The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	601746	639397	5631913	transposase,tRNA,terminase,portal,head,tail,lysis,integrase	Enterobacteria_phage(55.0%)	54	597550:597565	632964:632979
597550:597565	attL	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000912342.1|601746_603132_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|603167_603689_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|603796_604009_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|604010_604877_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|605357_605900_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|606119_606812_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|606842_609452_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|609430_610471_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|610481_610997_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|610999_611632_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_000051902.1|611966_613130_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|612985_613357_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|613328_613607_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|613654_613873_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|613971_614253_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|614263_614455_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|614427_614610_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|614606_615287_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_001427106.1|615283_616069_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995439.1|616074_616371_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|616446_616737_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|617203_617524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|617659_617923_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|618004_618694_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|618798_619029_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|619098_619638_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|619724_620654_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|620650_621352_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|621556_621904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|622656_623265_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|623564_623981_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|623959_624361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|624484_624586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|624582_625038_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|625037_625208_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|625200_625491_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|625487_625850_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|625846_625987_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|626072_626456_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|626644_627727_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|628315_628531_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|628530_629028_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|629244_629427_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|629517_629811_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|630018_630186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918325.1|630151_631362_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.2e-167
WP_001427981.1|631479_631674_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|632062_632608_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027295.1|632582_634508_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
632964:632979	attR	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000198149.1|634504_634711_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|634707_636309_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000381395.1|636781_638353_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|638372_638720_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_109013661.1|638719_639397_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 2
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	750062	863855	5631913	transposase,terminase,protease,holin,portal,capsid,head,tail,lysis,integrase	Enterobacteria_phage(35.37%)	117	759053:759071	833304:833322
WP_000140570.1|750062_750965_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|751158_752349_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|752345_753605_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|753594_755223_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|755495_756854_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|756858_757935_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|758397_759048_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
759053:759071	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|759101_759356_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|759355_760486_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|760574_762860_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001427555.1|763555_767290_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|767417_768140_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|768286_770914_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|771062_772751_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|772747_773353_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|773367_774438_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|774415_774634_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|774739_775084_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|775202_775445_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|775519_775870_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|775866_776472_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|776468_776690_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|776788_777070_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|777080_777272_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|777244_777427_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|777426_778104_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|778100_778886_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|778891_779188_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|779242_779407_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|779375_779540_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|779612_779981_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|780130_780601_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|780734_781073_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|781075_781381_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|781694_782345_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|782425_782611_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|782720_783017_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|783049_783988_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|783984_784686_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|784682_784973_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|785045_785252_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|785259_785706_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|785702_786230_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|786226_786409_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|786912_788748_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|789271_789838_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|789812_790415_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|790411_791077_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|791073_791697_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|791949_792693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|792778_792937_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|793017_793416_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|793558_793774_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|793773_794271_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|794487_794670_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|794760_795054_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|795413_795608_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|796002_796512_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001444182.1|796483_798193_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.9e-239
WP_001238637.1|798205_798412_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_000258991.1|798395_798602_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000827572.1|798598_800191_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_001254039.1|800180_801686_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|801722_802070_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|802127_803012_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|803063_803438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|803430_803784_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|803798_804374_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|804370_804766_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|804773_805526_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|805539_805971_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|805997_806411_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|806391_808953_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|808949_809279_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|809278_809977_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194778.1|809982_810726_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_032284631.1|811354_814654_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_001341328.1|814682_814961_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_000612622.1|815082_815430_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|815478_817017_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|817079_817295_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|817362_817962_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_000279018.1|818026_819340_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023380.1|819341_819611_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001025664.1|821169_822492_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001676637.1|823292_827687_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|827687_829337_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|829341_830118_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|830392_833242_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|833327_833978_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
833304:833322	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|833994_836667_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|837405_838497_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|838608_839664_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|839737_840802_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|840801_841452_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|841527_843171_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|843388_845035_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|845183_845672_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_001296837.1|845807_845972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686723.1|846080_846575_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|846564_846828_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778069.1|846824_849311_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091291.1|849317_850013_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013509.1|849999_850863_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|850859_851309_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|851318_851921_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|851939_852557_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971723.1|852553_853216_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|853257_853995_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|853991_854201_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|854197_854677_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|854673_856617_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|856613_857171_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211567.1|857167_858220_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|858254_858902_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001369202.1|862280_863204_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|863366_863855_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
>prophage 3
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	941301	951229	5631913	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|941301_942033_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|942254_943940_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|943936_944656_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|944702_945173_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|945604_946990_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|947039_947387_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_133395011.1|947383_947698_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	4.5e-50
WP_001342301.1|948095_950096_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|950092_951229_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1202050	1238215	5631913	terminase,plate,holin,portal,capsid,head,tail,integrase	Enterobacteria_phage(87.18%)	46	1200988:1201047	1238322:1238442
1200988:1201047	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|1202050_1202191_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1202381_1202642_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|1202931_1204071_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|1204470_1205571_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|1205728_1206913_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|1206912_1207425_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|1207479_1207845_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|1207880_1208009_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853453.1|1207995_1210803_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.6	0.0e+00
WP_000979948.1|1210815_1211304_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000954196.1|1211460_1212033_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|1212076_1212655_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000108516.1|1212654_1214787_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000071738.1|1214789_1215320_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|1215312_1216209_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|1216212_1216563_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|1216559_1217141_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356324.1|1217137_1217773_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001342220.1|1217765_1218233_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202144.1|1218256_1220134_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|1220272_1220680_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072339.1|1220676_1221069_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_001342221.1|1221065_1221389_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|1221391_1221592_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|1221591_1222086_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|1222187_1222988_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_001055094.1|1223033_1224086_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262635.1|1224109_1224946_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.3e-149
WP_032317643.1|1225100_1226852_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087812.1|1226851_1227898_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289965.1|1228387_1228978_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	6.8e-31
WP_000211289.1|1229041_1229353_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|1229357_1230317_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272086.1|1230393_1233234_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.5	0.0e+00
WP_000564224.1|1233230_1233620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|1233943_1234147_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|1234233_1234347_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|1234343_1234586_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|1234597_1234876_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|1234886_1235237_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|1235258_1235462_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1235533_1235671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1235760_1236165_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|1236180_1236831_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|1236860_1237208_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|1237213_1238215_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
1238322:1238442	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1322250	1412193	5631913	transposase,tRNA,terminase,protease,holin,capsid,head,tail,integrase	Escherichia_phage(34.78%)	102	1314051:1314065	1355126:1355140
1314051:1314065	attL	TGGTGCGTGAACTGC	NA	NA	NA	NA
WP_000916763.1|1322250_1322481_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1322619_1322994_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1322997_1323870_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|1323882_1324224_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189091.1|1324616_1325693_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001443927.1|1325658_1325940_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|1326046_1326235_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|1326227_1326422_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|1326478_1327288_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105102.1|1327280_1329932_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.7	0.0e+00
WP_001307773.1|1330030_1330306_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|1330379_1330550_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|1330549_1330771_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_000379547.1|1331191_1331344_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|1331650_1332070_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1332166_1332409_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702028.1|1332405_1332828_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_001427413.1|1332905_1333694_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.8	1.8e-42
WP_000788774.1|1333700_1334447_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	2.4e-113
WP_000450657.1|1334469_1335240_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.5e-88
WP_001141109.1|1335255_1335687_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.4	1.0e-60
WP_000721512.1|1335720_1336761_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.8	3.8e-61
WP_000107695.1|1336784_1338614_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001186253.1|1338762_1338915_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	91.8	6.0e-16
WP_071527992.1|1339150_1339402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940309.1|1339473_1340073_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	3.8e-106
WP_000228018.1|1340072_1340363_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640124.1|1340359_1340914_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	2.2e-71
WP_000211431.1|1341184_1341766_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	83.1	7.4e-54
WP_000917767.1|1342009_1342207_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000301785.1|1342341_1343055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1343504_1343936_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000381395.1|1344493_1346065_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1346084_1346432_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1346431_1347109_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_109013669.1|1347214_1349152_+	DUF1737 domain-containing protein	NA	A0A0P0ZDW4	Stx2-converting_phage	96.7	0.0e+00
WP_000143458.1|1349287_1349467_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290221.1|1349507_1349780_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_001072901.1|1349856_1350072_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|1350076_1350610_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|1350883_1351579_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280922.1|1351673_1351805_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_071529499.1|1352027_1352213_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001109019.1|1352451_1353003_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_000828068.1|1353348_1353675_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095741.1|1353806_1354007_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829190.1|1354048_1354414_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|1354700_1355264_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
1355126:1355140	attR	GCAGTTCACGCACCA	NA	NA	NA	NA
WP_001368653.1|1355260_1356922_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000173079.1|1356985_1358923_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063110.1|1358967_1359189_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	94.5	1.6e-33
WP_000125988.1|1361715_1362042_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1362051_1362402_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1362398_1362845_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1362841_1363186_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|1363251_1363968_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|1363973_1364348_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1364443_1364653_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106918332.1|1364704_1367947_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.9	0.0e+00
WP_000807964.1|1367939_1368281_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001179486.1|1368280_1368979_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_009445180.1|1368989_1369733_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.2e-146
WP_072280596.1|1369678_1370311_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000649829.1|1370501_1371029_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106918354.1|1371162_1374636_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_001230428.1|1374703_1375303_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_109013670.1|1375367_1376681_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
WP_001023379.1|1376682_1376952_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|1377092_1377968_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|1378192_1378843_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|1379797_1380454_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1380454_1380646_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1380750_1380987_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|1381104_1382544_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|1382623_1385257_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|1385225_1386509_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1386638_1387136_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|1387232_1387931_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001427396.1|1387950_1389999_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1390190_1391072_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|1391117_1392491_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1392667_1393459_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1393601_1393841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1393999_1394143_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1394217_1394505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1395173_1395317_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1395329_1395539_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|1395704_1396514_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|1396510_1397077_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|1397505_1397964_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1398018_1398870_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1398882_1399683_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_109013671.1|1399745_1400717_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_001295494.1|1402738_1404337_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1404467_1405832_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|1406015_1406594_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1406597_1407959_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1408032_1408212_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1408331_1408691_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1409053_1409398_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1409529_1411440_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|1411497_1412193_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1423608	1464172	5631913	transposase,plate,protease,head,tail,integrase	Shigella_phage(51.28%)	58	1418917:1418933	1458340:1458356
1418917:1418933	attL	TTGGGCCGACAATCAGC	NA	NA	NA	NA
WP_000604932.1|1423608_1424040_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000826412.1|1424047_1425256_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_000512153.1|1425483_1425732_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|1425790_1425865_-	protein YoaJ	NA	NA	NA	NA	NA
WP_001219350.1|1425867_1425966_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001283455.1|1425998_1427024_-	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_000077537.1|1427567_1428098_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|1428288_1428537_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|1428538_1430629_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|1430699_1431632_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|1431634_1431856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1431868_1432123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1432124_1432406_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1432402_1432675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023441717.1|1432679_1432973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1432984_1433515_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|1433612_1434155_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|1434158_1434692_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|1434691_1435207_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|1435210_1435762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|1435758_1435944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|1435982_1436315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1436307_1436505_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|1436494_1436791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|1436787_1437297_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|1437366_1437792_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1437863_1438364_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1438398_1438827_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|1438810_1439029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|1439038_1439266_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|1439246_1439555_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|1439551_1439842_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|1439844_1440426_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|1440425_1442090_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|1442089_1443679_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|1443662_1444988_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|1445106_1445580_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|1445756_1446881_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|1446880_1447828_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002054.1|1447871_1448276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1448272_1448692_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1448688_1449249_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1449249_1449495_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1449491_1450994_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1451002_1451368_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1451382_1451859_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_032244543.1|1454046_1455396_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	2.9e-53
WP_000098807.1|1455379_1456504_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1456493_1457108_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1457100_1457538_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1457537_1458620_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
1458340:1458356	attR	TTGGGCCGACAATCAGC	NA	NA	NA	NA
WP_000301577.1|1458610_1459171_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1459170_1460082_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1460116_1460638_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1460717_1460921_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1461143_1461704_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1461803_1463843_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1463989_1464172_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
>prophage 7
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1618568	1748047	5631913	transposase,tRNA,terminase,protease,portal,holin,capsid,head,tail,integrase	Enterobacteria_phage(30.14%)	138	1666841:1666857	1718229:1718245
WP_001295400.1|1618568_1619843_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|1619904_1620765_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|1620808_1621414_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|1621519_1623022_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030346.1|1623632_1624268_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|1624267_1624963_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920784.1|1624966_1625587_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000915761.1|1626648_1628871_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|1628863_1629442_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133188.1|1629441_1630023_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|1630099_1630540_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|1630625_1630841_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|1631113_1631239_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|1631481_1632522_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|1632556_1633558_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459381.1|1633661_1634834_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125607.1|1634843_1636436_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179510.1|1636610_1637639_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|1637750_1638518_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_001342191.1|1638738_1639329_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106918351.1|1639717_1641529_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075858.1|1641525_1642899_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227023.1|1642937_1644203_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043342.1|1644247_1645756_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170683.1|1645856_1647032_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|1647230_1648877_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_023442004.1|1649019_1650423_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|1650419_1651349_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732497.1|1651424_1652726_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
WP_001092519.1|1652729_1653449_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|1653577_1653913_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|1653909_1654632_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|1654668_1656051_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1656236_1657181_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|1657704_1659237_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1659247_1660636_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085277.1|1661742_1662972_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953271.1|1663346_1663535_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_001496008.1|1663587_1664514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|1664446_1664737_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113154.1|1664729_1665050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261490.1|1665056_1665356_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000710169.1|1665352_1667170_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
1666841:1666857	attL	GGCGATTCGCTGGTGGA	NA	NA	NA	NA
WP_000125509.1|1667457_1667703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044863309.1|1667699_1668110_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233310.1|1668120_1668393_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|1668518_1668743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|1669034_1670192_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504055.1|1670231_1670804_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001398592.1|1670841_1672017_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020674.1|1672013_1672352_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134113.1|1672348_1672645_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1672644_1673085_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|1673374_1673731_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127890.1|1673714_1675376_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	5.7e-277
WP_000133423.1|1675389_1675671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|1676707_1676878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|1676984_1677350_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|1677336_1677666_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260840.1|1677704_1678526_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1678625_1678709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1678801_1679137_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1679533_1680787_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1680893_1681787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1681921_1683142_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1683266_1683962_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1683914_1685207_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000526492.1|1686021_1686876_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1686877_1687495_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1687505_1689929_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|1692613_1692919_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1693026_1693737_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|1693739_1694300_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1694334_1694676_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1694810_1695137_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1695342_1696557_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1696568_1697588_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|1697645_1697756_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|1697775_1699071_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|1699090_1699327_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048585.1|1699411_1701883_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|1701976_1702168_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1702164_1702353_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1702920_1703130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1703130_1703769_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|1703780_1703933_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000362153.1|1704198_1704618_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1704718_1705000_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_109013673.1|1704983_1705409_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|1705431_1706400_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|1706406_1707147_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450862.1|1707176_1707947_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001141099.1|1707962_1708355_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_024182342.1|1708351_1708648_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
WP_001018050.1|1708644_1708926_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
WP_001002668.1|1709165_1709477_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_000256992.1|1709604_1709823_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_052922150.1|1709824_1710370_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	55.2	2.2e-60
WP_000787530.1|1710359_1710755_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000128514.1|1710989_1711202_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001341388.1|1711369_1711648_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265151.1|1711649_1712699_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
WP_001217425.1|1712711_1713071_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064874.1|1713067_1713736_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_032316733.1|1714439_1716290_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000411802.1|1716737_1716944_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000992045.1|1717818_1718352_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
1718229:1718245	attR	GGCGATTCGCTGGTGGA	NA	NA	NA	NA
WP_000675931.1|1718572_1718686_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1718907_1719093_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1719620_1719935_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1720016_1720241_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000867488.1|1720635_1721181_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	2.8e-79
WP_001027230.1|1721155_1723081_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|1723077_1723284_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1723280_1724882_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123236.1|1724862_1726182_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1726191_1726524_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000399648.1|1727329_1728310_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001695575.1|1728925_1729321_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_000752994.1|1729332_1729686_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000683124.1|1730271_1730667_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_000235098.1|1730674_1731427_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|1731440_1731863_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1731889_1732303_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081793.1|1732283_1734896_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000847280.1|1734892_1735222_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106918349.1|1735221_1735920_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_001375575.1|1735925_1736669_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_096844540.1|1736614_1737247_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_109013674.1|1737492_1740969_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001233130.1|1741036_1741636_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_109013675.1|1741700_1743014_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
WP_001023379.1|1743015_1743285_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1743397_1743973_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1744045_1744675_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1744756_1745398_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1746338_1746773_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1746913_1748047_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1893274	2003638	5631913	transposase,tRNA,terminase,portal,holin,capsid,head,tail,lysis,integrase	Escherichia_phage(41.43%)	114	1877596:1877611	2001385:2001400
1877596:1877611	attL	GCGATTTCATCCGCCA	NA	NA	NA	NA
WP_085948178.1|1893274_1894487_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000520676.1|1894754_1895669_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|1895727_1896231_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|1896243_1896774_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000123648.1|1896787_1899439_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|1899480_1900191_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|1900551_1901115_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023441930.1|1902066_1903389_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|1903388_1903655_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000127325.1|1903877_1904357_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.7	1.7e-43
WP_000154339.1|1911253_1912207_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194888.1|1912455_1913991_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911171.1|1913984_1915013_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1915012_1916005_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|1916016_1917039_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774200.1|1917065_1917935_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|1917888_1918395_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|1918398_1919313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|1919519_1920971_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|1921197_1922616_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|1922754_1923114_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1923113_1924040_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|1924103_1925492_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|1925592_1926474_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323836.1|1926551_1927010_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|1926958_1927666_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1927815_1929006_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1929030_1929696_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1929907_1930342_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1930361_1930745_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1930776_1930995_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1931051_1932491_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_001022772.1|1932515_1934189_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1934244_1934556_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|1934583_1935906_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1936020_1936332_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|1936530_1937229_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|1937273_1938173_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1938367_1939555_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1939681_1939777_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671731.1|1941916_1942309_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024559.1|1942584_1943103_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|1943147_1945193_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1945329_1946076_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1946164_1946851_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|1947028_1947232_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1947267_1948728_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1948816_1950100_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096845570.1|1950159_1950450_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	82.0	2.6e-20
WP_097451673.1|1950501_1951657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_122993102.1|1952111_1953125_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|1953339_1953417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023998.1|1953527_1953797_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	2.3e-42
WP_032284465.1|1953798_1955112_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001233130.1|1955176_1955776_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_096089457.1|1955843_1959320_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_096844540.1|1959565_1960198_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001375575.1|1960143_1960887_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_001375577.1|1960892_1961591_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|1961590_1961920_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|1961916_1964496_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|1964476_1964890_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1964916_1965348_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_032325228.1|1965361_1966114_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|1966121_1966517_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|1966513_1967092_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1967103_1967457_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1967468_1967864_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1967905_1968931_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1968986_1969319_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1969328_1970648_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|1970628_1972230_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1972226_1972433_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1972429_1974355_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1974329_1974875_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1975263_1975458_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1975645_1976263_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1976412_1976850_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1976846_1977344_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1977343_1977550_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1977997_1979848_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1981018_1981840_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1981836_1982211_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265060.1|1982223_1983273_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	6.9e-111
WP_001341382.1|1983274_1983553_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|1983720_1983933_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|1984122_1984227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|1984342_1985212_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|1985222_1985486_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|1985487_1985652_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|1985737_1985950_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|1986000_1986357_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|1986334_1986796_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|1986792_1987089_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151124.1|1987085_1987508_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_000450674.1|1987523_1988285_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788968.1|1988307_1989054_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000693802.1|1989928_1990351_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|1990347_1990602_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|1990681_1991101_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001427316.1|1991399_1991552_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560223.1|1991972_1992194_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1992193_1992364_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|1992438_1992714_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105150.1|1992815_1995416_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000166313.1|1995408_1996218_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1996273_1996423_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1996460_1996649_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1996748_1996964_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040851.1|1996965_1998201_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_001157401.1|1998252_1999188_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
WP_000123745.1|1999316_2000690_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2001167_2002151_-	zinc transporter ZntB	NA	NA	NA	NA	NA
2001385:2001400	attR	GCGATTTCATCCGCCA	NA	NA	NA	NA
WP_000628065.1|2002405_2003638_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2080179	2156267	5631913	transposase,terminase,protease,holin,capsid,head,tail,integrase	Stx2-converting_phage(33.33%)	84	2093958:2093985	2156404:2156431
WP_000422045.1|2080179_2081229_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|2081448_2082207_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2082203_2082794_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2082833_2083706_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|2083806_2084427_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2084423_2085305_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2085442_2085487_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_023442273.1|2085578_2087141_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2087140_2088736_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001342102.1|2088739_2090098_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000209520.1|2090109_2091303_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2091302_2092109_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2092489_2092669_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2092754_2093255_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2093300_2093807_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2093958:2093985	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2094308_2094527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2097289_2097880_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2098063_2098711_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2098847_2098994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2099421_2099700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|2100867_2101437_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2101502_2102414_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2102520_2102643_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|2106588_2106858_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|2106918_2107596_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2107595_2107943_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2107962_2109534_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_106918341.1|2109566_2110880_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	2.0e-75
WP_001228278.1|2111031_2111631_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|2111698_2112748_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000099160.1|2112770_2114309_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2114357_2114705_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_151333969.1|2114826_2115105_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	98.9	1.2e-43
WP_106918340.1|2115182_2117633_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_129593009.1|2117975_2118608_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	4.6e-102
WP_044863475.1|2118553_2119297_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.6e-149
WP_001335877.1|2119307_2120006_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|2120005_2120347_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_109013678.1|2120339_2123582_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.0	0.0e+00
WP_001513217.1|2123629_2123839_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2123934_2124309_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_032244183.1|2124323_2125040_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
WP_000133393.1|2125105_2125450_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2125446_2125893_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2125889_2126240_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2126250_2126577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2129103_2129325_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173027.1|2129369_2131148_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.6	0.0e+00
WP_033800465.1|2131211_2132873_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958380.1|2132869_2133433_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2133721_2134087_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|2134128_2134314_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000347013.1|2134443_2134584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2134940_2135165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2135229_2135436_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2135663_2135810_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2135809_2136379_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|2136649_2137183_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|2137233_2137578_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2137582_2137798_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|2137947_2139801_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_001059384.1|2141325_2142015_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2142011_2142377_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|2142377_2143433_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|2143434_2143713_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2143782_2144040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2144260_2144473_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2144751_2145510_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2146208_2146373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|2147136_2147679_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2147590_2148631_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|2148602_2149154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2149137_2149365_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2149441_2149849_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2150113_2150413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2150485_2150704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2150726_2151134_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2151111_2151345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|2151338_2151506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|2151905_2152094_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|2152090_2152279_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|2152374_2154846_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2154910_2155159_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2155136_2156267_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2156404:2156431	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2260336	2276544	5631913	tRNA,terminase,protease,portal,capsid,head	uncultured_Caudovirales_phage(90.0%)	20	NA	NA
WP_001297484.1|2260336_2261443_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2261478_2262120_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2262123_2263494_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2263661_2264333_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2264332_2265793_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|2266408_2266690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127884.1|2266703_2268365_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
WP_000113646.1|2268348_2268705_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_001145906.1|2268993_2269434_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000134114.1|2269433_2269730_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001020669.1|2269726_2270065_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_001398592.1|2270061_2271237_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504047.1|2271274_2271847_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001137338.1|2271886_2273044_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_001132080.1|2273335_2273560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233311.1|2273685_2273958_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126670.1|2273970_2274381_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001368652.1|2274390_2274579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080642.1|2274692_2274944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833614.1|2275146_2276544_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
>prophage 11
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2279976	2341012	5631913	terminase,holin,capsid,head,tail,lysis,integrase	Escherichia_phage(27.59%)	77	2325126:2325144	2341337:2341355
WP_000085269.1|2279976_2281206_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000456506.1|2281454_2282576_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|2282721_2283951_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2284200_2285337_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|2285320_2286184_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|2286457_2287048_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|2287230_2287881_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|2287955_2289014_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2289141_2289777_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|2289844_2290426_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_159091279.1|2290716_2294175_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.0	0.0e+00
WP_001513217.1|2294222_2294432_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|2294527_2294902_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|2294907_2295624_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|2295690_2296035_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2296031_2296478_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2296474_2296825_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2296834_2297161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2299687_2299909_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|2299953_2301891_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_103951664.1|2301954_2303616_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2303612_2304176_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001427183.1|2304467_2304833_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_000095736.1|2304874_2305102_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2305470_2305695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|2305691_2306186_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_032140280.1|2306187_2306274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003120.1|2306828_2307362_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_000138558.1|2307521_2307794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|2308049_2308256_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874393.1|2308703_2310554_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000261909.1|2311321_2312035_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|2312129_2312369_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000090264.1|2313624_2313996_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|2313985_2314357_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_109013680.1|2314369_2315419_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.3e-109
WP_001341388.1|2315420_2315699_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|2315866_2316079_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|2316123_2316261_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|2316626_2317400_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2317751_2318165_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000451007.1|2318180_2318951_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788750.1|2318972_2319719_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_077756695.1|2319725_2320817_-	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	3.9e-133
WP_000273724.1|2320895_2321351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|2321556_2321982_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2321965_2322238_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2322346_2322748_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2322775_2322967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2322966_2323254_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|2323529_2323685_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|2323826_2324216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|2324402_2324588_-	hypothetical protein	NA	NA	NA	NA	NA
2325126:2325144	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000413705.1|2325161_2325350_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2325346_2325538_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032317593.1|2325631_2328103_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	3.4e-55
WP_000273151.1|2328170_2328413_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2328390_2329410_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001427258.1|2330226_2330658_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
WP_000762928.1|2331223_2332045_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|2332041_2332416_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265236.1|2332428_2333478_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.2e-109
WP_000191872.1|2333479_2333752_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2333873_2334218_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2334337_2334550_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2334783_2335341_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683607.1|2335342_2335561_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_001365112.1|2335663_2335999_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000699809.1|2335991_2336219_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2336215_2336497_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000451006.1|2336529_2337291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	4.9e-74
WP_000788759.1|2337312_2338059_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_001262372.1|2338065_2339136_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000693928.1|2339207_2339633_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2339616_2339940_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2340064_2340541_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|2340859_2341012_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
2341337:2341355	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
>prophage 12
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2526791	2638694	5631913	transposase,terminase,protease,holin,capsid,head,tail,integrase	Escherichia_phage(35.14%)	126	2584650:2584709	2637769:2637833
WP_023442187.1|2526791_2527994_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	1.2e-42
WP_032244309.1|2528618_2529074_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|2529885_2530809_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|2531292_2532564_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|2532569_2533697_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2533754_2534585_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|2535250_2536759_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2536917_2537127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|2537181_2541144_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2541183_2541822_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2542109_2543201_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2543200_2543893_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|2543904_2544291_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|2544298_2545099_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|2545108_2545699_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|2545709_2546204_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|2546224_2547553_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|2547635_2547809_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|2548181_2548778_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2548798_2549026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|2549063_2550305_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|2550596_2551856_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|2552115_2553036_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|2553035_2553341_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|2553433_2554033_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|2554029_2556576_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|2556575_2557748_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2557877_2558570_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|2558542_2559571_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001444338.1|2559653_2562398_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|2562469_2563543_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2563590_2563764_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2563753_2563984_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2563958_2564147_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2564157_2564370_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2564655_2564868_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2565309_2565615_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2565721_2566366_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2566362_2567109_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|2567108_2569205_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2569250_2570390_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2570377_2570824_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|2570843_2573024_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2573138_2574437_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000399648.1|2574700_2575681_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000270305.1|2575795_2575888_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|2575900_2577037_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|2577048_2578545_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|2578727_2579585_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|2579581_2579980_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_023441895.1|2579976_2580564_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2580560_2581268_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2581286_2583080_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2583076_2584195_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2584650:2584709	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_095585410.1|2584790_2584943_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|2585319_2586681_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2587135_2587405_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|2587442_2589014_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2589033_2589381_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2589380_2590058_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_032284669.1|2590113_2591427_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001230428.1|2591491_2592091_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106918333.1|2592157_2595634_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_064761467.1|2595879_2596509_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_025404499.1|2596454_2597198_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_001357740.1|2597203_2597902_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2597901_2598243_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106918336.1|2598235_2601478_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_001513217.1|2601525_2601735_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2601830_2602205_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_032244183.1|2602219_2602936_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
WP_000133393.1|2603001_2603346_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|2603342_2603789_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2603785_2604136_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2604145_2604472_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2606997_2607219_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|2607263_2609201_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_064460387.1|2609264_2610926_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958380.1|2610922_2611486_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001375434.1|2611778_2612144_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_001448509.1|2612185_2612410_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2612491_2612806_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2613331_2613517_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2613744_2613894_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_109013682.1|2613893_2614463_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	4.4e-104
WP_000087714.1|2614737_2615271_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|2615275_2615491_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2615568_2615814_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2615854_2616034_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|2616169_2618107_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2618584_2619016_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2619465_2620179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2620313_2620511_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|2620752_2621283_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2621291_2621651_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265111.1|2621663_2622710_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.6e-107
WP_001342259.1|2622711_2622984_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2623119_2623377_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2623382_2623682_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|2623886_2624231_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|2624227_2624593_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2624594_2624813_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2624900_2625536_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|2625701_2625884_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2625917_2626130_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2626180_2626537_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2626514_2626976_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2626972_2627269_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|2627265_2627658_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|2627673_2628399_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|2628432_2628975_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|2628886_2629897_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|2629983_2630421_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2630417_2630678_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2630804_2631197_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2631243_2631603_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2631605_2631908_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|2632321_2632522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2632614_2632833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2632836_2633001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2633401_2633590_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2633586_2633775_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048499.1|2633869_2636320_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2636387_2636630_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2636607_2637627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|2638034_2638694_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2637769:2637833	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 13
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2866737	2917812	5631913	transposase,terminase,protease,portal,holin,head,tail,lysis,integrase	Enterobacteria_phage(49.25%)	71	2914979:2914994	2922050:2922065
WP_001448642.1|2866737_2867313_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|2867373_2868051_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2868050_2868398_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2868417_2869989_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021351651.1|2870463_2870835_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001428038.1|2870958_2871792_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
WP_000950982.1|2872008_2872890_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|2872995_2873265_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_032284503.1|2873266_2874481_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	4.0e-78
WP_096089457.1|2875211_2878688_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_096844540.1|2878933_2879566_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001375575.1|2879511_2880255_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_001375577.1|2880260_2880959_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|2880958_2881288_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|2881284_2883864_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|2883844_2884258_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|2884284_2884716_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2884729_2885482_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_032284507.1|2885489_2885858_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|2885854_2887393_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612622.1|2887441_2887789_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000839179.1|2887785_2888190_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001254029.1|2888267_2888444_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001432013.1|2888433_2890026_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000259002.1|2890022_2890229_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|2890212_2892141_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|2892112_2892622_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|2893017_2893212_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2893399_2894017_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2894166_2894604_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2894600_2895098_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2895097_2895304_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|2897914_2898073_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2898158_2898902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2899086_2899776_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2899790_2899913_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750156.1|2900251_2901214_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|2901421_2901610_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|2901606_2901969_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|2901965_2902256_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|2902255_2902978_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|2902970_2903180_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|2903139_2903541_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2903543_2903720_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|2903716_2904127_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|2904098_2904455_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|2904751_2905042_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788880.1|2905038_2905740_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000185473.1|2905736_2906675_-	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000438538.1|2906707_2907007_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000064150.1|2907145_2907379_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000428099.1|2907492_2908197_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|2908465_2908828_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088201.1|2909434_2909707_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000073663.1|2909729_2910269_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_001341800.1|2910632_2911493_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|2911517_2911649_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|2911633_2911786_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|2912042_2912648_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|2912647_2913031_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|2913054_2913348_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|2913358_2913523_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|2913519_2914077_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|2914073_2914631_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|2914632_2915250_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
2914979:2914994	attL	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
WP_012817743.1|2915246_2915549_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|2915541_2915826_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|2915898_2916066_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|2916094_2916439_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|2916545_2916764_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|2916741_2917812_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
2922050:2922065	attR	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
>prophage 14
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3146452	3171337	5631913	transposase,protease,capsid,head,tail	Enterobacteria_phage(52.38%)	24	NA	NA
WP_001201825.1|3146452_3147406_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_109013685.1|3147592_3149032_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3149259_3149565_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|3149621_3150290_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000279150.1|3150928_3153889_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|3153953_3154553_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|3154623_3158037_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|3158097_3158730_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|3159415_3160114_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|3160113_3160443_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|3160439_3163001_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|3162993_3163428_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|3163409_3163832_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|3163847_3164588_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|3164595_3164991_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|3164987_3165566_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|3165556_3165931_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|3165942_3166338_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|3166379_3167405_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|3167460_3167793_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|3167802_3168681_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001339397.1|3168721_3169399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3169398_3169746_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3169765_3171337_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 15
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3414913	3519911	5631913	tRNA,terminase,holin,capsid,head,tail,integrase	Stx2-converting_phage(34.85%)	102	3504134:3504148	3516176:3516190
WP_001298974.1|3414913_3415651_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3415782_3417117_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|3417325_3418207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3418309_3418897_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3418952_3419336_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3419640_3420330_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3420377_3421415_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3421621_3422041_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3422109_3422808_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3422839_3425500_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3425613_3426969_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3427014_3427338_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3427334_3428633_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3434486_3437060_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3437189_3437921_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|3437917_3438898_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3439032_3439770_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3440040_3440382_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3440485_3440533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3440631_3441792_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3441834_3442956_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3442966_3444037_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3444246_3444612_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3444761_3445280_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|3445269_3446496_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3446511_3446994_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3447070_3447418_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3447459_3448227_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3448257_3448806_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3448824_3449073_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3449321_3450683_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3450849_3451641_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3451661_3452948_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3453002_3453596_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3453718_3454597_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3454682_3456344_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3456492_3456834_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3456895_3457186_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3457175_3457652_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3457783_3458266_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|3460019_3461381_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_115801847.1|3468116_3468206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|3468312_3468582_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_109013687.1|3468583_3469897_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001228241.1|3469961_3470561_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_109013688.1|3470628_3474102_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_064761467.1|3474347_3474977_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_025404499.1|3474922_3475666_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_001357740.1|3475671_3476370_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|3476369_3476711_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212878.1|3476703_3479946_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.1	0.0e+00
WP_001453698.1|3479997_3480207_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030040.1|3480302_3480677_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_000133388.1|3481464_3481809_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3481805_3482252_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3482248_3482599_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3482608_3482935_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3485461_3485683_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|3485727_3487665_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_033805975.1|3487728_3489390_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958416.1|3489386_3489950_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001365481.1|3490240_3490606_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000095736.1|3490647_3490875_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|3491243_3491468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|3491553_3491739_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|3492257_3492791_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|3492841_3493186_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|3493190_3493406_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|3493482_3493755_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|3493795_3493975_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_032212763.1|3494110_3496048_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000868396.1|3497167_3498094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131907.1|3498080_3498629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|3498641_3498983_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001427606.1|3499000_3499990_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001061413.1|3499997_3500795_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767105.1|3500814_3501204_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210162.1|3501200_3501527_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_001427609.1|3501523_3502177_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_001447905.1|3502176_3502671_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_000061512.1|3502667_3503486_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001444024.1|3503482_3503707_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_001087337.1|3503711_3504548_-	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
3504134:3504148	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_000521508.1|3504544_3505096_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|3505139_3505340_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3505430_3506105_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3506771_3507134_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|3507199_3508024_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|3508152_3508689_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_109013689.1|3508679_3509558_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.8	4.2e-170
WP_000158004.1|3509554_3509758_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|3509750_3509990_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|3509986_3510316_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|3510317_3511181_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|3511265_3511508_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|3511511_3511658_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|3511830_3513006_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_109013708.1|3513488_3514397_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	99.7	5.2e-171
WP_001427612.1|3514695_3515916_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
WP_000448925.1|3515954_3516371_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
3516176:3516190	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_000214985.1|3516442_3518191_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|3518192_3519911_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 16
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3592561	3599701	5631913		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3592561_3595123_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3595228_3595885_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3595935_3596703_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3596898_3597807_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3597803_3599066_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3599062_3599701_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3751387	3759336	5631913	transposase,integrase	Stx2-converting_phage(42.86%)	7	3749344:3749360	3758429:3758445
3749344:3749360	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|3751387_3752959_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3752978_3753326_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3753325_3754003_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|3754397_3755126_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|3756034_3756694_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|3756686_3758294_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_001272558.1|3758580_3759336_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3758429:3758445	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 18
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	4622565	4635897	5631913	transposase,integrase	Enterobacteria_phage(66.67%)	15	4622383:4622405	4636382:4636404
4622383:4622405	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|4622565_4623735_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4623754_4625614_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4625610_4626036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|4626363_4626936_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|4627009_4627510_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|4627506_4628241_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|4628792_4629059_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|4629055_4629655_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|4629647_4629935_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|4629927_4630383_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|4630457_4632029_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4632048_4632396_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4632395_4633073_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|4633228_4633549_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|4633563_4635897_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
4636382:4636404	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 19
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	4887174	4989774	5631913	transposase,tRNA,terminase,plate,protease,portal,holin,capsid,head,tail,lysis,integrase	Escherichia_phage(47.92%)	108	4920212:4920258	4951669:4951715
WP_000560983.1|4887174_4887612_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4887656_4888598_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4888661_4889570_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4889798_4890110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4890110_4890401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4891005_4891224_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086390.1|4891442_4891685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|4891913_4892894_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000027708.1|4893293_4894223_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829008.1|4894219_4894855_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4894851_4895754_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4895766_4898817_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4899010_4899844_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|4899996_4901037_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931345.1|4901086_4902835_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019489.1|4902834_4903905_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|4903894_4905346_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729592.1|4905356_4905803_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4906115_4906430_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009269.1|4906426_4907575_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179751.1|4907646_4908471_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211515.1|4908553_4909813_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144123.1|4909809_4911279_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001341797.1|4911566_4912043_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001341961.1|4912017_4912404_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369519.1|4912387_4913326_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063496.1|4913322_4914357_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4914641_4915262_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4915521_4916505_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4916653_4917328_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4917469_4918843_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4918839_4919538_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4919687_4920188_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4920212:4920258	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4920374_4921355_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4921424_4921718_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4921854_4922127_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4922296_4922797_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|4922860_4923085_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277903.1|4923084_4923387_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
WP_001113264.1|4923386_4923611_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4923607_4923883_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_106918308.1|4923872_4926149_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.1	0.0e+00
WP_001143636.1|4926350_4927295_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_000142509.1|4927302_4928292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559725.1|4928281_4929403_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000038161.1|4929817_4930852_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|4930851_4932624_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|4932797_4933652_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248595.1|4933710_4934784_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
WP_023568552.1|4934787_4935531_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.8	9.2e-126
WP_000988633.1|4935630_4936140_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4936139_4936343_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4936346_4936628_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_042002652.1|4936627_4937125_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_106918309.1|4937139_4937565_+	protein lysA	NA	Q858W1	Yersinia_virus	88.7	1.6e-58
WP_106918310.1|4937552_4937978_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	2.1e-66
WP_001300730.1|4937949_4938123_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_106918311.1|4938085_4938553_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_106918312.1|4938545_4938998_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_097316138.1|4939064_4939700_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.4e-113
WP_063610681.1|4939696_4940044_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_089628582.1|4940048_4940957_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
WP_001285341.1|4940949_4941561_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_109013697.1|4941557_4942745_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	84.9	1.6e-156
WP_016232558.1|4942748_4943168_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.1	8.5e-36
WP_001420299.1|4943139_4943742_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	89.5	1.6e-96
WP_109013698.1|4943741_4944272_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.2	6.8e-99
WP_000905106.1|4944302_4944896_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.5e-102
WP_001286716.1|4944955_4946146_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4946158_4946677_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001461862.1|4946733_4947009_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_000785970.1|4947041_4947161_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_109013699.1|4947153_4949601_+|tail	phage tail tape measure protein	tail	A0A0F7LCI6	Escherichia_phage	96.6	0.0e+00
WP_000978897.1|4949615_4950095_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_000468308.1|4951338_4951557_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4951793_4952696_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4951669:4951715	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4952876_4953839_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045673.1|4954157_4955147_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708994.1|4955253_4956009_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4956063_4956831_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4956938_4957538_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4957638_4958079_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4958290_4958590_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4958616_4959045_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4959049_4959796_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4959892_4960903_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4961037_4962546_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4962568_4963414_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4963838_4964084_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4964168_4964654_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4964746_4965673_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4965739_4967071_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4967080_4967611_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4967703_4968663_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4968754_4969780_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|4969935_4972134_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4972336_4972549_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_109013700.1|4972708_4976881_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
WP_000644414.1|4976882_4977119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797347.1|4978111_4978720_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|4978903_4979221_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001341952.1|4979497_4980658_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110785.1|4980660_4983093_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|4983441_4984332_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_109013701.1|4984660_4986841_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001341951.1|4986934_4987840_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647882.1|4987866_4988484_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|4988793_4989774_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5123438	5177322	5631913	tRNA,terminase,holin,capsid,head,tail,integrase	Enterobacteria_phage(28.57%)	66	5168099:5168113	5181929:5181943
WP_001093919.1|5123438_5123720_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.2e-43
WP_001061338.1|5123756_5124329_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.4	5.1e-108
WP_000628776.1|5124328_5124895_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	92.5	4.0e-97
WP_000192143.1|5125408_5125957_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
WP_001450018.1|5125953_5126163_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	100.0	8.8e-34
WP_001242710.1|5126174_5126786_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
WP_000008177.1|5126776_5127313_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_021522371.1|5127440_5128265_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	3.9e-149
WP_000135680.1|5128330_5128693_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|5129150_5129804_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|5129899_5130097_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514178.1|5130124_5130709_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	1.6e-56
WP_044863395.1|5130705_5131851_+	peptidase	NA	A5LH69	Enterobacteria_phage	85.3	8.5e-179
WP_000620696.1|5131847_5132072_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_032343211.1|5132068_5132887_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_023441586.1|5132883_5133378_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	5.2e-85
WP_000066917.1|5133377_5134031_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|5134027_5134354_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|5134350_5134740_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|5134759_5135569_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|5135584_5136100_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_032317762.1|5136109_5137099_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_001047129.1|5137112_5137865_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_000691354.1|5138432_5139380_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|5139389_5139659_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_001486442.1|5140158_5140248_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	6.3e-10
WP_122994412.1|5141826_5142096_+	hypothetical protein	NA	Q5MBW4	Stx1-converting_phage	98.9	2.1e-43
WP_000143458.1|5142231_5142411_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290221.1|5142451_5142724_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_001072901.1|5142800_5143016_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|5143020_5143554_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|5143827_5144523_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280922.1|5144617_5144749_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_071529499.1|5144971_5145157_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001109019.1|5145395_5145947_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_000828068.1|5146292_5146619_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095741.1|5146750_5146951_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829190.1|5146992_5147358_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|5147646_5148210_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001368653.1|5148206_5149868_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_044165196.1|5149931_5151869_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063096.1|5151913_5152135_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|5154660_5154987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|5154996_5155347_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|5155343_5155790_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5155786_5156131_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275476.1|5156197_5156914_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030040.1|5156919_5157294_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001513217.1|5157389_5157599_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106918336.1|5157646_5160889_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_000807964.1|5160881_5161223_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|5161222_5161921_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404499.1|5161926_5162670_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_064761467.1|5162615_5163245_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_109013704.1|5163490_5166967_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.1	0.0e+00
WP_001230429.1|5167033_5167633_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106918319.1|5167697_5169011_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
5168099:5168113	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_001023407.1|5169012_5169282_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001370116.1|5169691_5170297_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|5170521_5171172_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217539.1|5171765_5172014_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|5172075_5173173_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543823.1|5173261_5174299_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5174432_5174675_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5174840_5175824_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|5175906_5177322_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
5181929:5181943	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
>prophage 21
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5320395	5368318	5631913	transposase,protease,tRNA,integrase	Vibrio_phage(20.0%)	45	5301370:5301384	5327712:5327726
5301370:5301384	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|5320395_5322015_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|5322011_5323583_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|5323699_5324965_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|5325344_5325920_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|5325956_5327654_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|5327629_5327968_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
5327712:5327726	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|5328083_5329385_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_001427817.1|5329502_5330939_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|5331275_5331752_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|5331767_5333024_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|5333299_5333593_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|5333636_5335283_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|5335420_5335774_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|5336026_5337007_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|5337255_5338125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|5338514_5339543_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|5339584_5340151_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|5340202_5340328_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|5340438_5340585_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|5340766_5341084_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|5341080_5341614_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|5341702_5342836_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|5342898_5343258_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|5343268_5343664_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|5343674_5344409_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_106918320.1|5344401_5346210_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|5346534_5347512_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|5347730_5349233_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|5349284_5349599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|5349595_5349910_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|5349938_5353262_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|5353283_5354252_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_109013705.1|5354348_5355401_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|5355495_5356041_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|5356904_5356958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|5356940_5358080_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5358078_5359626_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5359597_5360059_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5360077_5361415_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|5361424_5363272_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5363264_5364215_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5364300_5364609_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|5364685_5365966_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5366051_5367311_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5367313_5368318_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 22
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5380030	5440602	5631913	transposase,protease	Stx2-converting_phage(25.0%)	59	NA	NA
WP_000811566.1|5380030_5380306_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5380454_5380784_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|5380965_5381715_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5381711_5382467_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5382574_5383639_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|5383993_5385391_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5385406_5385712_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|5385721_5386186_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5386199_5386850_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5386859_5387714_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|5387713_5388400_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|5388528_5388804_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5389130_5389526_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5389532_5389847_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5389851_5390079_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5390120_5390570_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001427815.1|5390640_5391435_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|5391874_5392489_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|5392496_5393705_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|5393839_5394478_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5394696_5395317_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|5395625_5397029_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|5397295_5397730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|5397828_5398896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|5399142_5399805_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|5399912_5400878_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|5400985_5401846_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5401934_5402315_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|5402443_5404387_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|5404576_5405317_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_023442195.1|5405306_5405864_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5406188_5406395_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|5406456_5407800_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|5408122_5408761_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5408966_5410700_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|5410696_5414476_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5414478_5414820_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|5415031_5415283_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|5415276_5415627_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5415706_5416237_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_023442194.1|5416546_5417503_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|5417642_5419145_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|5419158_5420181_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|5420167_5421163_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5421195_5422194_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|5422369_5423743_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|5423898_5424450_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5424543_5425896_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099160.1|5426200_5427739_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|5427787_5428135_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|5428131_5428536_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|5428971_5429436_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|5429594_5431733_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|5432126_5433782_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|5433831_5435253_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181312.1|5435371_5436319_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5436503_5436557_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|5436697_5439394_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399648.1|5439621_5440602_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5451066	5503136	5631913	transposase,tRNA,integrase	Stx2-converting_phage(48.0%)	47	5448424:5448439	5484869:5484884
5448424:5448439	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000416407.1|5451066_5453922_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|5453921_5454365_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5454718_5456230_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|5456496_5457597_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5457596_5458679_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|5458797_5460300_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|5460429_5461449_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|5461892_5463155_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|5463398_5464238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|5464375_5465962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|5466251_5466929_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5466928_5467276_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5467295_5468867_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|5469176_5469449_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|5469450_5470005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|5470001_5470754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|5471668_5471929_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|5471925_5472474_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|5472473_5472698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|5472694_5473018_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|5473032_5475366_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|5476271_5477096_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|5477144_5477717_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|5479070_5479328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5479884_5480652_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5480652_5481609_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|5481605_5482604_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|5482600_5483503_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|5483547_5485872_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
5484869:5484884	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068905.1|5485958_5486912_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5486908_5487430_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5489180_5489438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5490170_5491529_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|5491767_5493153_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|5493202_5493550_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_133395011.1|5493546_5493861_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	4.5e-50
WP_001221615.1|5494281_5494716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|5494703_5495105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|5495270_5495840_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|5496579_5498151_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5498170_5498518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5498517_5499195_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|5499262_5499439_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|5500072_5500351_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|5500800_5501205_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|5501201_5501549_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|5501597_5503136_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 1
NZ_CP028113	Escherichia coli O103 str. RM8385 plasmid pRM8385-1, complete sequence	94220	6399	71542	94220	protease,transposase,integrase	Stx2-converting_phage(36.84%)	49	5787:5846	87480:87688
5787:5846	attL	GACCATGGTGGTGAGCGGGGAGCGCTACTGTACAGCCTGATCGGGACGTGCAAACTGAAT	NA	NA	NA	NA
WP_001034100.1|6399_10302_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136138333.1|11105_11519_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_109013709.1|11517_12729_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_001341409.1|13497_13818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023441732.1|14038_16759_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001291056.1|16770_17103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157095.1|17334_17670_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001341408.1|17755_18604_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000148286.1|19182_19434_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077776889.1|19464_19686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|19709_20600_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_001247865.1|20664_20931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|21023_21458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117628.1|22185_22686_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032313270.1|23147_23465_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_001276261.1|23741_24461_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001341455.1|24457_24940_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|24984_25419_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|25430_25649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|25648_26332_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_077249722.1|26715_27618_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|27890_28850_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|28849_29245_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001172748.1|30205_30595_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|30638_32849_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_097586315.1|33033_34246_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_158000298.1|34212_34437_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	4.4e-07
WP_000361610.1|35040_36018_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341442.1|36180_36408_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_001341423.1|36461_37136_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|37132_37480_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_109013710.1|37483_39052_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	6.6e-158
WP_001344870.1|39875_40289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|40239_41427_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|45413_45890_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|49016_49247_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000907857.1|59818_60850_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|61551_62193_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000154135.1|62333_62999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109013710.1|63658_65227_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	6.6e-158
WP_000631725.1|65230_65578_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|65574_66249_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|66302_66689_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|66816_67677_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001165114.1|68434_68980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|69141_69558_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|69554_69785_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|70344_70758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|70759_71542_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
87480:87688	attR	ATTCAGTTTGCACGTCCCGATCAGGCTGTACAGTAGCGCTCCCCGCTCACCACCATGGTCAGAGCCGAAGAACAGGAAGTTTTTACGACCCAGACTGACCGCCCGCAGGGCATTTTCAGCGATGTTGTTGTCGATTTCCACCCAGCCATCGTTCGCATAGTACGTCAGTGCCGGCCACTGGTTAAGTGCGTACGCGAACGCCTTCGCCA	NA	NA	NA	NA
