The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	317567	334037	5785882	integrase	Enterobacteria_phage(14.29%)	18	308399:308415	330406:330422
308399:308415	attL	GAAATGGTGCAAAACGG	NA	NA	NA	NA
WP_000749860.1|317567_318623_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
WP_001285288.1|318910_320014_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|320025_321279_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_016234638.1|321634_322849_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	8.3e-132
WP_000035054.1|323277_323481_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412538.1|323480_323912_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_032312024.1|323924_324758_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|324750_324933_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_077757964.1|324926_326180_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	1.0e-12
WP_032341460.1|326176_326440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|326436_326658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058740.1|326650_327253_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000628967.1|327263_327605_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208878.1|327597_327969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001719727.1|327955_330712_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	8.9e-299
330406:330422	attR	CCGTTTTGCACCATTTC	NA	NA	NA	NA
WP_032312028.1|331483_331945_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.2e-61
WP_000909176.1|331938_332616_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000246961.1|332615_334037_+	DNA transfer protein	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
>prophage 2
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	620371	727992	5785882	integrase,lysis,terminase,tail,plate,transposase,tRNA,head,protease,capsid	Enterobacteria_phage(34.02%)	137	630532:630578	719466:719512
WP_000912342.1|620371_621757_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|621792_622314_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|622421_622634_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|622635_623502_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|623982_624525_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|624744_625437_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|625467_628077_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|628055_629096_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|629106_629622_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|629624_630257_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
630532:630578	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|630591_631755_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|631610_631982_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|631953_632232_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|632279_632498_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|632596_632878_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|632888_633080_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|633052_633235_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|633231_633912_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|633908_634694_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_109041946.1|634699_634996_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_000206913.1|635071_635362_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|635828_636149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|636284_636548_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|636629_637319_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|637423_637654_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|637723_638263_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|638349_639279_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|639275_639977_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|640181_640529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|641281_641890_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|642189_642606_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|642584_642986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|643109_643211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|643207_643663_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|643662_643833_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|643825_644116_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|644112_644475_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|644471_644612_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|644697_645081_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|645269_646352_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|646940_647156_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|647155_647653_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|647869_648052_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|648142_648436_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|648642_648810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101750776.1|648775_649989_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.3e-166
WP_001427981.1|650106_650301_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|650689_651235_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027297.1|651209_653135_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|653131_653338_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000528251.1|654491_655229_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|655182_655383_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|655497_655962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|656000_656246_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|656281_656464_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|656610_658650_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|658749_659310_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|659532_659736_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|659815_660337_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|660371_661283_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|661282_661843_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|661833_662916_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|662915_663353_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|663345_663960_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|663949_665074_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|665057_666407_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_109041948.1|666393_668469_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|668595_669072_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|669086_669452_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|669460_670963_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|670959_671205_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|671205_671766_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|671762_672182_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002059.1|672178_672553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|672596_673544_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|673543_674668_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|674844_675318_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|675436_676762_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|676745_678335_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|678334_679999_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|679998_680580_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|680582_680873_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|680869_681178_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|681158_681386_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|681395_681614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|681597_682026_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|682060_682561_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|682632_683058_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|683127_683637_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|683633_683930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|683919_684117_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|684109_684442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|684480_684666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|684662_685214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|685217_685733_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|685732_686266_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|686269_686812_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|686909_687440_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|687451_687745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|687749_688022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|688018_688300_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|688301_688556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|688568_688790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129791.1|688792_689725_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
WP_000289290.1|689795_691886_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|691887_692136_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|692326_692857_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000381395.1|694157_695729_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|695748_696096_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|696095_696773_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|696813_697692_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|697701_698034_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|698089_699115_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|699156_699552_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|699563_699938_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|699928_700507_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|700503_700899_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|700906_701647_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_032341613.1|701662_702085_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	9.1e-70
WP_000459457.1|702066_702501_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|702493_705055_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|705051_705381_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|705380_706079_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|706764_707397_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|707457_710871_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|710941_711541_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000268807.1|711605_714566_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_000885569.1|714565_715150_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|715204_715873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|715929_716235_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|716418_717903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|718089_719043_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|719555_720317_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
719466:719512	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|720499_721390_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|721390_724363_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|724349_726587_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|726855_727992_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	947402	1031252	5785882	integrase,lysis,terminase,tail,holin,protease,transposase,head	Enterobacteria_phage(47.69%)	96	945935:945969	1030093:1030127
945935:945969	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000533654.1|947402_948473_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|948450_948669_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|948775_949120_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|949148_949316_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|949388_949673_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|949665_949968_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|949964_950582_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_000034231.1|950583_951141_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|951137_951695_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|951691_951856_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|951866_952160_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|952183_952567_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|952566_953172_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|953428_953581_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|953565_953697_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|953721_954582_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000788880.1|956326_957028_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|957024_957315_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|957611_957968_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|957939_958350_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|958346_958523_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_085947969.1|958765_959979_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001307652.1|960384_960579_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|960766_961384_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092330.1|961533_961971_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
WP_000075132.1|961967_962465_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|962464_962671_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|965281_965440_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|965525_966269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|966453_967143_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|967157_967280_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|967618_968578_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|968789_968978_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|968974_969337_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|969333_969624_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|969623_970346_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|970338_970548_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_085947969.1|970768_971981_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000235451.1|972071_972581_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|972552_974481_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|974464_974671_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001254029.1|976248_976425_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001342326.1|976502_976781_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	98.9	5.6e-44
WP_000612622.1|976902_977250_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|977298_978837_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|978833_979202_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143027.1|979209_979962_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_000479086.1|979975_980407_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000847304.1|983401_983731_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|983730_984429_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001375575.1|984434_985178_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_122993493.1|985123_985756_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_000515142.1|986001_989478_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|989545_990145_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|990209_991424_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|991425_991695_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|991800_992682_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|992905_993733_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|993856_994228_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|994702_996274_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|996293_996641_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|996640_997318_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|997378_997954_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|998154_998535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|998618_998840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|998852_999506_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|1000009_1000486_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|1000544_1001834_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000951213.1|1001920_1002961_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118840.1|1002957_1004112_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246805.1|1004098_1004854_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044868.1|1004846_1005524_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|1006102_1008124_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001295302.1|1008315_1009224_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_001295301.1|1009620_1010610_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084632.1|1010631_1011144_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|1011146_1011632_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598619.1|1011624_1011870_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852287.1|1011871_1012324_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|1012460_1013165_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446932.1|1013369_1014083_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045454.1|1014118_1015075_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650337.1|1015074_1016316_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113363.1|1016312_1017074_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|1017206_1017617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469031.1|1017578_1018685_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070131.1|1018695_1019829_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996091.1|1019821_1021558_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|1021550_1022546_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1022548_1023220_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007094.1|1023448_1024813_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000443534.1|1025043_1026129_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|1026269_1027232_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|1027259_1029410_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|1029529_1030012_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000399685.1|1030271_1031252_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
1030093:1030127	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 4
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1213059	1361239	5785882	integrase,terminase,tail,protease,holin,transposase,head,portal,capsid	Escherichia_phage(35.4%)	169	1264928:1264944	1362991:1363007
WP_000156528.1|1213059_1214820_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877167.1|1215005_1215458_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1215532_1216573_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1216929_1217439_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1217657_1218287_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1218249_1220412_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1220421_1220868_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1220990_1223045_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1223076_1223535_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1223630_1224293_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1224465_1224879_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1224923_1225241_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|1225298_1226489_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1226583_1226862_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1226858_1227188_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_109041951.1|1227278_1227938_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	2.4e-40
WP_001299351.1|1228345_1229365_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1229342_1229585_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048583.1|1229652_1232103_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|1232196_1232388_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1232384_1232573_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1233140_1233350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394543.1|1233350_1233989_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_000380316.1|1234000_1234153_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001303876.1|1234429_1234717_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1234716_1234908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1234935_1235337_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1235445_1235718_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1235701_1236127_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1236333_1236789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205821.1|1236867_1237983_+	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000788742.1|1237989_1238736_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_096954161.1|1238757_1239528_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	7.9e-80
WP_001151233.1|1239543_1239957_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1240308_1241082_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1241447_1241585_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000018421.1|1241629_1241842_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001265141.1|1242288_1243338_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|1243350_1243722_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1243711_1244083_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1244234_1245053_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1245339_1245537_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1245674_1246388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874350.1|1247155_1249006_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1249453_1249660_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1249915_1250188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1250347_1250881_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1251101_1251215_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1251436_1251622_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1252148_1252463_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1252544_1252769_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|1253165_1253711_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1253685_1255611_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1255607_1255814_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|1255810_1257412_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|1257392_1258712_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1258721_1259054_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1259109_1260135_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1260176_1260572_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1260583_1260937_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1260947_1261526_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1261522_1261918_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1261925_1262678_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|1262691_1263114_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533442.1|1263140_1263554_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106875094.1|1263534_1266147_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
1264928:1264944	attL	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
WP_000847298.1|1266143_1266473_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001448659.1|1266472_1267171_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	3.4e-130
WP_064551617.1|1267181_1267925_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.6e-149
WP_122993786.1|1267870_1268503_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_109041953.1|1268748_1272225_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.6	0.0e+00
WP_001216290.1|1272293_1272917_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_001023445.1|1274295_1274565_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|1274689_1275442_-	type III effector	NA	NA	NA	NA	NA
WP_077630526.1|1276245_1276872_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
WP_106875093.1|1276947_1278160_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.1e-168
WP_001232849.1|1278200_1278461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273151.1|1278555_1278798_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048499.1|1278865_1281316_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|1281410_1281599_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1281595_1281784_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|1282184_1282349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|1282352_1282571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|1282663_1282864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|1283277_1283580_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|1283582_1283942_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|1283988_1284381_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|1284507_1284768_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|1284764_1285202_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|1285288_1286299_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|1286210_1286753_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|1286786_1287512_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|1287527_1287920_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|1287916_1288213_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|1288209_1288671_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|1288648_1289005_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|1289055_1289268_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|1289301_1289484_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|1289649_1290285_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|1290372_1290591_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229304.1|1290592_1290958_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.5e-68
WP_000206830.1|1290954_1291299_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|1291503_1291803_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|1291808_1292066_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|1292201_1292474_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|1292475_1293522_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|1293534_1293894_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1293902_1294433_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|1294674_1294872_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|1295006_1295720_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1296169_1296601_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023293.1|1297078_1299016_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143463.1|1299151_1299331_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|1299371_1299617_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1299694_1299910_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|1299914_1300448_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056882.1|1300722_1301292_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000455402.1|1301291_1301441_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|1301668_1301854_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1302379_1302694_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|1302775_1303000_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279807.1|1303041_1303407_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
WP_000958380.1|1303697_1304261_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1304257_1305919_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_044869027.1|1305982_1307920_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063025.1|1307964_1308186_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1310712_1311039_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1311049_1311400_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1311396_1311843_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1311839_1312184_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1312249_1312966_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1312971_1313346_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1313441_1313651_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212984.1|1313698_1316941_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
WP_000807964.1|1316933_1317275_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001448747.1|1317274_1317973_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
WP_001302649.1|1317989_1318310_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1318417_1318591_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001432327.1|1318661_1319585_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001375566.1|1319639_1320377_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_122993786.1|1320322_1320955_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_001230400.1|1324742_1325342_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_001023986.1|1326720_1326990_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_122988840.1|1327100_1327178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273658.1|1328545_1328719_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1328801_1330130_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1330150_1330645_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|1330655_1331246_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001341462.1|1331255_1332056_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|1332063_1332450_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|1332461_1333154_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|1333153_1334245_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|1334532_1335171_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001341463.1|1335210_1339173_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|1339227_1339437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|1339595_1341104_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|1341768_1342599_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|1342656_1343784_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199164.1|1343789_1345061_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_071531009.1|1345544_1346468_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	7.8e-90
WP_001297190.1|1347279_1347735_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|1348360_1349563_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282206.1|1349749_1351567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1352678_1352975_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1353201_1353399_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335696.1|1353617_1355051_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1355871_1356435_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1356589_1358950_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000997978.1|1359706_1361239_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
1362991:1363007	attR	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1530461	1688858	5785882	integrase,terminase,tail,holin,transposase,protease,head,tRNA,capsid	Stx2-converting_phage(30.0%)	189	1640400:1640416	1675598:1675614
WP_001113310.1|1530461_1530929_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074974.1|1531005_1532124_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1532092_1532362_-	excisionase	NA	NA	NA	NA	NA
WP_000048520.1|1532423_1534895_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|1534987_1535179_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1535175_1535364_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000367376.1|1535853_1536006_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|1536281_1536926_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1537023_1537251_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1537247_1537673_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|1537741_1538779_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|1538810_1539233_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450612.1|1539267_1539966_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000702797.1|1539987_1540212_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_085948186.1|1540341_1541498_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000143031.1|1542411_1544262_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411804.1|1544552_1544759_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1545014_1545287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1545446_1545980_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1546626_1546833_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1546897_1547122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1547478_1547619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|1547748_1547934_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_001365481.1|1547975_1548341_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958402.1|1548630_1549194_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1549190_1550852_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1550915_1552853_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1552897_1553119_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1555644_1555971_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1555981_1556332_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1556328_1556775_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_071587642.1|1556842_1557115_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
WP_001275459.1|1557180_1557897_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1557902_1558277_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1558372_1558582_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1558629_1561872_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1561864_1562206_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1562205_1562904_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|1562914_1563658_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1563603_1564236_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_109041956.1|1564481_1567955_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.9	0.0e+00
WP_001230532.1|1568021_1568621_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_000279108.1|1568685_1569999_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
WP_001339397.1|1570054_1570732_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1570731_1571079_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1571098_1572670_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001023483.1|1572707_1572977_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938122.1|1573431_1574793_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_095585410.1|1575169_1575322_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058323.1|1575917_1577036_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1577032_1578826_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1578844_1579552_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1579548_1580136_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063971.1|1580132_1580531_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1580527_1581385_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_071999646.1|1581567_1583064_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460810.1|1583075_1584212_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1584224_1584317_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001300464.1|1584396_1585695_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|1585809_1587990_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1588009_1588456_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1588443_1589583_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|1589628_1591725_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1591724_1592471_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1592467_1593112_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1593218_1593524_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1593965_1594178_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1594463_1594676_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1594686_1594875_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1594849_1595080_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1595069_1595243_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|1595290_1596364_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|1596435_1599180_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|1599262_1600291_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1600263_1600956_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1601085_1602258_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|1602257_1604804_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|1604800_1605400_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|1605492_1605798_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|1605797_1606718_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000097601.1|1606977_1608237_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044313.1|1608528_1609770_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|1609807_1610035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607021.1|1610055_1610634_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013656.1|1610630_1611941_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_001208773.1|1611993_1612278_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497812.1|1612323_1612575_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1612562_1612796_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994787.1|1612939_1613302_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
WP_042357761.1|1613337_1613553_-	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000628762.1|1613485_1614397_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_085948186.1|1614878_1616034_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000224734.1|1616177_1616375_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000206782.1|1616380_1616839_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_001014298.1|1616841_1617033_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_032345989.1|1617034_1617412_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	92.6	1.9e-63
WP_000812200.1|1617408_1618038_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_001214439.1|1618034_1618199_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_001111290.1|1618209_1618506_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_000073098.1|1618529_1619117_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_000536228.1|1619113_1619794_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|1619802_1619991_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1619987_1620101_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198866.1|1620093_1620234_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000167595.1|1620427_1620898_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1620956_1621340_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000687675.1|1621847_1622252_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1622248_1622905_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1622901_1623189_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1623325_1624030_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1624143_1624377_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438542.1|1624515_1624812_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1624844_1625783_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788927.1|1625779_1626481_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000145907.1|1626477_1626768_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1626838_1627117_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1627249_1627465_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1627475_1627712_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1627668_1628115_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1628111_1628639_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1628635_1628818_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1629092_1629827_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1629901_1630624_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1630623_1631229_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1631225_1631420_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1631412_1631847_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1632353_1633301_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1633310_1633580_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|1634079_1636017_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|1636152_1636332_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|1636372_1636645_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|1636721_1636937_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|1636941_1637286_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|1637336_1637870_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|1638140_1638710_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1638709_1638856_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1639083_1639269_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1639693_1639921_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1639962_1640328_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
1640400:1640416	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958402.1|1640615_1641179_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1641175_1642837_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1642900_1644838_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1644882_1645104_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1647626_1647953_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1647963_1648314_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1648310_1648757_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_071587642.1|1648824_1649097_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
WP_001030060.1|1649883_1650258_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1650353_1650563_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1650610_1653853_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1653845_1654187_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1654186_1654885_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001090046.1|1655634_1656216_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.6	6.8e-92
WP_001216290.1|1660005_1660629_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279008.1|1660692_1662015_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
WP_001023435.1|1662016_1662286_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|1662399_1662975_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|1663265_1663847_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1663914_1664550_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1664677_1665736_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1665810_1666461_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|1666643_1667234_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|1667507_1668371_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1668354_1669491_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1669740_1670970_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1671115_1672237_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085258.1|1672485_1673715_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|1674080_1674269_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|1674326_1675355_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_096957805.1|1675344_1675602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1675574_1675808_+	hypothetical protein	NA	NA	NA	NA	NA
1675598:1675614	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204981.1|1675800_1676034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|1676039_1676339_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833619.1|1676335_1677736_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|1677936_1678188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1678184_1678595_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1678605_1678878_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1679004_1679229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1679480_1679687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1679686_1680742_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1680754_1681090_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1681102_1681516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|1681721_1682264_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|1682518_1682800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1683401_1684862_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1684861_1685533_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1685700_1687071_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1687074_1687716_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1687751_1688858_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1801530	1814934	5785882	tail,holin,transposase	Escherichia_phage(38.46%)	16	NA	NA
WP_157825328.1|1801530_1802073_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|1802836_1803001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1803699_1804458_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1804736_1804949_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1805169_1805427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1805496_1805775_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|1805776_1806832_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|1806832_1807198_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1807194_1807884_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|1809408_1811262_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|1811411_1811627_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1811631_1811976_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|1812026_1812560_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056807.1|1812830_1813349_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
WP_085948186.1|1813405_1814561_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001023357.1|1814664_1814934_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
>prophage 7
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1917884	1974070	5785882	integrase,lysis,terminase,tail,holin,transposase,tRNA,head,portal,capsid	Escherichia_phage(43.28%)	69	1917518:1917533	1933005:1933020
1917518:1917533	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|1917884_1919117_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1919371_1920355_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1920832_1922206_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1922334_1923270_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|1923321_1924557_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1924558_1924774_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1924873_1925062_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1925099_1925249_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1925304_1926114_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105151.1|1926106_1928707_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
WP_000632297.1|1928808_1929084_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1929158_1929329_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1929328_1929550_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|1929970_1930123_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|1930421_1930841_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1930920_1931175_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1931171_1931594_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001432368.1|1931657_1932137_+	YdaU family protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
WP_085947969.1|1932139_1933353_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
1933005:1933020	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000788968.1|1933783_1934530_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450672.1|1934552_1935314_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_001151124.1|1935329_1935752_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1935748_1936045_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1936041_1936503_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1936480_1936837_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1936887_1937100_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1937185_1937350_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1937351_1937615_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1937625_1938495_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1938610_1938715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1938904_1939117_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|1939284_1939563_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265080.1|1939564_1940614_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|1940626_1941001_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|1940997_1941819_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|1942989_1944840_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1945287_1945494_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|1945493_1945991_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1945987_1946425_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1946574_1947192_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1947379_1947574_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1947962_1948508_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1948482_1950408_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1950404_1950611_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_109041959.1|1950603_1952208_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.0	2.0e-303
WP_000123251.1|1952188_1953508_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1953517_1953850_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1953905_1954931_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1954972_1955368_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1955379_1955733_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_032358209.1|1955744_1956323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.3e-79
WP_000683137.1|1956319_1956715_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1956722_1957475_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479086.1|1957488_1957920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1957946_1958360_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_109041961.1|1958340_1960980_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|1960915_1961245_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|1961244_1961943_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001375575.1|1961948_1962692_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_122993493.1|1962637_1963270_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_106875083.1|1963515_1966992_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001233130.1|1967059_1967659_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_000279018.1|1967723_1969037_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023379.1|1969038_1969308_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1969420_1969996_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1970068_1970698_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1970779_1971421_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1972361_1972796_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837943.1|1972936_1974070_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 8
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2176990	2276478	5785882	integrase,lysis,terminase,tail,holin,transposase,protease,head,portal,capsid	Enterobacteria_phage(44.09%)	121	2223663:2223682	2273542:2273561
WP_001023433.1|2176990_2177260_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000279009.1|2177261_2178575_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001456919.1|2178639_2179263_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_000515131.1|2179331_2182808_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_133253573.1|2183053_2183686_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_000194802.1|2183631_2184375_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001357740.1|2184385_2185084_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2185083_2185413_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2188001_2188415_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2188441_2188864_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235099.1|2188877_2189630_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000683063.1|2189637_2190033_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2190029_2190563_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000752969.1|2190577_2190931_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000158901.1|2190942_2191338_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000063258.1|2191379_2192405_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|2192460_2192793_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2192802_2194122_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2194102_2195704_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2195700_2195907_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2195903_2197829_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2197803_2198349_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001431375.1|2198735_2198960_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_001303878.1|2199041_2199356_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2199883_2200069_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992045.1|2200620_2201154_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001041949.1|2201665_2202457_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000411809.1|2202460_2202667_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_032325211.1|2203114_2204965_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_001299632.1|2205443_2205875_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|2206064_2206274_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|2206326_2206551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|2207395_2208148_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|2208161_2209211_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|2209212_2209482_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|2209535_2209763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2209986_2210358_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2210350_2210668_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2210770_2210983_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|2211197_2211749_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|2212100_2212286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|2212345_2213107_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|2213136_2213877_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|2213883_2214849_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|2214829_2215351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|2215334_2215565_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|2215648_2216056_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380321.1|2216222_2216375_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000394548.1|2216386_2217025_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2217025_2217235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2217799_2217988_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2217984_2218173_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102117.1|2218265_2220728_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_001368608.1|2220815_2221052_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_085948186.1|2221488_2222644_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
2223663:2223682	attL	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_120795384.1|2224282_2224396_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2224464_2224698_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2225014_2225605_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2225702_2226278_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_085948186.1|2226338_2227495_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_100005742.1|2227556_2230505_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.0	2.9e-53
WP_001233114.1|2230569_2231169_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_000515505.1|2231239_2234653_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000741589.1|2234713_2235361_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140707.1|2235258_2236002_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152371.1|2236006_2236705_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000447251.1|2236714_2237044_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000372024.1|2237043_2240109_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2240080_2240410_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2240418_2240805_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2240865_2241609_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2241619_2242021_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677128.1|2242017_2242596_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001283148.1|2242607_2242883_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097041.1|2242875_2243199_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|2243285_2245313_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985929.1|2245257_2246766_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|2246765_2246978_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|2246974_2249074_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421825.1|2249082_2249622_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031435.1|2250182_2250389_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000035577.1|2250689_2251100_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|2251251_2251425_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2251596_2251752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2251831_2251897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2251899_2252088_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2252098_2252311_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2252673_2253171_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2253167_2253701_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|2253697_2254009_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2254013_2254229_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066483.1|2254982_2255198_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000087756.1|2255498_2255711_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2255765_2255855_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047133.1|2256132_2256885_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265198.1|2256898_2257948_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2257949_2258228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2258294_2258546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2258762_2258918_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2258989_2259277_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2259276_2259516_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2259540_2259846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|2260048_2260381_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|2260817_2262158_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|2262191_2262611_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054507.1|2262651_2263617_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_000705349.1|2263597_2264119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2264102_2264330_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2264407_2264815_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2265007_2265163_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000347171.1|2265164_2265740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2266226_2266415_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|2266411_2266603_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_106875080.1|2266696_2269168_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000624622.1|2270953_2271301_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2271300_2271978_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000877011.1|2272232_2273513_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001360138.1|2273532_2273643_-	hypothetical protein	NA	NA	NA	NA	NA
2273542:2273561	attR	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_000836079.1|2273700_2274720_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2274731_2275946_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2276151_2276478_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 9
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2292763	2309547	5785882	integrase,terminase,protease,head,portal,capsid	uncultured_Caudovirales_phage(90.91%)	24	2298388:2298403	2320727:2320742
WP_001260840.1|2292763_2293585_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|2293623_2293953_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|2293939_2294305_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|2294411_2294582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|2295618_2295900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|2295913_2297575_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|2297558_2297915_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|2298204_2298645_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
2298388:2298403	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|2298644_2298941_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|2298937_2299276_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|2299272_2300448_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|2300485_2301058_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|2301097_2302255_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|2302546_2302771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|2302896_2303169_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|2303179_2303590_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|2303586_2303832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032341440.1|2304119_2305937_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	4.4e-129
WP_001261488.1|2305933_2306233_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113156.1|2306239_2306560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|2306552_2306843_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|2306775_2307702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|2307754_2307943_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|2308317_2309547_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
2320727:2320742	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 10
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2505981	2603166	5785882	integrase,lysis,terminase,tail,protease,transposase,tRNA,head,capsid	Escherichia_phage(31.34%)	111	2545482:2545496	2604613:2604627
WP_000826412.1|2505981_2507190_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_000604932.1|2507197_2507629_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|2507644_2507833_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|2507836_2508196_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|2508368_2509007_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|2509133_2510057_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|2510159_2511245_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|2511495_2513106_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|2513137_2514262_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|2514317_2515283_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|2515336_2516452_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|2516533_2518219_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2518423_2519005_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|2519044_2519740_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2519797_2521708_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2521839_2522184_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2522546_2522906_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2523025_2523205_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2523278_2524640_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|2524643_2525222_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|2525405_2526770_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|2526900_2528499_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394973.1|2528502_2530053_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|2530515_2531487_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2531549_2532350_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2532362_2533214_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|2533268_2533727_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2534155_2534722_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|2534718_2535528_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2535693_2535903_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2535915_2536059_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|2536727_2537015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2537089_2537233_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|2537391_2537631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|2537773_2538565_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|2538741_2540115_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2540160_2541042_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001431407.1|2541233_2543282_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000431370.1|2543301_2544000_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2544096_2544594_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|2544723_2546007_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
2545482:2545496	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|2545975_2548609_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|2548688_2550128_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2550245_2550482_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2550586_2550778_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2550778_2551435_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|2552389_2553040_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|2553264_2554140_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|2554280_2554550_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268926.1|2554551_2555865_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|2555929_2556529_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000099148.1|2556584_2558123_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612626.1|2558171_2558519_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|2558515_2558920_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_064551593.1|2559058_2562454_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.5	0.0e+00
WP_050439450.1|2562796_2563429_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_053892383.1|2563374_2564118_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	1.7e-148
WP_032363306.1|2564128_2564827_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000847298.1|2564826_2565156_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081762.1|2565152_2567765_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000533440.1|2567745_2568159_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2568185_2568608_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2568621_2569374_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683137.1|2569381_2569777_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|2569773_2570352_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|2570363_2570717_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|2570728_2571124_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|2571165_2572191_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|2572246_2572579_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|2572588_2573908_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_000198153.1|2575485_2575692_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|2575688_2577614_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|2577588_2578134_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|2578522_2578717_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2578904_2579522_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2579671_2580109_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2580105_2580603_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_032160906.1|2580602_2580782_-	hypothetical protein	NA	A0A0P0ZC45	Stx2-converting_phage	100.0	2.7e-23
WP_000143049.1|2581254_2583105_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|2584274_2585096_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|2585092_2585467_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|2585479_2586529_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2586530_2586803_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2586924_2587269_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2587388_2587601_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2587834_2588392_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2588393_2588612_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2588739_2589051_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2589043_2589271_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2589267_2589549_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|2589581_2590343_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|2591116_2592079_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|2592101_2592527_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2592523_2592826_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|2592923_2593295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2593315_2593507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001448501.1|2593508_2593787_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|2594073_2594226_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|2594646_2594868_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|2594867_2595038_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|2595111_2595387_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|2595485_2598137_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|2598129_2598939_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|2598995_2599190_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2599182_2599371_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|2599477_2599759_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189092.1|2599724_2600840_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	9.4e-98
WP_000976492.1|2601192_2601534_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2601546_2602419_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2602422_2602797_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2602935_2603166_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2604613:2604627	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 11
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2649439	2723362	5785882	integrase,terminase,tail,holin,tRNA,plate,head,portal,capsid	Enterobacteria_phage(75.56%)	82	2686974:2687033	2724305:2724425
WP_000564746.1|2649439_2650411_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176770.1|2650575_2653005_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2653029_2654130_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2654517_2655264_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2655277_2655844_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|2656059_2657793_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|2657969_2658458_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|2658577_2658970_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|2658969_2661048_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|2661040_2662189_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2662390_2663035_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2663045_2663435_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|2663449_2664499_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2664501_2665362_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|2665380_2666985_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|2667030_2668692_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2668836_2669340_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|2669360_2671325_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2671329_2672256_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|2672252_2673140_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2673266_2673845_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2673847_2674198_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|2674977_2675406_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2675412_2676837_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|2676811_2677612_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2677778_2678765_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|2678779_2680294_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2680363_2681353_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2682149_2682653_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|2682731_2682983_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2683097_2683184_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|2683446_2683770_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|2683940_2684438_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2684475_2684715_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|2684905_2686117_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|2686178_2686844_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2686974:2687033	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|2687200_2688202_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|2688207_2688555_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|2688584_2689235_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2689250_2689655_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2689744_2689882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2689953_2690157_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|2690178_2690529_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|2690539_2690818_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|2690829_2691072_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021647.1|2691068_2691182_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000985152.1|2691268_2691472_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|2691795_2692185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|2692181_2695022_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|2695098_2696058_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2696062_2696374_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|2696437_2697028_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|2697517_2698564_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|2698563_2700315_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|2700469_2701306_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|2701329_2702382_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|2702427_2703228_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|2703329_2703824_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|2703823_2704024_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|2704026_2704350_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|2704346_2704739_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|2704735_2705143_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202151.1|2705281_2707159_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|2707182_2707650_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|2707642_2708278_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271909.1|2708274_2708856_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|2708852_2709203_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|2709206_2710103_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|2710095_2710626_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|2710628_2712761_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|2712760_2713339_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|2713382_2713955_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|2714111_2714600_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853455.1|2714612_2717420_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000763327.1|2717406_2717535_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2717570_2717936_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2717990_2718503_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|2718502_2719687_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|2719844_2720945_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|2721344_2722484_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2722770_2723031_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|2723221_2723362_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
2724305:2724425	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 12
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2883299	2889601	5785882		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100797.1|2883299_2883842_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
WP_000857547.1|2883846_2884725_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001023633.1|2884782_2885682_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000699427.1|2885681_2886767_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_000183038.1|2887138_2888032_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116073.1|2888206_2889601_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 13
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2981043	2990971	5785882	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|2981043_2982180_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|2982176_2984177_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|2984508_2984889_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2984885_2985233_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|2985282_2986668_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|2987099_2987570_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|2987616_2988336_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2988332_2990018_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2990239_2990971_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 14
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3063065	3165221	5785882	integrase,lysis,terminase,tail,protease,transposase,holin,head,portal	Enterobacteria_phage(37.5%)	117	3100215:3100233	3174437:3174455
WP_000101718.1|3063065_3064307_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_001171357.1|3064405_3064636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387479.1|3064803_3065010_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|3065693_3066254_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001342316.1|3066243_3066486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|3066458_3066680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|3066681_3066915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3066920_3067220_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|3067216_3068617_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|3068818_3069064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|3069194_3069389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|3069392_3069554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|3069681_3070170_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|3070332_3071256_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|3074634_3075282_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|3075316_3076369_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|3076365_3076923_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|3076919_3078863_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|3078859_3079339_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|3079335_3079545_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|3079541_3080279_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|3080320_3080983_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|3080979_3081597_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|3081615_3082218_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|3082227_3082677_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|3082673_3083537_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|3083523_3084219_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|3084225_3086712_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|3086708_3086972_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|3086961_3087456_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|3087864_3088353_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|3088501_3090148_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|3090365_3092009_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|3092084_3092735_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|3092734_3093799_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|3093872_3094928_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|3095039_3096131_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|3096869_3099542_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|3099558_3100209_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3100215:3100233	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876007.1|3100294_3103144_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001225855.1|3103418_3104195_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|3104199_3105849_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|3105849_3110244_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|3111045_3112368_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|3113061_3113709_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023380.1|3113918_3114188_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001228241.1|3115566_3116166_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|3116233_3116449_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|3116511_3118050_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3118098_3118446_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839165.1|3118442_3118847_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_001375477.1|3118875_3122175_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000090884.1|3122235_3122868_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_012817801.1|3122804_3123548_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_001152619.1|3123553_3124252_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|3124251_3124581_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_100037251.1|3124577_3127139_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000533403.1|3127119_3127533_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|3127559_3127991_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|3128004_3128757_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|3128764_3129160_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|3129156_3129732_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3129746_3130100_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3130092_3130467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|3130518_3131403_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|3131460_3131808_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|3131844_3133350_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000827572.1|3133339_3134932_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000258991.1|3134928_3135135_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001238637.1|3135118_3135325_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_024262528.1|3135337_3137047_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
WP_000235436.1|3137018_3137528_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|3137922_3138117_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|3138476_3138770_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3138860_3139043_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|3139259_3139757_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|3139756_3139972_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3140114_3140513_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3140593_3140752_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3140837_3141581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|3141833_3142457_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|3142453_3143119_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|3143115_3143718_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|3143692_3144259_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|3144758_3146594_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|3147097_3147280_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|3147276_3147804_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|3147800_3148247_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|3148254_3148461_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|3148533_3148824_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|3148820_3149522_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|3149518_3150457_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|3150489_3150786_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|3150895_3151081_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3151161_3151812_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3152126_3152432_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3152434_3152773_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3152906_3153377_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|3153526_3153895_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|3153967_3154132_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|3154100_3154265_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|3154319_3154616_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3154621_3155407_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3155403_3156081_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3156080_3156263_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3156235_3156427_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3156437_3156719_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|3156817_3157039_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|3157035_3157641_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|3157637_3157988_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|3158062_3158305_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|3158423_3158768_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|3158873_3159092_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|3159069_3160140_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|3160154_3160760_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|3160756_3162445_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|3162593_3165221_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3174437:3174455	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 15
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3253895	3389570	5785882	integrase,lysis,terminase,tail,holin,tRNA,transposase,head,portal,bacteriocin,capsid	Escherichia_phage(41.48%)	165	3331309:3331325	3363247:3363263
WP_001283577.1|3253895_3254708_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3254707_3255721_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|3255786_3256923_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|3257021_3258017_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|3258013_3259192_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3259475_3260696_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683823.1|3260854_3262861_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3262981_3263260_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|3263293_3263842_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|3263841_3264651_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|3264650_3265475_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3265478_3266564_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_096954153.1|3266598_3267531_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3267696_3268248_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|3268320_3269172_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|3269173_3269713_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|3269709_3270198_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|3270194_3270704_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482751.1|3270719_3271472_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001375769.1|3271491_3274137_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|3274218_3274782_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3275465_3275951_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|3276153_3278298_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3278297_3279608_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|3279787_3280072_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3280443_3281784_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|3282148_3283207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3283388_3284144_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3284437_3285370_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331701.1|3285591_3293946_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.9	0.0e+00
WP_000012437.1|3294015_3295281_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|3295291_3295543_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|3295553_3296000_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|3296002_3296656_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|3296749_3297151_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|3297207_3297348_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|3297580_3298318_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|3298397_3299015_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|3299020_3299299_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|3299313_3300582_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001146321.1|3300578_3302204_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_001303606.1|3302498_3302687_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001023407.1|3302825_3303095_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_012816803.1|3303096_3305034_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_000207922.1|3305030_3305681_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|3305680_3306244_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001371266.1|3306227_3306689_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_100013453.1|3306738_3307128_-	hypothetical protein	NA	V5UT93	Shigella_phage	99.2	2.9e-62
WP_000214474.1|3307182_3308397_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345011.1|3308420_3309428_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000787035.1|3309585_3311730_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_024231339.1|3311729_3313436_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_001086067.1|3313416_3314211_-	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
WP_001108577.1|3314503_3315055_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|3315293_3315479_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|3315706_3315853_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3315852_3316422_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3316692_3317226_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3317230_3317446_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3317523_3317769_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3317809_3317989_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874485.1|3318125_3320063_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000738068.1|3320560_3320830_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3320841_3321801_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204859.1|3322584_3323019_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3323011_3323206_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3323202_3323766_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3323773_3324223_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|3324222_3325194_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|3325183_3326704_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|3326697_3327075_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|3327241_3327436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|3327606_3327810_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|3327905_3328619_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|3328713_3330183_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|3330179_3331133_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
3331309:3331325	attL	TCAAGCCAGAAACATCG	NA	NA	NA	NA
WP_016051777.1|3331749_3332535_+	regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001369605.1|3332790_3333465_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000917252.1|3333535_3333748_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|3333759_3334041_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|3334061_3334343_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_106910114.1|3334359_3335310_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	98.1	9.5e-176
WP_000187063.1|3335306_3335996_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344636.1|3335995_3336583_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_001071603.1|3336657_3337005_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3337068_3337890_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_032344414.1|3337966_3338410_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
WP_001345192.1|3338517_3339396_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.7	3.8e-179
WP_032344415.1|3339589_3339829_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	8.0e-39
WP_032344417.1|3339825_3340527_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	99.6	3.9e-134
WP_001447495.1|3340531_3340720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888384.1|3340757_3341027_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	89.4	2.5e-25
WP_000212746.1|3341028_3341316_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_032344418.1|3341319_3341943_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.6	3.6e-115
WP_032344420.1|3342038_3342767_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
WP_000203834.1|3343090_3343729_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_044164933.1|3343784_3344216_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
WP_000163444.1|3344212_3344839_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291843.1|3344798_3345011_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994797.1|3345046_3345445_+	DUF1627 domain-containing protein	NA	G3CFH0	Escherichia_phage	99.2	4.7e-52
WP_021351637.1|3345588_3345822_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|3345809_3346061_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_024174014.1|3346121_3346304_+	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_032274263.1|3346287_3347457_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
WP_000958687.1|3347888_3349046_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000440209.1|3349290_3350433_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_001280420.1|3350503_3352627_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000287055.1|3352748_3353015_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_000749284.1|3353085_3353571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868968.1|3353585_3355430_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000246938.1|3355429_3356836_-	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000964882.1|3356845_3357538_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614047.1|3357540_3357996_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000785546.1|3357995_3358844_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_001122374.1|3358843_3360262_-	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000246750.1|3360270_3360753_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|3360727_3360913_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_001133481.1|3360955_3362227_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000426731.1|3362238_3363123_-	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_000852339.1|3363136_3365263_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
3363247:3363263	attR	CGATGTTTCTGGCTTGA	NA	NA	NA	NA
WP_000200776.1|3365265_3366678_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000179910.1|3366674_3367100_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000807788.1|3367179_3367422_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999682.1|3367525_3367897_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_001016387.1|3368180_3368699_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000092296.1|3368904_3369342_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229392.1|3369338_3369815_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|3369798_3370122_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3371194_3371818_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_001271146.1|3371814_3372480_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_000144614.1|3372457_3372664_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001107956.1|3372660_3373266_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_072189684.1|3373258_3373468_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_000924601.1|3373427_3373829_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3373831_3374008_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|3374004_3374415_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|3374386_3374743_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000103674.1|3375208_3375424_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_001248395.1|3375510_3376887_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000539347.1|3376883_3377705_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001375758.1|3377888_3378167_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_001054987.1|3378276_3378501_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092874.1|3378645_3379320_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_000394868.1|3379360_3379657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|3380090_3380363_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_001430488.1|3380365_3380728_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_000382838.1|3380758_3381253_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_000167585.1|3381453_3381924_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000776959.1|3382067_3382379_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000972063.1|3382454_3382589_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3382573_3382726_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_085948186.1|3382778_3383935_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_064551585.1|3383950_3384160_+	hypothetical protein	NA	K7PH22	Enterobacteria_phage	100.0	2.8e-24
WP_000031004.1|3384249_3384855_+	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_000951323.1|3384854_3385238_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111303.1|3385261_3385555_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000812180.1|3385726_3386314_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_000052365.1|3386310_3386979_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000060377.1|3386980_3387169_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_001375782.1|3387172_3387790_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000156090.1|3387786_3388374_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_000376716.1|3388373_3388652_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|3388809_3389109_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|3389144_3389312_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001163428.1|3389369_3389570_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 16
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3525957	3604187	5785882	integrase,terminase,tail,holin,protease,tRNA	Escherichia_phage(43.4%)	81	3563828:3563844	3601073:3601089
WP_000829332.1|3525957_3527973_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_001267508.1|3527987_3528851_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000911330.1|3528997_3529396_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450524.1|3529395_3529623_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_001295467.1|3529776_3530490_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001297320.1|3530702_3531737_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001311023.1|3531753_3532632_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000176187.1|3532777_3533350_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001068682.1|3533349_3533820_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_001299064.1|3534072_3534690_+	hydrogenase 4 subunit HyfA	NA	NA	NA	NA	NA
WP_000339460.1|3534689_3536708_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_001317255.1|3536718_3537666_+	hydrogenase 4 subunit HyfC	NA	NA	NA	NA	NA
WP_000429108.1|3537682_3539122_+	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
WP_000147987.1|3539133_3539784_+	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_000122537.1|3539788_3541369_+	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_001102289.1|3541358_3543026_+	hydrogenase 4 catalytic subunit HyfG	NA	NA	NA	NA	NA
WP_000916065.1|3543035_3543581_+	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_000133936.1|3544327_3544741_+	hydrogenase 4 assembly chaperone HyfJ	NA	NA	NA	NA	NA
WP_001251579.1|3544770_3546783_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_001244723.1|3546804_3547653_+	formate transporter	NA	NA	NA	NA	NA
WP_000892044.1|3547690_3548752_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000489667.1|3548964_3550428_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166449.1|3550448_3550808_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|3550945_3551692_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198328.1|3551741_3553031_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3553116_3553743_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001341612.1|3554067_3555105_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|3555104_3555743_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_032341451.1|3555913_3557980_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121363.1|3557984_3559526_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000772775.1|3559564_3561808_-	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001344399.1|3562177_3562351_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|3562664_3563180_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755172.1|3563195_3563735_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
3563828:3563844	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001341613.1|3563954_3564437_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
WP_000403808.1|3564433_3565063_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
WP_000207023.1|3565052_3565361_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
WP_001275997.1|3565357_3565750_-	membrane protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
WP_000902802.1|3565898_3566261_+	GtrA family protein	NA	I1TED9	Salmonella_phage	80.8	2.2e-48
WP_064551513.1|3566397_3569019_-|tail	phage tail protein	tail	A0A193GYU1	Enterobacter_phage	70.1	4.3e-125
WP_001188253.1|3569214_3569472_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
WP_001147904.1|3569503_3569800_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_001248457.1|3569995_3572470_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
WP_000119864.1|3572475_3574278_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_001145658.1|3574274_3576788_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.8	0.0e+00
WP_000332878.1|3576787_3577333_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_000567631.1|3577332_3577797_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_001018556.1|3577796_3580268_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
WP_000179256.1|3580267_3580873_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	98.5	4.0e-111
WP_000424489.1|3580872_3581196_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_000012377.1|3581246_3581582_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627084.1|3581592_3582030_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	96.6	7.7e-72
WP_000268715.1|3582081_3583068_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_001048086.1|3583082_3583778_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
WP_000133160.1|3583780_3584077_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_032346017.1|3584073_3585753_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.4e-301
WP_000335899.1|3585767_3585974_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000999681.1|3586676_3587048_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	4.5e-57
WP_000132540.1|3587138_3588614_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.4	1.3e-296
WP_001090120.1|3588610_3589285_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_001129693.1|3589325_3589664_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
WP_000002095.1|3589656_3589938_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	92.5	1.0e-45
WP_109041972.1|3589930_3590797_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	57.9	2.9e-70
WP_100037244.1|3590798_3591260_-	ead/Ea22-like family protein	NA	A0A0P0ZFW8	Escherichia_phage	76.5	7.4e-57
WP_000445440.1|3591223_3591856_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	68.0	1.9e-63
WP_001231254.1|3591917_3592262_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_001432051.1|3592379_3593165_-	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.5	6.7e-151
WP_000086414.1|3593161_3593977_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402893.1|3593992_3594193_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|3594343_3594574_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3594728_3595313_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001102252.1|3595621_3595921_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
WP_032345905.1|3595917_3596739_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	96.7	1.8e-159
WP_000063818.1|3596735_3597617_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
WP_000675390.1|3597666_3597915_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001364206.1|3598072_3598324_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	4.4e-40
WP_000163457.1|3598316_3598967_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	2.5e-127
WP_001055436.1|3598963_3599623_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
WP_000954565.1|3599625_3600882_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.3	1.7e-236
WP_000138282.1|3601074_3602652_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3601073:3601089	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|3602720_3604187_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 17
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3681676	3786998	5785882	integrase,terminase,tail,holin,tRNA,head,capsid	Stx2-converting_phage(35.29%)	105	3750647:3750661	3793034:3793048
WP_001298974.1|3681676_3682414_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3682545_3683880_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|3684088_3684970_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3685072_3685660_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3685715_3686099_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3686403_3687093_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3687140_3688178_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3688384_3688804_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3688872_3689571_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3689602_3692263_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3692376_3693732_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3693777_3694101_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3694097_3695396_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3701249_3703823_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3703952_3704684_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|3704680_3705661_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3705795_3706533_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3706803_3707145_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3707248_3707296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3707394_3708555_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3708597_3709719_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3709729_3710800_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3711009_3711375_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3711524_3712043_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|3712032_3713259_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3713274_3713757_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3713833_3714181_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3714222_3714990_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3715020_3715569_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3715587_3715836_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3716084_3717446_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3717612_3718404_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3718424_3719711_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3719765_3720359_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3720481_3721360_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3721445_3723107_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3723255_3723597_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3723658_3723949_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3723938_3724415_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3724546_3725029_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938110.1|3726783_3728145_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|3728521_3731923_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|3732515_3734864_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3734883_3734973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|3735079_3735349_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|3735350_3736664_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001427270.1|3736728_3737328_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000514836.1|3737395_3740869_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_122996338.1|3741107_3741740_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_000194787.1|3741685_3742429_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001341641.1|3742439_3743138_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|3743137_3743479_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_000212961.1|3743471_3746714_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
WP_001513217.1|3746761_3746971_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030067.1|3747066_3747441_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|3747446_3748163_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|3748228_3748573_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3748569_3749016_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3749012_3749363_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3749373_3749700_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
3750647:3750661	attL	TCACCGCCTGCTGCA	NA	NA	NA	NA
WP_001063025.1|3752226_3752448_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|3752492_3754430_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001341975.1|3754493_3756155_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000958402.1|3756151_3756715_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001365481.1|3757005_3757371_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000095736.1|3757412_3757640_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|3758008_3758233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|3758318_3758504_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|3759022_3759556_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|3759606_3759951_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|3759955_3760171_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|3760247_3760520_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|3760560_3760740_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_106875073.1|3760875_3762813_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000868396.1|3763932_3764859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131907.1|3764845_3765394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|3765406_3765748_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001427606.1|3765765_3766755_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001061413.1|3766762_3767560_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767136.1|3767579_3767969_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210170.1|3767965_3768292_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001341555.1|3768288_3768942_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001447903.1|3768941_3769436_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_000061518.1|3769432_3770251_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_000620696.1|3770247_3770472_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087342.1|3770468_3771620_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000521508.1|3771616_3772168_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|3772211_3772412_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3772502_3773177_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3773843_3774206_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|3774271_3775096_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|3775224_3775761_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|3775751_3776630_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|3776626_3776830_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|3776822_3777062_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|3777058_3777388_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|3777389_3778253_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|3778337_3778580_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|3778583_3778730_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|3778902_3780078_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|3780560_3781469_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001448712.1|3781767_3783003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.5	6.5e-233
WP_000448925.1|3783041_3783458_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|3783529_3785278_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|3785279_3786998_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
3793034:3793048	attR	TGCAGCAGGCGGTGA	NA	NA	NA	NA
>prophage 18
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3859789	3866929	5785882		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3859789_3862351_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3862456_3863113_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3863163_3863931_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3864126_3865035_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3865031_3866294_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3866290_3866929_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 19
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	4946579	4959912	5785882	integrase,transposase	Enterobacteria_phage(66.67%)	15	4946397:4946419	4960397:4960419
4946397:4946419	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|4946579_4947749_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4947768_4949628_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4949624_4950050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|4950377_4950950_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|4951023_4951524_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|4951520_4952255_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|4952806_4953073_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|4953069_4953669_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|4953661_4953949_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|4953941_4954397_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|4954472_4956044_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4956063_4956411_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4956410_4957088_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|4957243_4957564_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|4957578_4959912_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
4960397:4960419	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 20
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	5496003	5543926	5785882	integrase,protease,transposase,tRNA	Vibrio_phage(20.0%)	45	5476974:5476988	5503320:5503334
5476974:5476988	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|5496003_5497623_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|5497619_5499191_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|5499307_5500573_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|5500952_5501528_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|5501564_5503262_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|5503237_5503576_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
5503320:5503334	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|5503691_5504993_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_109041991.1|5505110_5506547_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|5506883_5507360_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|5507375_5508632_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|5508907_5509201_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|5509244_5510891_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|5511028_5511382_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|5511634_5512615_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|5512863_5513733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|5514122_5515151_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|5515192_5515759_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|5515810_5515936_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|5516046_5516193_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|5516374_5516692_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|5516688_5517222_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|5517310_5518444_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|5518506_5518866_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|5518876_5519272_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|5519282_5520017_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192991.1|5520009_5521818_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|5522142_5523120_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|5523338_5524841_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|5524892_5525207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|5525203_5525518_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|5525546_5528870_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|5528891_5529860_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|5529956_5531009_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|5531103_5531649_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|5532512_5532566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|5532548_5533688_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5533686_5535234_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5535205_5535667_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5535685_5537023_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122519.1|5537032_5538880_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5538872_5539823_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5539908_5540217_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|5540293_5541574_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5541659_5542919_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5542921_5543926_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 21
NZ_CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	5555638	5616210	5785882	protease,transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_000811566.1|5555638_5555914_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5556062_5556392_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|5556573_5557323_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5557319_5558075_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5558182_5559247_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|5559601_5560999_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5561014_5561320_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000056760.1|5561807_5562458_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5562467_5563322_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|5563321_5564008_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|5564136_5564412_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5564738_5565134_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5565140_5565455_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5565459_5565687_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5565728_5566178_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001341645.1|5566248_5567043_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|5567482_5568097_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|5568104_5569313_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|5569447_5570086_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5570304_5570925_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|5571233_5572637_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|5572903_5573338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|5573436_5574504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|5574750_5575413_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5575520_5576486_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|5576593_5577454_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5577542_5577923_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|5578051_5579995_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5580184_5580925_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|5580914_5581472_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5581796_5582003_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5582064_5583408_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5583730_5584369_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5584574_5586308_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|5586304_5590084_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5590086_5590428_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5590639_5590891_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5590884_5591235_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5591314_5591845_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|5592154_5593111_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|5593250_5594753_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|5594766_5595789_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|5595775_5596771_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5596803_5597802_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|5597977_5599351_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|5599506_5600058_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5600151_5601504_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099160.1|5601808_5603347_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|5603395_5603743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|5603739_5604144_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|5604579_5605044_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|5605202_5607341_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|5607734_5609390_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|5609439_5610861_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181312.1|5610979_5611927_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5612111_5612165_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|5612305_5615002_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399685.1|5615229_5616210_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	0	7581	98899		Escherichia_phage(55.56%)	9	NA	NA
WP_001154678.1|1796_2606_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	99.6	3.4e-158
WP_000888906.1|2898_3783_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|4116_4509_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|4520_4661_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|4686_5109_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|5148_5937_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|5945_6125_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|6399_6684_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_109041922.1|6687_7581_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.0	2.5e-154
>prophage 2
NZ_CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	12626	44314	98899	terminase	Escherichia_phage(63.16%)	39	NA	NA
WP_000751806.1|12626_13454_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_001276599.1|13837_15202_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_001198654.1|15201_16200_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	3.7e-194
WP_039719949.1|17887_18673_-	hypothetical protein	NA	A0A077SLJ8	Escherichia_phage	98.9	3.0e-143
WP_000896801.1|18659_19388_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000840931.1|21140_21386_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000095381.1|22031_22187_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_001354545.1|23309_23987_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684846.1|23983_24685_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	5.4e-144
WP_109041924.1|25150_26248_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.7	1.6e-203
WP_000021755.1|26320_26827_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000675629.1|27020_27746_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	3.8e-140
WP_024177054.1|27785_27977_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	4.7e-18
WP_000042974.1|27973_28189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071056.1|28181_28826_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.1	4.4e-132
WP_000154831.1|28822_29590_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	98.5	8.8e-31
WP_001369800.1|29586_30075_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.0	4.4e-44
WP_000797279.1|30247_30436_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000951710.1|30437_30647_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_021351680.1|30643_31186_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	74.6	7.3e-72
WP_000516537.1|31268_31502_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_000269003.1|31680_31974_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_000988658.1|31980_32355_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_000057449.1|32336_33269_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_001261544.1|33265_33628_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|34289_34541_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|34664_35054_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|35126_35348_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|35347_35728_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|35732_35912_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648825.1|35939_36983_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
WP_001369802.1|37071_37524_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_109041926.1|37610_38804_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.5	4.8e-209
WP_000124155.1|38803_40288_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_071528000.1|40489_40849_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_021351678.1|40845_41964_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	87.9	1.2e-177
WP_000611662.1|41996_42848_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|42958_43168_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000086536.1|43723_44314_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	5.6e-25
>prophage 3
NZ_CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	47591	52937	98899	integrase	Escherichia_phage(85.71%)	7	44555:44569	51238:51252
44555:44569	attL	AATGTGTTTTCTTTG	NA	NA	NA	NA
WP_000542336.1|47591_47813_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_109041928.1|47820_48852_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.7	4.9e-194
WP_001224233.1|48902_49214_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	3.9e-46
WP_000848359.1|49460_50021_+	Ref family protein	NA	Q71TG3	Escherichia_phage	96.8	5.5e-99
WP_001376241.1|50210_50852_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
WP_000747846.1|52251_52500_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
51238:51252	attR	CAAAGAAAACACATT	NA	NA	NA	NA
WP_000224043.1|52496_52937_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
>prophage 4
NZ_CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	59812	74028	98899	head,portal,holin	Escherichia_phage(56.25%)	16	NA	NA
WP_109041930.1|59812_61522_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_000132937.1|61514_62534_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001038142.1|62578_62833_-	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	3.6e-37
WP_109041937.1|62825_63383_-	lysozyme	NA	Q71TF3	Escherichia_phage	96.8	1.7e-103
WP_000068870.1|63552_64041_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	90.1	2.3e-77
WP_032283208.1|64238_64916_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	97.8	1.9e-125
WP_000432105.1|64922_65705_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_032283206.1|65697_66792_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.3	1.3e-40
WP_001165936.1|66823_67132_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_109041933.1|67121_70109_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_096858736.1|70121_70487_-	ddrA	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
WP_109041935.1|70483_72403_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_001345482.1|72404_73007_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|72993_73437_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|73433_73763_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|73653_74028_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
>prophage 5
NZ_CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	78569	98088	98899		Escherichia_phage(50.0%)	21	NA	NA
WP_001286326.1|78569_79004_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|79082_79919_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_024224232.1|79918_81352_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.2	4.5e-270
WP_000002800.1|81348_81705_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_024224231.1|81704_85097_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	98.4	0.0e+00
WP_001702265.1|85178_86060_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	4.8e-174
WP_000523978.1|86074_86686_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_000188924.1|86696_87263_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000846124.1|87321_87591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120526.1|87849_88524_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
WP_000245702.1|88924_89146_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	94.5	6.9e-37
WP_001749377.1|89142_90180_+	hypothetical protein	NA	Q71TN2	Escherichia_phage	92.8	7.0e-172
WP_001187875.1|90343_91144_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_024224130.1|91173_92019_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.6	2.2e-152
WP_001426344.1|92069_92315_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_023351947.1|92496_92652_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	88.2	3.4e-14
WP_000509943.1|92768_93278_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
WP_000035299.1|93289_93871_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000041774.1|93906_94722_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085153.1|94731_96321_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.6	3.7e-305
WP_000067713.1|96381_98088_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
>prophage 1
NZ_CP028124	Escherichia coli O26 str. RM10386 plasmid pRM10386-2, complete sequence	83012	8064	75249	83012	transposase,protease,integrase	Stx2-converting_phage(44.0%)	62	11174:11233	60250:61004
WP_001164205.1|8064_8847_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|8848_9262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|9820_10051_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|10047_10464_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|10625_11171_-	hypothetical protein	NA	NA	NA	NA	NA
11174:11233	attL	ATGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGC	NA	NA	NA	NA
WP_085948186.1|11238_12394_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_109041911.1|13199_14060_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|14187_14574_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|14627_15302_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|15298_15646_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|15649_17218_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000154135.1|17877_18543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|18683_19325_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|20026_21058_+	replication initiation protein	NA	NA	NA	NA	NA
WP_109041913.1|22017_24498_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_109041915.1|24499_24919_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_000937603.1|25115_26303_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|26302_26668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631725.1|29118_29466_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|29462_30137_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|30190_30418_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|30580_31558_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|32363_33576_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000937603.1|34201_35389_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001341410.1|35388_35574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158000286.1|35588_35744_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	90.0	6.8e-07
WP_096071227.1|35709_36923_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_101981703.1|37107_37320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387727.1|37307_39317_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|39360_39750_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|40710_41106_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|41105_42065_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_159096021.1|43242_43497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086536.1|46570_47161_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	5.6e-25
WP_000086167.1|47441_48125_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|48124_48343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|48354_48789_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|48833_49316_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|49312_50032_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|50308_50626_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|51087_51588_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000218854.1|52315_52750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|52842_53109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|53173_54064_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_077776889.1|54087_54309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|54339_54591_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|55169_56018_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|56103_56439_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|56670_57003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991399.1|57014_59735_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|59955_60276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109041919.1|61043_62257_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
60250:61004	attR	ATGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAACCCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCTCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCACATATCCGCACTCGCGAAACATATGGAACCCGGCGGCTCCAGACGGAGCTGGCAGAGAATGGCATCATCGTTGGTCGTGACCGACTGGCACGTCTTCGTAAGGAGCTAAGGCTACGCTGTAAGCAGAAACGCAAGTTCAGAGCGACTACGAACTCGAACCACAATCTGCCAGTTGCGCCAAATCTGCTGAACCAGACGTTCGCTCCTACAGCACCAAATCAGGTCTGGGTGGCGGACCTGA	NA	NA	NA	NA
WP_000114001.1|62966_63224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|63471_67374_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|68311_68731_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|68661_69336_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|69332_69680_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|69683_71252_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|71530_72718_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|72717_73083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|73319_73667_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998025.1|73716_75249_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
