2856758_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027821905.1|2856757_2857054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608057.1|2857078_2857249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101775.1|2857260_2857566_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_027821906.1|2857633_2858146_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.8e-27
WP_027821907.1|2858395_2858683_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.3e-22
WP_027821908.1|2859011_2859398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821909.1|2859394_2860294_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	1.0e-62
WP_016511194.1|2860325_2861078_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	1.1e-70
WP_016511193.1|2861158_2861947_+	replication protein DnaD	NA	NA	NA	NA	NA
WP_016511192.1|2861927_2862770_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	96.1	2.9e-152
WP_027821910.1|2862926_2863649_+	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	4.2e-51
WP_027821911.1|2863653_2864172_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	2.9e-54
WP_027821912.1|2864168_2864549_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_027821913.1|2864760_2865222_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	3.1e-39
WP_033608060.1|2865631_2866651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821914.1|2866668_2867172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821915.1|2867250_2867430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821916.1|2867398_2867671_+	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	50.6	4.0e-18
WP_027821917.1|2867894_2868215_+	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	45.6	1.8e-17
WP_033608061.1|2868272_2868788_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	88.8	2.8e-65
WP_033608063.1|2868780_2870094_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.3	8.6e-127
WP_050482354.1|2870108_2871845_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	34.4	7.0e-76
WP_027821919.1|2871844_2872756_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_027821920.1|2872866_2873526_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_027821921.1|2873539_2873911_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	33.6	1.5e-07
WP_050482355.1|2873926_2875036_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	40.1	1.8e-61
WP_027821922.1|2875053_2875422_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_033608065.1|2875418_2875751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821923.1|2875751_2876243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821924.1|2876245_2876641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821925.1|2876689_2877343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821926.1|2877371_2877890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821927.1|2877964_2878222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079111870.1|2878446_2882235_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	57.2	3.3e-38
WP_027821928.1|2882259_2882538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821929.1|2882610_2883522_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	30.3	1.6e-18
WP_027821930.1|2883514_2884702_+|tail	phage tail protein	tail	NA	NA	NA	NA
2892782:2892802	attR	CCGTGCGGGTGATAAGTTGAC	NA	NA	NA	NA
>prophage 7
NZ_CP029349	Lactiplantibacillus plantarum strain HAC01 chromosome, complete genome	3197727	3192041	3196994	3197727		Lactobacillus_phage(66.67%)	11	NA	NA
WP_057138663.1|3192041_3192716_-	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	44.6	8.0e-52
WP_057138664.1|3192884_3193133_+	transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	61.4	4.0e-17
WP_063722542.1|3193148_3193856_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	59.9	5.1e-65
WP_079111810.1|3193867_3194077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|3194192_3194519_-	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_079111809.1|3194576_3194837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063722546.1|3194979_3195234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641371.1|3195236_3195437_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_162920430.1|3195720_3195891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098960.1|3195890_3196148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137016.1|3196250_3196994_+	replisome organizer	NA	E9LUM6	Lactobacillus_phage	57.3	2.7e-40
