The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	326317	337198	5198840	integrase,transposase	Enterobacteria_phage(22.22%)	10	319909:319922	335525:335538
319909:319922	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000749863.1|326317_327373_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|327660_328764_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|328775_330029_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|330384_331599_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|331741_332623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|332820_333018_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|333017_333449_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_001019379.1|333461_334295_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_085948178.1|334413_335627_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
335525:335538	attR	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000942525.1|336127_337198_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	550995	630887	5198840	tRNA,transposase,protease,tail,head,capsid	Escherichia_phage(36.36%)	70	NA	NA
WP_000186631.1|550995_551475_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|551678_552473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|552610_552952_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|553065_555570_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|555831_556764_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|556766_558059_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|558183_558591_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|558591_559050_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|559046_559964_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|560109_560787_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|560773_561556_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|561618_562473_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|562533_563343_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|563332_563956_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|563926_564613_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|564609_567024_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|571645_571906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|573137_574232_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|574300_575227_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|575456_575939_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|576016_576832_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|576921_578703_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|578715_579492_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|579591_580470_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|580638_582093_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|582152_583514_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|583570_584872_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|584893_586039_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|586167_586953_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|586963_588199_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|588220_589270_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|589586_591254_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|591263_592523_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|592533_593349_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|593345_594239_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|594375_595443_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|595439_595949_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|596066_596789_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|596791_597286_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|597459_598845_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|598880_599402_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|599509_599722_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|599723_600590_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|601070_601613_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|601832_602525_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|602555_605165_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|606216_606732_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|606734_607367_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|608577_608910_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|608965_609991_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|610032_610428_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|610439_610739_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|610759_611972_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|612065_612644_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|612640_613036_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|613043_613784_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|613799_614222_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|614203_614638_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|614630_616811_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|616816_618029_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244794.1|617995_618142_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_000239881.1|618099_618768_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|618824_619130_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|619313_620798_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|620984_621938_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|622450_623212_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|623394_624285_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|624285_627258_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|627244_629482_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|629750_630887_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	850433	868387	5198840	integrase,tail,transposase,holin	Enterobacteria_phage(50.0%)	25	850346:850360	869714:869728
850346:850360	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000263438.1|850433_851510_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000638251.1|851523_851934_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_085948178.1|851917_853131_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075117.1|853136_853334_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_000411800.1|853333_853540_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000023272.1|853987_855838_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|856136_856295_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|856380_857124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|857308_857998_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|858012_858135_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|858474_859434_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|859645_859834_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|859830_860193_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|860189_860480_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|860472_860685_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|860677_860854_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|860853_861213_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_074458876.1|861215_861371_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.0	4.7e-24
WP_085948178.1|861437_862650_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001191368.1|862692_862896_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
WP_000950982.1|863001_863883_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|864106_864937_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|865060_865432_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001002868.1|866650_867031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|867174_868387_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
869714:869728	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 4
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1079041	1121604	5198840	transposase,protease,holin	Escherichia_phage(37.04%)	55	NA	NA
WP_000156528.1|1079041_1080802_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1080987_1081440_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1081515_1082556_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1082912_1083422_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1083694_1084270_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1084232_1086395_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1086404_1086851_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1086973_1089028_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1089059_1089518_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1089613_1090276_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1090448_1090862_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1090906_1091224_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1091281_1092472_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1092566_1092845_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1092841_1093171_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1093261_1093921_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1095325_1095568_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|1096730_1097944_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000048507.1|1097995_1099420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1099512_1099704_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1099700_1099889_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1100420_1100795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1100806_1100959_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1101231_1101948_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1101997_1102213_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1102209_1102635_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1102706_1103777_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1103817_1104240_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1104236_1104533_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1104529_1104991_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1104968_1105325_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1105375_1105588_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1105673_1105838_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1105839_1106103_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1106113_1106983_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1107098_1107203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1107391_1107604_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1107771_1108032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1108051_1109101_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1109113_1109485_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1109474_1109846_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1109997_1110816_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1111102_1111300_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1111437_1112151_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1112918_1114769_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1115216_1115423_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1115678_1115951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1116110_1116644_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1116864_1116978_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1117199_1117385_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1117911_1118226_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1118307_1118532_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|1118581_1119795_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|1119881_1120775_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1121220_1121604_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1177140	1244390	5198840	integrase,protease,transposase	Escherichia_phage(23.53%)	58	1169377:1169391	1200603:1200617
1169377:1169391	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_000279869.1|1177140_1178343_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1178529_1180347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1181458_1181755_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1181981_1182179_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|1182397_1183831_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1184651_1185215_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1185369_1187730_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998045.1|1188486_1190025_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_085948178.1|1190236_1191449_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000024297.1|1192306_1192666_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591991.1|1192758_1194378_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1194602_1194878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042352357.1|1195258_1195957_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1196047_1196350_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1196358_1196679_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1196671_1198375_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1198384_1198849_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142973.1|1198849_1199524_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1199535_1200153_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1201364_1201628_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
1200603:1200617	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001135715.1|1201929_1202070_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000435663.1|1205951_1206377_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1206373_1206724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1206754_1208368_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957251.1|1209310_1209652_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1209638_1209968_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1210228_1210696_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1210713_1211922_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1211932_1212889_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1212888_1213968_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|1213969_1214743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|1214735_1215878_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|1215887_1216946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|1217267_1217849_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_108988474.1|1217848_1219006_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|1219028_1219484_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|1219506_1220547_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|1220595_1221174_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|1221242_1221818_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|1222242_1222629_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|1223142_1225233_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|1226685_1226904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|1227537_1227873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|1228653_1228848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|1228899_1229073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|1229161_1229434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|1229717_1229933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|1229998_1230196_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|1230925_1232050_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|1233403_1233862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|1234319_1234829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|1234917_1235541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|1235636_1235870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|1235922_1236114_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|1236788_1237835_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001304205.1|1238588_1240757_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000502842.1|1242474_1243113_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_085948178.1|1243176_1244390_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1345181	1415590	5198840	integrase,transposase,tRNA,terminase,tail,holin,head,capsid	Stx2-converting_phage(36.36%)	75	1340275:1340289	1346756:1346770
1340275:1340289	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1345181_1346300_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1346268_1346538_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1346599_1349065_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1346756:1346770	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1349157_1349349_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1349345_1349534_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1349873_1350014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1350017_1350236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1350276_1350666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1350961_1351240_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1351241_1351433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1351453_1351825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1351922_1352225_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|1352221_1352647_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1352669_1353632_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_023981635.1|1353672_1354089_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
WP_085948178.1|1354128_1355342_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001002672.1|1355651_1355963_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|1356268_1356847_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|1356806_1357904_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_085948178.1|1358538_1359752_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|1359789_1359930_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|1360097_1360370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1360371_1361427_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1361427_1361793_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1361801_1362332_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1362573_1362771_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1362921_1363980_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_108988476.1|1364776_1366531_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_085948178.1|1366570_1367784_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411802.1|1368387_1368594_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1368598_1368943_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1368993_1369527_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1369797_1370367_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1370366_1370513_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1370740_1370926_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1371350_1371578_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1371619_1371985_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1372274_1372838_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1372834_1374496_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|1374559_1376497_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1376541_1376763_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1379451_1379778_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1379787_1380138_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1380134_1380581_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1380577_1380922_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1380988_1381705_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1381710_1382085_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1382180_1382390_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1382441_1385684_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1385676_1386018_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1386017_1386716_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1386732_1387053_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1387160_1387334_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1388381_1389119_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1389064_1389697_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|1389933_1393413_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|1393479_1394079_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|1394143_1395466_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|1395467_1395737_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1395843_1395933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1395952_1398301_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1398891_1402293_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_000145590.1|1402461_1403040_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1403062_1403188_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1403267_1403543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1403603_1404965_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1405328_1406192_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1406175_1407312_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359442.1|1407561_1408791_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1408936_1410058_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1410133_1411594_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1411593_1412265_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1412432_1413803_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1413806_1414448_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1414483_1415590_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1516806	1589828	5198840	transposase,portal,protease,terminase,holin,tail	Enterobacteria_phage(42.31%)	79	NA	NA
WP_000268365.1|1516806_1517355_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_085948178.1|1519201_1520414_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075578.1|1520478_1521015_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1521047_1521329_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1521325_1521622_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1521618_1522080_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1522057_1522414_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1522509_1522881_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1522877_1523231_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1523436_1523736_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1523741_1523999_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1524134_1524413_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1524414_1525464_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1525476_1525851_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1525847_1526669_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1526895_1527093_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1527243_1528302_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1528896_1530843_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1530980_1531160_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1531200_1531446_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1531523_1531739_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1531742_1531988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1532013_1533226_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000992150.1|1533649_1534183_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012578895.1|1534701_1534887_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000373407.1|1535362_1535839_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1535835_1537959_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1537955_1538168_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1538167_1539670_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1539614_1541639_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1541726_1542053_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1542045_1542327_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1542329_1542953_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1542965_1543364_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1543371_1544124_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1544137_1544560_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1544586_1544895_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1544938_1547584_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1547580_1547910_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|1548617_1549361_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|1549306_1549939_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_106895295.1|1550175_1553652_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_001230455.1|1553719_1554319_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|1554383_1555697_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1555698_1555968_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000692020.1|1557103_1557694_+	protein kinase	NA	NA	NA	NA	NA
WP_001079509.1|1558730_1559237_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1559282_1559783_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1559868_1560048_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1560428_1561235_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1561234_1562428_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|1562439_1563798_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1563801_1565397_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1565396_1566959_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1567050_1567095_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1567232_1568114_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1568110_1568731_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1568831_1569704_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1569743_1570334_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1570330_1571089_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1571308_1572358_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1572393_1572645_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1573024_1575622_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_000776253.1|1575831_1576806_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295577.1|1577136_1577265_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001297116.1|1577267_1577435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1577548_1577644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099519.1|1577807_1580483_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1580546_1581137_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256539.1|1581306_1582071_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876286.1|1582219_1582528_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1582534_1583704_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176278.1|1583895_1584633_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001295580.1|1584632_1584959_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000498253.1|1585084_1585303_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088625.1|1585571_1586321_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1586410_1586584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153244795.1|1588502_1588649_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	80.0	4.9e-07
WP_085948178.1|1588614_1589828_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1650212	1684013	5198840	tRNA,integrase,transposase,holin	Escherichia_phage(56.76%)	44	1649846:1649861	1681002:1681017
1649846:1649861	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|1650212_1651445_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1651699_1652683_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1653160_1654534_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1654662_1655598_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1655649_1656885_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1656886_1657102_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1657201_1657390_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1657427_1657577_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1657632_1658442_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1658434_1661035_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1661136_1661412_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1661486_1661657_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1661656_1661878_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1662319_1662808_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1662804_1662960_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1662970_1663150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1663392_1663812_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1663891_1664146_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1664142_1664565_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1664642_1665431_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1665437_1666184_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1666206_1666968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1666983_1667406_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1667511_1667724_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1667809_1667974_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1667975_1668239_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1668249_1668411_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1668489_1668735_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1669166_1670318_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1670285_1671275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1671274_1672666_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|1673165_1673765_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1673764_1674055_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1674051_1674606_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1675167_1675599_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_106914131.1|1676169_1678023_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|1678172_1678388_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1678392_1678737_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1678787_1679321_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|1679594_1680134_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_085948178.1|1680136_1681350_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1681002:1681017	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_001303943.1|1682376_1682655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1683082_1683229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1683365_1684013_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
>prophage 9
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1692772	1717148	5198840	transposase,tail	Escherichia_phage(45.0%)	31	NA	NA
WP_000048484.1|1692772_1695244_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|1695339_1695528_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1695524_1695713_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1696112_1696280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1696273_1696507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1696484_1696892_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|1696914_1697133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1697205_1697505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1697769_1698177_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1698463_1699015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1698986_1700027_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1699938_1700481_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|1700514_1701249_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|1701245_1701410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1702108_1702867_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1703145_1703358_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1703578_1703836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|1703905_1704184_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|1704185_1705241_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1705241_1705607_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1705603_1706293_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|1707822_1709592_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_085948178.1|1709643_1710856_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064764776.1|1710822_1710945_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_001023452.1|1710946_1711216_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1711356_1712232_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|1712456_1713107_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1713702_1714017_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1714076_1715360_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1715448_1716909_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1716944_1717148_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1856369	1978828	5198840	transposase,integrase,protease,terminase,head,holin,tail,capsid	Stx2-converting_phage(32.08%)	116	1936401:1936417	1974058:1974074
WP_000826406.1|1856369_1857578_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|1858104_1858773_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|1859075_1859669_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|1859665_1860658_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|1860849_1861761_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|1861755_1862292_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1862354_1862579_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1862718_1864374_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013783.1|1864598_1865942_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|1866158_1867082_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|1867119_1868760_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1869158_1869308_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1869379_1869553_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1869797_1870328_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1870516_1871518_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1873058_1873859_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|1874130_1878033_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1878233_1878839_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1878889_1880206_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|1880195_1881953_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|1881968_1882865_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1882864_1883470_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|1883640_1885947_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|1886010_1886871_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|1887101_1887692_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|1887673_1888624_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1888724_1890038_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|1890064_1891270_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1891269_1891692_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1891681_1893109_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|1893110_1893899_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1893898_1894666_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|1894662_1895733_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1895740_1896238_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1896252_1896999_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1897007_1897295_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1897306_1898236_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|1898520_1900566_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|1900813_1903087_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|1904866_1905772_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001341369.1|1905943_1906270_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1906277_1906463_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|1906459_1909099_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1909306_1910296_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1910406_1910829_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1910825_1911092_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|1911365_1914890_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|1915256_1916390_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|1916530_1916965_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1917545_1918187_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1918268_1918898_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|1918970_1919546_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|1919658_1919928_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|1919929_1921243_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|1921307_1921907_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|1921977_1925475_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|1925608_1926136_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|1926326_1926959_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|1926904_1927648_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|1927658_1928357_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|1928356_1928698_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212770.1|1928690_1931933_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_001453698.1|1931984_1932194_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|1932289_1932664_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275480.1|1932669_1933386_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_000133393.1|1933454_1933799_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1933795_1934242_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|1934238_1934589_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|1934598_1934925_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
1936401:1936417	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063099.1|1937289_1937511_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|1937555_1939493_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|1939556_1941218_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1941214_1941778_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|1942067_1942433_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|1942474_1942702_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1943070_1943295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1943380_1943566_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|1944083_1944617_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1944667_1945012_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|1945016_1945223_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000143036.1|1945668_1947519_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|1947966_1948098_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000705364.1|1948941_1949463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1949446_1949674_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1949751_1950159_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1950351_1950504_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1950515_1950881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1950849_1951137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1951552_1951741_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_108988479.1|1951737_1951872_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085948178.1|1951923_1953136_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_159090333.1|1953102_1953249_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.4e-06
WP_085948178.1|1955650_1956864_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001296941.1|1957203_1957440_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1957474_1958755_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1958774_1958885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1958942_1959962_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1959973_1961188_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1961393_1961720_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1961854_1962196_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1962230_1962791_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1962793_1963504_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1963611_1963917_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1964115_1966542_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1966602_1969026_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1969036_1969654_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1969655_1970510_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1970552_1971167_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|1971325_1972618_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1972570_1973266_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1973390_1974611_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
1974058:1974074	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|1974745_1975639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1975745_1976999_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|1977395_1977731_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1977823_1977907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|1978006_1978828_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2102309	2140393	5198840	transposase,tRNA,portal,plate,terminase,tail,holin,head,capsid	Enterobacteria_phage(86.11%)	45	NA	NA
WP_100206497.1|2102309_2102588_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2102598_2102877_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2102888_2103131_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000165075.1|2103195_2104077_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000686506.1|2105649_2106609_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2106613_2106925_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2107289_2107559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2108121_2108646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2108660_2109707_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2109706_2111458_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2111612_2112449_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2112472_2113525_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2113570_2114371_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2114473_2114968_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2114967_2115168_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2115170_2115494_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2115490_2115883_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2115879_2116287_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2116424_2116892_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2116884_2117520_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2117516_2118098_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2118094_2118445_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2118448_2119345_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2119337_2119868_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2119870_2122003_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2122002_2122581_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2122624_2123197_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2123353_2123842_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2123854_2126662_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2126648_2126804_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2126812_2127187_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2127242_2127755_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2127754_2128939_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2129096_2130206_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2130431_2131934_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2132177_2132438_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2132628_2132769_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2133075_2133375_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2133379_2135767_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2135781_2136765_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2137048_2137093_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2137215_2137572_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2137624_2137822_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2137918_2138461_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2138464_2140393_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 12
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2360025	2447917	5198840	transposase,integrase,portal,terminase,head,holin,tail,capsid	Escherichia_phage(31.75%)	103	2446384:2446443	2460687:2460767
WP_085948178.1|2360025_2361239_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_159090334.1|2361244_2362369_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.6	4.4e-188
WP_000879833.1|2363760_2364558_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2364567_2365119_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2365287_2365620_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2365953_2366268_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|2366481_2368140_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2368132_2369128_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2369120_2369807_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|2369806_2371180_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2371198_2371642_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620092.1|2371638_2372766_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2372870_2373335_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2373339_2374344_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2374340_2374754_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2374756_2375122_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2375121_2375859_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2375868_2376138_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2376145_2376931_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2377220_2377844_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2377887_2378130_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2378238_2378466_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2378763_2379579_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2379575_2381270_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|2381440_2381623_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2381701_2382619_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2382791_2383712_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2383700_2384171_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2384151_2385570_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2385636_2386332_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2386371_2386737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2387303_2388467_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|2389057_2389909_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2390016_2391375_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2391374_2392046_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|2392178_2392592_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2392700_2393705_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2393705_2394341_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_122993428.1|2394576_2395248_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2395590_2396121_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2397355_2398369_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2398774_2399044_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106888379.1|2399045_2400368_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.4	1.6e-75
WP_001230455.1|2400432_2401032_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2401099_2404576_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2404822_2405455_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001152113.1|2406148_2406847_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2406846_2407176_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081780.1|2407172_2409785_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|2409765_2410179_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2410205_2410628_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2410641_2411394_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2411401_2411797_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2411793_2412327_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2412342_2412696_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2412688_2413072_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2413123_2414152_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2414209_2414557_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2414593_2416099_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2416088_2417681_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2417677_2417884_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2417867_2419796_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2419767_2420274_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2420700_2420925_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2421006_2421321_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2421846_2422032_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2422549_2423083_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|2423641_2423857_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2423933_2424206_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2424246_2424426_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_024222300.1|2424563_2426501_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
WP_153244796.1|2426486_2426630_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|2426979_2427411_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2427498_2427924_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2427920_2428271_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2428301_2429915_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2430400_2431114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2431248_2431446_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2431669_2432224_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2432232_2432592_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2432604_2433654_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2433655_2433928_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2434049_2434394_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2434513_2434726_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2434959_2435517_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2435518_2435737_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2435864_2436176_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2436168_2436396_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2436392_2436674_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2436706_2437423_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2437444_2438191_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2438197_2439268_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2439339_2439765_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2439748_2440030_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2440129_2440549_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2440814_2440967_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2440978_2441617_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2441617_2441827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2442397_2442586_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2442582_2442774_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048405.1|2442866_2445254_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001300307.1|2445489_2446287_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2446384:2446443	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_001345280.1|2446642_2447917_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_001345280.1|2446642_2447917_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2460687:2460767	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAA	NA	NA	NA	NA
>prophage 13
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2673278	2742166	5198840	integrase,transposase,lysis,protease,terminase,holin,capsid	Enterobacteria_phage(20.0%)	64	2711220:2711255	2743106:2743141
WP_000101907.1|2673278_2674520_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2675016_2675223_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2675177_2676986_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2677201_2677441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2677413_2677647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2677639_2677873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2677878_2678178_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2678174_2679575_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2679776_2680022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2680152_2680347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2680350_2680512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2680639_2681128_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2681290_2682214_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2685590_2686238_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2686272_2687325_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2687321_2687879_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2687875_2689819_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2689815_2690295_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2690291_2690501_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2690497_2691235_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2691276_2691939_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2691935_2692553_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2692571_2693174_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2693183_2693633_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2693629_2694493_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2694479_2695175_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2695181_2697668_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2697664_2697928_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2697917_2698412_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2698820_2699309_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2699457_2701104_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2701321_2702965_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2703040_2703691_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2703690_2704755_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2704828_2705884_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2705995_2707087_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2707825_2710498_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2710514_2711165_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2711220:2711255	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2711364_2714214_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2714488_2715265_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2715269_2716919_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|2716919_2721314_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2722115_2723438_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2724131_2724770_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_085948178.1|2724807_2726020_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000881316.1|2726060_2726585_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2726734_2727172_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2727168_2727666_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2727665_2727881_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2728023_2728422_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2728502_2728661_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2729753_2730377_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2730373_2731039_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2731035_2731638_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2731612_2732179_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2732726_2733659_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2733697_2734525_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2735028_2735211_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2735367_2735712_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2735817_2736036_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2736013_2737084_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2737078_2737705_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2737701_2739390_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_108988489.1|2739538_2742166_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2743106:2743141	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 14
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	3091900	3178097	5198840	tRNA,transposase,portal,protease,terminase,tail	Enterobacteria_phage(73.68%)	89	NA	NA
WP_001298974.1|3091900_3092638_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3092769_3094104_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3094313_3095195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3095298_3095886_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3095941_3096325_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3096628_3097318_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3097365_3098403_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3098609_3099029_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3099097_3099796_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3099827_3102488_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3102601_3103957_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3104002_3104326_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3104322_3105621_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3111473_3114047_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3114176_3114908_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3114904_3115885_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3116019_3116757_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3117027_3117369_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3117472_3117520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3117618_3118779_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3118821_3119943_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3119953_3121024_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3121233_3121599_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3121748_3122267_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3122256_3123483_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3123498_3123981_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3124057_3124405_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3124446_3125214_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3125244_3125793_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3125811_3126060_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3126308_3127670_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3127836_3128628_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3128648_3129935_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3129989_3130583_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3130705_3131584_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3131669_3133331_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3133479_3133821_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3133882_3134173_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3134162_3134639_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3134770_3135253_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3136101_3136350_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3136717_3136987_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_001230455.1|3138374_3138974_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|3139041_3142518_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|3142764_3143397_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3143342_3144086_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3144091_3144790_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3144789_3145119_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|3145115_3147761_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|3147804_3148113_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3148139_3148562_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3148575_3149328_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_001444799.1|3149335_3149626_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
WP_085948178.1|3149680_3150893_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|3150896_3151043_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_000974958.1|3151055_3151679_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|3151681_3151963_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3151955_3152282_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_106895285.1|3152369_3154334_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3154337_3155840_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|3155839_3156052_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_108988492.1|3156048_3158172_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000373407.1|3158168_3158645_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3159119_3159305_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|3160308_3160578_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3160587_3161535_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3162041_3162476_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3162468_3162663_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3162659_3163265_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000211413.1|3164062_3164767_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001254256.1|3165041_3165224_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3165220_3165748_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|3165744_3166191_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|3166147_3166384_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|3166394_3166610_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3166742_3167021_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|3167090_3167360_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131492.1|3167359_3168796_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3168785_3169685_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3169677_3169824_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_001177653.1|3169858_3170137_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000335772.1|3171012_3171636_+	hypothetical protein	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
WP_000532424.1|3171636_3172149_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_001111331.1|3172162_3172456_+	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_001214463.1|3172466_3172634_+	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001289947.1|3172630_3173230_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_085948178.1|3173581_3174795_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000448925.1|3175859_3176276_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3176348_3178097_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
>prophage 15
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	3251345	3258485	5198840		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3251345_3253907_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3254012_3254669_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3254719_3255487_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3255682_3256591_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3256587_3257850_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3257846_3258485_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 16
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	4785152	4830064	5198840	tRNA,terminase,tail,holin,head,capsid	Stx2-converting_phage(34.09%)	48	NA	NA
WP_000956557.1|4785152_4785686_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|4786103_4786385_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4786421_4786994_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4786993_4787728_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4787730_4787922_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829414.1|4787974_4788391_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
WP_000145671.1|4788537_4789011_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4789007_4789358_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4789348_4789885_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4790012_4790837_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4790902_4791265_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4791968_4792661_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4792758_4793019_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4793011_4793563_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4795075_4795828_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4796137_4796290_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4797107_4798958_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|4799406_4799613_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4799612_4800110_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4800326_4800512_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4801039_4801354_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001377217.1|4801607_4802138_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_000958398.1|4802253_4802817_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4802813_4804475_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4804538_4806476_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4806520_4806742_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4809105_4809432_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4809441_4809792_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4809788_4810235_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4810231_4810576_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4810642_4811359_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4811364_4811739_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4811834_4812044_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4812095_4815338_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4815330_4815672_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4815671_4816370_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4816380_4817124_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4817069_4817702_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000514845.1|4817937_4821414_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|4821482_4822106_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4822170_4823484_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4823485_4823755_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4823915_4824338_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4824467_4825526_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4825604_4826255_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4826437_4827028_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4827529_4827778_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4829026_4830064_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	4944700	5008557	5198840	tRNA,protease,integrase,transposase	Vibrio_phage(12.5%)	59	4986434:4986463	5011924:5011953
WP_000811566.1|4944700_4944976_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4945092_4946718_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|4946801_4947965_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|4947967_4948606_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4948615_4949014_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|4949031_4949691_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4949741_4950440_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4950458_4950860_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|4950986_4951718_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|4951897_4954258_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|4954296_4954722_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4954926_4956225_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4956328_4956526_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4956607_4957612_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4957614_4958874_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460353.1|4958959_4960240_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4960316_4960625_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|4960710_4961661_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|4961653_4963501_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|4963510_4964848_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4964866_4965328_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4965299_4966847_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|4966845_4967985_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4967967_4968021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4968879_4969425_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4969519_4970572_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4970668_4971637_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|4971658_4974982_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4975010_4975325_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4975321_4975636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4975687_4977190_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4977408_4978386_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|4978710_4980519_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4980511_4981246_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|4981256_4981652_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4981662_4982022_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|4982084_4983218_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4983306_4983840_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4983836_4984154_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4984335_4984482_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4984592_4984718_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4984769_4985336_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4985377_4986406_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4986434:4986463	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
WP_001008073.1|4986795_4987665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4987868_4988222_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4988359_4990006_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4990049_4990343_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4990618_4991875_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4991890_4992367_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4992703_4994140_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4994257_4995559_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|4995674_4996013_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|4995988_4997686_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4997722_4998298_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|4998677_4999943_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000631719.1|5001604_5001952_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|5004273_5004822_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_085948178.1|5006959_5008173_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254202.1|5008266_5008557_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5011924:5011953	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_CP028118	Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence	78469	16379	58289	78469	transposase	Escherichia_phage(30.0%)	35	NA	NA
WP_000937595.1|16379_17567_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000086162.1|17673_18045_-	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_032271575.1|18120_18426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077629034.1|18429_19332_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921961.1|19604_20564_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_000445936.1|20563_20959_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001172748.1|21918_22308_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_085952195.1|23333_24546_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001369346.1|24512_24722_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	7.8e-06
WP_001034091.1|24866_28832_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_000997720.1|29338_29593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091308.1|29731_30097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|30096_31284_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000859016.1|31487_31727_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001344604.1|31739_32000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130993.1|32702_33560_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365571.1|33552_33627_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083826.1|33861_34119_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766809.1|34358_34946_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001369435.1|34983_35193_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233838.1|35238_35700_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001369432.1|35944_36157_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|36899_37280_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_108988525.1|37674_39213_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.4e-298
WP_001213544.1|40031_41471_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|41474_43595_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217744.1|43644_46641_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|46642_47158_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000091308.1|48267_48633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|48632_49820_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001302199.1|51632_52454_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|52453_53560_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550555.1|53653_55375_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|55448_56447_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000998093.1|56750_58289_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
