The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	198427	260601	5057506	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001325807.1|198427_199780_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_021542017.1|199809_202242_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202363_202849_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|202852_203878_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|203982_204438_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204441_205230_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|205229_206378_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206374_206971_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|207007_210490_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|210502_211462_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|211560_213702_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213758_214148_+	VOC family protein	NA	NA	NA	NA	NA
WP_108942234.1|214212_215511_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|215559_215820_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_108942236.1|215806_216007_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|216172_216718_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216714_217137_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217150_217861_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_108942238.1|218110_219091_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|219293_220118_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|220170_221889_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|221999_222707_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222703_223108_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|223225_224041_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224080_224734_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224726_225758_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|225945_226518_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997037.1|232264_233068_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_000648576.1|233064_233979_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234219_235020_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|235097_235868_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|235915_237274_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|237345_238101_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|238134_238857_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238853_239321_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239385_240117_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240652_241438_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241574_242054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|242063_242978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243021_243504_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377958.1|243527_244880_-	membrane protein	NA	NA	NA	NA	NA
WP_122985795.1|244890_248325_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|248433_249849_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|249853_250597_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001583146.1|250593_253353_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	9.4e-83
WP_000343302.1|253361_254123_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|254127_255459_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255461_255986_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_021542025.1|255982_257263_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|257287_258370_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_108942240.1|258333_260184_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260187_260601_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	564334	627476	5057506	tRNA,terminase,integrase,protease,transposase,capsid,head,tail,lysis,portal	Enterobacteria_phage(44.23%)	69	574496:574542	618950:618996
WP_000912345.1|564334_565720_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|565755_566277_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|566384_566597_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|566598_567465_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|567945_568488_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|568707_569400_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001306954.1|569430_572040_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|572052_573060_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|573070_573586_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|573588_574221_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
574496:574542	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_108942260.1|574555_575719_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	2.8e-198
WP_000433949.1|575574_575946_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000206813.1|575945_576251_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|576250_576613_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_047083433.1|576603_577140_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	5.3e-99
WP_000081287.1|577267_578092_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|578157_578520_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|578990_579506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|579825_580518_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|580615_580876_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|580868_581420_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|581595_581775_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|581764_582706_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_077613723.1|582702_583197_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.1e-86
WP_162617006.1|583196_583523_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	96.3	3.3e-51
WP_000767127.1|583519_583909_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|583928_584726_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_023277492.1|584733_585723_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	5.4e-190
WP_001204780.1|585740_586124_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|586313_587411_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|587999_588215_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|588214_588712_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|588928_589111_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|589201_589495_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001403557.1|589785_590196_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_001031427.1|590481_590688_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|590852_591047_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453603.1|591435_591981_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_032292250.1|591955_593881_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|593877_594084_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_108942266.1|594080_595682_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000123333.1|595662_596982_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|596991_597324_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063224.1|597379_598405_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158880.1|598446_598842_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000752994.1|598853_599207_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000985116.1|599218_599797_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683143.1|599793_600189_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|600196_600937_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000479139.1|600952_601375_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|601356_601791_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_108942268.1|601783_604345_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
WP_021520659.1|604341_604671_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152535.1|604670_605369_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_000140728.1|605374_606118_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_000090891.1|606054_606687_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515477.1|606746_610244_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.9	0.0e+00
WP_047667381.1|610314_610914_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	4.8e-109
WP_089585292.1|610978_614050_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885574.1|614049_614634_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|614688_615357_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|615413_615719_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226386.1|615902_617387_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096968254.1|617573_618527_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|619039_619801_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
618950:618996	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|619983_620874_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|620874_623847_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|623833_626071_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|626339_627476_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1107985	1172659	5057506	terminase,integrase,holin,capsid,lysis,portal	Escherichia_phage(68.92%)	75	1106250:1106265	1171913:1171928
1106250:1106265	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_001401545.1|1107985_1109296_-|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208773.1|1109348_1109633_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497812.1|1109678_1109930_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_032276318.1|1109917_1110151_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	98.7	3.1e-35
WP_000994795.1|1110294_1110684_-	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_001291843.1|1110719_1110932_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1110891_1111518_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1111514_1111946_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|1112001_1112679_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260979.1|1113003_1113261_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
WP_032276320.1|1113389_1113587_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	98.5	9.2e-33
WP_001240641.1|1113676_1113982_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
WP_001451754.1|1114024_1114594_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_052900916.1|1114845_1115127_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	1.8e-50
WP_052900919.1|1115329_1116223_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	92.1	6.0e-164
WP_000476216.1|1116219_1116459_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000157000.1|1116451_1116655_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1116651_1117530_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1117637_1118081_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1118157_1118979_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1119042_1119390_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|1119465_1120053_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187066.1|1120052_1120742_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1120738_1121689_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1121707_1121989_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_000917253.1|1122303_1122516_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1122586_1123234_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1124094_1125048_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1125044_1126514_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1126608_1127322_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1127417_1127621_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1127791_1127986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1128152_1128530_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1128523_1130044_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1130033_1131005_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402092.1|1131004_1131454_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1131461_1132025_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1132021_1132216_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1132208_1132643_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000691354.1|1133149_1134097_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1134106_1134376_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_108942304.1|1134879_1136820_+	SASA family carbohydrate esterase	NA	A0A0H4IQ82	Shigella_phage	99.5	0.0e+00
WP_000142786.1|1136955_1137135_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_001290208.1|1137175_1137421_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284510.1|1137498_1137714_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_108942306.1|1137718_1138252_+	lysozyme	NA	A0A2L1IV49	Escherichia_phage	92.7	5.1e-94
WP_047091152.1|1138525_1139095_+	antirepressor	NA	A0A0N7KZV8	Escherichia_phage	97.9	6.4e-103
WP_000455406.1|1139094_1139244_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_047091151.1|1139251_1139689_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	1.4e-68
WP_001109015.1|1139891_1140434_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_033817459.1|1140592_1140973_+	phage family protein	NA	Q716B1	Shigella_phage	98.4	1.6e-65
WP_001086073.1|1141372_1142179_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_108942308.1|1142159_1143866_+|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.8	0.0e+00
WP_000787518.1|1143865_1146010_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000345015.1|1146167_1147175_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000214467.1|1147198_1148413_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_001140445.1|1148467_1148857_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_001290743.1|1148907_1149369_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|1149352_1149916_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207918.1|1149915_1150566_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	100.0	3.5e-121
WP_000118000.1|1150562_1152344_+	hypothetical protein	NA	A0A1I9LJS9	Stx_converting_phage	99.2	1.3e-61
WP_052901188.1|1152412_1153084_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
WP_001146316.1|1153162_1154788_+	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
WP_040077394.1|1154784_1156053_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_000455635.1|1156067_1156346_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001373155.1|1156351_1156969_+	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	99.5	1.5e-121
WP_000078907.1|1157833_1157974_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|1158030_1158432_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509491.1|1158525_1159182_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_001561694.1|1159640_1159892_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.5e-11
WP_108942310.1|1159902_1161147_+	hypothetical protein	NA	A0A088CBK4	Shigella_phage	96.2	5.5e-208
WP_032276328.1|1161236_1169618_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	97.4	0.0e+00
WP_001273658.1|1170559_1170733_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1170815_1172144_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
1171913:1171928	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
WP_001028095.1|1172164_1172659_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 4
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1399694	1468345	5057506	terminase,integrase,protease,holin,capsid,head,tail,portal	Escherichia_phage(29.41%)	76	1399531:1399555	1454540:1454564
1399531:1399555	attL	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_028985500.1|1399694_1400825_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	1.2e-103
WP_000113186.1|1400802_1401051_-	excisionase	NA	NA	NA	NA	NA
WP_028985499.1|1401115_1403587_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092839.1|1403682_1403871_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1403867_1404056_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1404840_1405209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1405220_1405373_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1405562_1405970_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1406047_1406275_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1406258_1406780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1406760_1407726_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790459.1|1407732_1408473_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450858.1|1408502_1409264_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|1409323_1409518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1409859_1410411_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1410625_1410838_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|1410940_1411258_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1411846_1412074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1412127_1412397_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_033817200.1|1412398_1413448_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.9e-109
WP_000904136.1|1413460_1413823_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_021293385.1|1413815_1414481_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
WP_000342737.1|1414734_1415448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1415621_1415819_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_032308170.1|1415970_1417029_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000271631.1|1417508_1417937_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|1418633_1419359_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039264423.1|1421221_1423186_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	2.0e-297
WP_000142780.1|1423320_1423500_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1423540_1423786_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|1423863_1424079_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|1424082_1424874_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_062896309.1|1426077_1426260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|1426628_1426835_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|1426899_1427124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|1427468_1427795_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1427926_1428127_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1428168_1428534_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|1428822_1429386_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001373204.1|1429382_1431044_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|1431107_1433045_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1433089_1433311_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_039264426.1|1433256_1435842_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.2	0.0e+00
WP_000126028.1|1435838_1436165_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|1436175_1436526_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573397.1|1436522_1436969_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1436965_1437310_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|1437376_1438093_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|1438107_1438482_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|1438577_1438787_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212873.1|1438835_1442078_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_108942322.1|1442070_1442412_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	80.4	4.9e-50
WP_000738904.1|1442610_1443774_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001365876.1|1443984_1444683_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_039264428.1|1444693_1445437_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	3.8e-148
WP_137573430.1|1445382_1446015_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_108942324.1|1446924_1450611_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1450809_1450950_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000290874.1|1451094_1452363_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049904.1|1452431_1453103_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
WP_000211405.1|1453510_1454071_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001079509.1|1454717_1455224_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1454540:1454564	attR	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_001056491.1|1455269_1455770_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1455855_1456035_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1456415_1457222_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1457221_1458415_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001297118.1|1458426_1459785_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1459788_1461384_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|1461383_1462946_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1463037_1463082_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1463219_1464101_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1464097_1464718_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1464818_1465691_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1465730_1466321_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1466317_1467076_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1467295_1468345_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1756739	1815489	5057506	terminase,integrase,transposase,capsid,head,tail,lysis,portal	Enterobacteria_phage(38.46%)	75	1787756:1787771	1820185:1820200
WP_000527781.1|1756739_1758200_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_000347482.1|1758288_1759572_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1760176_1760290_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1760358_1760592_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1760908_1761499_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1761596_1762172_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073547402.1|1762171_1765570_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_032292241.1|1765634_1766234_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_000515751.1|1766301_1769781_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000090905.1|1769841_1770444_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_000140764.1|1770380_1771124_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_108942344.1|1771129_1771828_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847345.1|1771827_1772157_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000459480.1|1774724_1775159_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000479139.1|1775140_1775563_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_001439072.1|1775578_1776319_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|1776326_1776722_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000985116.1|1776718_1777297_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|1777308_1777662_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158880.1|1777673_1778069_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000063224.1|1778110_1779136_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001549228.1|1779191_1779524_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123333.1|1779533_1780853_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_108942266.1|1780833_1782435_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000198149.1|1782431_1782638_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032292250.1|1782634_1784560_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453603.1|1784534_1785080_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001368374.1|1785468_1785702_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1785759_1786170_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001309517.1|1786665_1786821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1786900_1786966_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1786968_1787157_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1787167_1787380_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1787742_1788240_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1787756:1787771	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1788236_1788770_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1788766_1789078_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1789082_1789298_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1790051_1790267_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1790567_1790780_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1790834_1790924_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1791201_1791954_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_108942346.1|1791967_1793017_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	6.3e-112
WP_012304870.1|1793018_1793297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1793363_1793615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1793831_1793987_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1794058_1794346_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1794345_1794585_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1794609_1794915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1795117_1795450_+	protein flxA	NA	NA	NA	NA	NA
WP_108942348.1|1795886_1797200_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1797377_1797560_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_072096395.1|1797534_1797753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|1798866_1799223_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1799219_1799642_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1799682_1800648_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1800628_1801150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1801133_1801364_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1801447_1801855_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1802021_1802177_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1802336_1802555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1802558_1802723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1803122_1803311_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1803307_1803499_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_040089035.1|1803591_1806063_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	7.2e-58
WP_001296941.1|1806150_1806387_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877001.1|1806421_1807702_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1807721_1807832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|1807889_1808909_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|1808920_1810135_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1810340_1810667_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705214.1|1810801_1811143_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1811177_1811738_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1811740_1812451_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1812558_1812864_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1813062_1815489_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
1820185:1820200	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 6
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1826953	1844391	5057506	terminase,integrase,protease,capsid,head,portal	uncultured_Caudovirales_phage(100.0%)	30	1832628:1832643	1855571:1855586
WP_001260849.1|1826953_1827775_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1827813_1828143_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1828129_1828495_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133415.1|1829858_1830140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127881.1|1830153_1831815_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000113645.1|1831798_1832155_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|1832278_1832461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|1832444_1832885_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
1832628:1832643	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134109.1|1832884_1833181_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020659.1|1833177_1833516_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000267605.1|1833512_1834724_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504056.1|1834725_1835298_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_032308183.1|1835337_1836495_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	1.1e-136
WP_000929753.1|1836782_1837055_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126668.1|1837065_1837476_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001294166.1|1837485_1837791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174166.1|1837787_1838039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033817305.1|1838241_1839651_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	3.4e-113
WP_033817306.1|1839647_1839947_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033817307.1|1839952_1840186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033812069.1|1840178_1840412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033882705.1|1840404_1840644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|1840633_1840846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|1840838_1841036_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201456.1|1841230_1841410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096427.1|1841467_1841695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1841914_1842094_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000182306.1|1842151_1842355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1842598_1842787_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_001364183.1|1843161_1844391_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
1855571:1855586	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 7
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2231757	2279042	5057506	plate,terminase,integrase,transposase,holin,capsid,head,tail,portal	Escherichia_phage(25.0%)	60	2235113:2235172	2279112:2279188
WP_000399679.1|2231757_2232738_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001007749.1|2233036_2233687_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2234029_2234560_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
2235113:2235172	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_000974856.1|2235537_2236542_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_001287093.1|2236547_2237591_-	phage late control protein	NA	R9TNM7	Vibrio_phage	28.7	9.9e-33
WP_000634204.1|2237594_2237807_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|2237823_2238066_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_024184912.1|2238044_2238434_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	39.5	1.5e-15
WP_012138675.1|2238469_2240110_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
WP_000444666.1|2240218_2240500_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039264464.1|2240512_2241025_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_039264465.1|2241042_2242536_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	34.1	3.8e-70
WP_001559300.1|2242541_2242775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264466.1|2243726_2244353_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.5	3.1e-26
WP_039264467.1|2244355_2245276_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
WP_047621011.1|2245272_2245614_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.8e-20
WP_039264469.1|2245616_2246519_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_108942388.1|2246499_2247036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264472.1|2247032_2247713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264473.1|2247744_2248125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108942389.1|2248121_2248529_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_039264475.1|2248559_2249594_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.4	9.2e-108
WP_000206291.1|2249655_2249985_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|2249984_2251295_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_028985357.1|2251294_2252866_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.5	6.6e-190
WP_012565126.1|2252862_2253096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|2253092_2254958_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|2254944_2255511_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|2255883_2256129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264476.1|2256445_2256739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131874.1|2257354_2257834_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
WP_039264477.1|2257820_2258105_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.0e-08
WP_001294589.1|2258104_2258488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264478.1|2258600_2259272_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.4	7.8e-15
WP_000717782.1|2259271_2259565_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_039264479.1|2259561_2260158_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	1.4e-71
WP_001025459.1|2260234_2260414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264586.1|2260565_2261207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001559328.1|2261325_2261604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2262171_2262660_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_039264480.1|2262669_2263275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048963140.1|2263384_2263789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560857.1|2264109_2264775_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021560858.1|2264979_2265177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264482.1|2265803_2266727_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_039264483.1|2266904_2267699_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	74.6	2.8e-48
WP_039264484.1|2268380_2268605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192614.1|2268834_2269236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028985348.1|2269274_2270666_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	45.6	1.2e-102
WP_039264487.1|2270662_2271727_-	hypothetical protein	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_000943913.1|2271729_2271954_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_039264488.1|2271993_2272470_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	5.5e-23
WP_028985347.1|2272528_2272759_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	61.8	4.2e-21
WP_001296165.1|2272857_2273271_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_028985346.1|2274267_2274588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028985345.1|2274618_2276841_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.4	1.1e-92
WP_001559346.1|2276837_2277407_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.3	3.6e-37
WP_000916333.1|2277406_2277589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001559348.1|2277798_2278014_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	67.6	1.0e-21
WP_028985344.1|2278013_2279042_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.4	5.6e-97
2279112:2279188	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 8
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2322578	2331730	5057506		Acanthocystis_turfacea_Chlorella_virus(28.57%)	8	NA	NA
WP_000704855.1|2322578_2323745_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.2e-110
WP_089539956.1|2323992_2325399_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.8e-37
WP_089539959.1|2325562_2326933_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	2.2e-32
WP_089539961.1|2326957_2327704_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.4	3.5e-08
WP_089539963.1|2327769_2329173_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	6.3e-51
WP_089590403.1|2329184_2329640_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_089539966.1|2329642_2330608_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	52.4	3.1e-89
WP_089539968.1|2330611_2331730_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	63.3	1.4e-130
>prophage 9
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2391689	2492031	5057506	tRNA,terminase,integrase,holin,capsid,head,tail,lysis,portal	Enterobacteria_phage(40.3%)	103	2439928:2439948	2489537:2489557
WP_000476011.1|2391689_2393051_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|2393380_2393698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2394112_2395012_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2395093_2395873_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844220.1|2395972_2397013_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2397060_2398416_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823287.1|2398419_2398704_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182903.1|2398734_2399187_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|2399196_2400459_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2400487_2401342_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2401649_2402702_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2402958_2404236_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2404232_2405237_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2405233_2406199_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2406172_2406919_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2406970_2407789_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822275.1|2407853_2408654_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195602.1|2408650_2409439_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2409661_2409934_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134647.1|2410054_2410879_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2411097_2411436_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026150.1|2411517_2412552_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_108942396.1|2412565_2415046_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2415061_2415736_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830490.1|2415815_2416358_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|2416650_2416932_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2417194_2418304_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2418435_2420469_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_021542174.1|2420609_2424404_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021542175.1|2424413_2428046_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|2428106_2428427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|2429609_2430698_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294366.1|2430708_2432988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292774.1|2432980_2434117_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2434113_2436114_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2436238_2436700_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2436740_2437211_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2437257_2437977_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2437973_2439659_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2439928:2439948	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001217533.1|2440173_2440422_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_001373129.1|2440691_2441366_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438829.1|2441377_2441590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064579206.1|2441599_2443312_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	5.9e-67
WP_000078853.1|2443456_2443597_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_108942397.1|2443795_2447482_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.1	0.0e+00
WP_122996641.1|2448390_2449023_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.6	2.4e-98
WP_108942398.1|2448968_2449712_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	1.5e-144
WP_106901605.1|2449722_2450421_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_000847280.1|2450420_2450750_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_087661333.1|2450746_2453326_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	78.6	0.0e+00
WP_000533452.1|2453306_2453720_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
WP_001299690.1|2453746_2454178_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235126.1|2454193_2454943_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_000683074.1|2454950_2455346_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_001571311.1|2455342_2455918_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_001204531.1|2455933_2456287_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001373367.1|2456279_2456663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044803575.1|2456714_2457743_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256803.1|2457800_2458148_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_021293161.1|2458183_2459689_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_021293160.1|2459678_2461271_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
WP_000259002.1|2461267_2461474_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_096780415.1|2461457_2463428_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	3.1e-261
WP_001102148.1|2463357_2463906_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_001109017.1|2464568_2465111_-	hypothetical protein	NA	A0A088CBJ5	Shigella_phage	98.9	4.1e-99
WP_032209690.1|2465313_2465751_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_000443009.1|2465753_2465903_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_001056888.1|2465902_2466475_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_108942400.1|2466749_2467283_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	6.2e-100
WP_024199769.1|2467417_2467705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041949.1|2467793_2468585_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|2468588_2468804_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_108942401.1|2469298_2471263_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.5	1.2e-294
WP_044803553.1|2471506_2471830_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	99.1	5.9e-61
WP_000738072.1|2472127_2472397_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649753.1|2472408_2473368_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_087661264.1|2473750_2474809_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.0	2.1e-192
WP_000917741.1|2474959_2475157_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_021293442.1|2475391_2476009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204795.1|2476075_2476468_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_001202274.1|2476485_2477475_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	2.0e-192
WP_001065352.1|2477527_2477785_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203853.1|2477781_2479182_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	4.1e-244
WP_000988196.1|2479178_2480057_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_087661265.1|2480067_2480994_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	92.9	9.6e-157
WP_000618002.1|2480990_2481215_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_024173711.1|2481211_2482075_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	82.5	8.8e-128
WP_040077782.1|2482052_2482232_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	86.4	1.7e-25
WP_001090267.1|2482251_2482959_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	81.6	3.8e-105
WP_000944728.1|2483040_2483274_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800143.1|2483430_2484120_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000387833.1|2484267_2484960_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000147360.1|2484965_2485166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553978.1|2485363_2485546_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_032253186.1|2485551_2486124_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_000720075.1|2486493_2487321_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.9	4.8e-131
WP_001373430.1|2487361_2487733_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	4.7e-62
WP_001193437.1|2487924_2488179_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063646.1|2488212_2489499_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_042101647.1|2489534_2490221_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
2489537:2489557	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216961.1|2490280_2490388_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2490368_2491100_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021542177.1|2491104_2492031_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	3028047	3035515	5057506	integrase,transposase	Escherichia_phage(66.67%)	6	3025835:3025848	3032948:3032961
3025835:3025848	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|3028047_3028530_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_108942571.1|3029272_3030502_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	1.7e-233
WP_000448925.1|3030540_3030957_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_108942450.1|3031028_3032777_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|3032778_3034497_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
3032948:3032961	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_001299388.1|3034648_3035515_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.9e-51
>prophage 11
NZ_CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	3105911	3113051	5057506		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3105911_3108473_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141340.1|3108578_3109235_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272549.1|3109285_3110083_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3110248_3111157_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_096968183.1|3111153_3112416_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_001278994.1|3112412_3113051_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	0	16397	109466	transposase	Stx2-converting_phage(60.0%)	10	NA	NA
WP_106889145.1|1033_1330_-	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_000264906.1|1357_1549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997723.1|1558_1924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108942198.1|8540_9923_+	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.8e-05
WP_000539307.1|10189_10339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050877130.1|11153_13241_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.9	3.1e-09
WP_047087018.1|13501_13924_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_108942200.1|14108_15623_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.7	2.8e-286
WP_000612591.1|15672_16020_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171532.1|16016_16397_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
>prophage 2
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	21945	22398	109466		Moraxella_phage(100.0%)	1	NA	NA
WP_108942202.1|21945_22398_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	31.1	2.4e-12
>prophage 3
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	28402	28732	109466	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_001442266.1|28402_28732_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	55.6	1.8e-28
>prophage 4
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	36251	38846	109466	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001442267.1|36251_36926_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	6.2e-12
WP_000631723.1|36922_37270_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	7.8e-43
WP_001066416.1|37289_38846_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	9.8e-162
>prophage 5
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	59772	63307	109466	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_108942208.1|59772_60234_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	8.0e-19
WP_108942200.1|61018_62533_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.7	2.8e-286
WP_000612591.1|62582_62930_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171532.1|62926_63307_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
>prophage 6
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	72676	80481	109466	integrase	Cronobacter_phage(25.0%)	11	66290:66303	82359:82372
66290:66303	attL	TTCCTGCATCGTGA	NA	NA	NA	NA
WP_000086114.1|72676_73360_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
WP_077630271.1|73745_74648_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|75066_75315_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|75311_75749_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_001365565.1|75748_76741_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001365560.1|76770_77019_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
WP_000340836.1|77023_77416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|77420_78392_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633912.1|78620_79265_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_000239527.1|79258_79534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016958.1|79671_80481_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
82359:82372	attR	TCACGATGCAGGAA	NA	NA	NA	NA
>prophage 7
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	85593	86571	109466		Salmonella_phage(100.0%)	1	NA	NA
WP_011310114.1|85593_86571_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	5.5e-102
>prophage 8
NZ_CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	106671	109061	109466	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_040118371.1|106671_108264_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
WP_000624677.1|108294_108645_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422680.1|108641_109061_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	87.6	6.1e-42
