The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2034510	2043973	5331435	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|2034510_2035626_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|2035622_2037563_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|2037639_2037861_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2038186_2038504_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2038534_2040814_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2040933_2041152_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004141853.1|2041505_2042225_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020323882.1|2042251_2043973_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 2
NZ_CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2299668	2368814	5331435	head,portal,tRNA,plate,tail,terminase,capsid,integrase	Enterobacteria_phage(51.35%)	83	2326861:2326882	2363570:2363591
WP_004150803.1|2299668_2300775_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2300831_2301290_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2301306_2301957_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2302197_2303448_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_020324087.1|2303720_2304434_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2304430_2304823_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2304815_2305139_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|2305258_2305435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2305588_2305816_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_020324096.1|2305928_2307122_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022631258.1|2307189_2307525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2307744_2307930_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2308020_2308515_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2308541_2309048_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2309064_2309952_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2310007_2311414_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2311410_2312421_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_020324075.1|2312533_2312731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2313297_2313930_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_020324078.1|2313969_2314149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2314546_2315233_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_009486509.1|2315345_2315510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|2315543_2317052_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2317172_2318063_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324097.1|2318069_2319854_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2319927_2321136_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2321438_2322482_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148037.1|2322562_2322682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807690.1|2323143_2324058_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_020324076.1|2324147_2324786_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|2324916_2325180_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2325239_2325365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2325482_2325557_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2325556_2325658_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2325715_2326729_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
2326861:2326882	attL	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_004216842.1|2326993_2327977_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004213095.1|2328092_2328392_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|2328512_2328791_+	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|2328811_2329030_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020324119.1|2329045_2329423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|2329438_2329702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324115.1|2329779_2330004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408797.1|2330000_2330567_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324116.1|2330799_2331735_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_020324090.1|2331772_2333920_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324106.1|2334177_2336124_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324074.1|2336116_2337124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324107.1|2338045_2338798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044816202.1|2339274_2340336_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324092.1|2340329_2342057_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_020324109.1|2342213_2343053_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324085.1|2343063_2344098_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324091.1|2344147_2345014_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324071.1|2345118_2345634_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_004131559.1|2345633_2345834_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324103.1|2345824_2346109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324098.1|2346105_2346651_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_157833084.1|2346837_2347173_+	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324102.1|2347173_2347641_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020324118.1|2347637_2348273_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|2348269_2348857_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324083.1|2348853_2349204_+	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_020324110.1|2349205_2350129_+|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020806131.1|2350118_2353145_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324108.1|2353141_2353354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324070.1|2353353_2354451_+|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324073.1|2354604_2355963_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_032408799.1|2356207_2356699_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324072.1|2356714_2359690_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032440702.1|2359676_2359835_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_004131585.1|2359834_2360152_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|2360197_2360713_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_020324084.1|2360712_2361885_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_020324077.1|2362039_2363179_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_004213128.1|2363222_2363474_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004179368.1|2363738_2363978_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2363570:2363591	attR	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_014343000.1|2363967_2364306_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|2364310_2364820_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004179371.1|2364965_2365658_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|2365689_2366865_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|2366972_2367767_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2367750_2368197_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004179374.1|2368313_2368814_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2489113	2536028	5331435	integrase,tail,terminase,holin	Klebsiella_phage(22.73%)	56	2491793:2491808	2545922:2545937
WP_004140269.1|2489113_2489923_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2489924_2490917_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2490916_2491807_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2491793:2491808	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_012542039.1|2491953_2493171_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_022631172.1|2493391_2493631_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_022631173.1|2493671_2494781_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_022631174.1|2494793_2497943_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.5	7.8e-291
WP_022631175.1|2498080_2498236_-	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
WP_020804303.1|2498244_2498436_-	YebW family protein	NA	NA	NA	NA	NA
WP_022631177.1|2498732_2499041_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_071784507.1|2499267_2499624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071784508.1|2499720_2499984_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022631179.1|2499986_2500523_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
WP_022631181.1|2500651_2501446_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
WP_032408811.1|2501511_2502351_+	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	2.3e-24
WP_022631183.1|2502353_2503103_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
WP_022631184.1|2503110_2503479_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.3	6.4e-11
WP_022631185.1|2503475_2503679_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
WP_086538002.1|2504161_2505205_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_022631188.1|2505194_2506037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631487.1|2506639_2506873_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
WP_022631486.1|2506950_2507172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631485.1|2507229_2507829_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
WP_031281243.1|2508037_2508334_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.7e-35
WP_004190680.1|2508330_2508699_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_022631482.1|2508695_2509478_+	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
WP_031281242.1|2509631_2509889_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_064159469.1|2509794_2510241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031281240.1|2510854_2511154_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_004184488.1|2511150_2511690_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_004190674.1|2511686_2512031_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2512027_2512303_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2513261_2513507_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2514369_2515374_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_022631478.1|2515351_2516659_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.2e-148
WP_022631477.1|2516658_2518059_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
WP_022631476.1|2518042_2519155_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	4.8e-110
WP_016946679.1|2519239_2520025_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_022631475.1|2520035_2520989_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	2.5e-131
WP_124724672.1|2520997_2521270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807837.1|2521310_2521706_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190649.1|2521707_2521962_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|2521971_2522205_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2522191_2522575_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_008807839.1|2522576_2523128_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004190640.1|2523124_2523517_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_022631474.1|2523540_2524713_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190637.1|2524766_2525249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631473.1|2525386_2525584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631472.1|2525649_2526171_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	56.4	6.9e-27
WP_022631471.1|2526262_2529163_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	5.2e-100
WP_004190622.1|2529162_2529627_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_022631470.1|2529807_2530290_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
WP_022631469.1|2530299_2530680_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	2.4e-69
WP_022631468.1|2530676_2533751_+	kinase	NA	A0A286S259	Klebsiella_phage	96.7	0.0e+00
WP_022631464.1|2533826_2536028_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	4.4e-99
2545922:2545937	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 4
NZ_CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2823374	2832788	5331435		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2823374_2823995_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|2823987_2825253_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|2825264_2826167_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2826427_2827189_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|2827209_2828070_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|2828367_2828628_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|2828714_2829803_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|2829833_2831099_-	MFS transporter	NA	NA	NA	NA	NA
WP_160333886.1|2831153_2832788_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
>prophage 5
NZ_CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	4246400	4323878	5331435	head,lysis,tRNA,plate,portal,tail,terminase,capsid,integrase	Salmonella_phage(75.51%)	87	4291282:4291328	4326159:4326205
WP_002914079.1|4246400_4247138_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4247269_4248601_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_004180937.1|4248646_4249030_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4249342_4250032_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4250089_4251175_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4251378_4251804_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4251873_4252572_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_020324863.1|4252606_4255258_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004180947.1|4255378_4256734_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4256775_4257099_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_020324862.1|4257102_4258398_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
WP_004150973.1|4264554_4267128_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004180948.1|4267257_4267989_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4267985_4268966_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4269097_4269835_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4270105_4270441_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4270547_4270595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4270695_4271856_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004174805.1|4271852_4272725_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4272787_4273909_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4273918_4274989_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4275331_4275841_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004180950.1|4275833_4277057_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004145671.1|4277070_4277553_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004180951.1|4277561_4278932_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4278988_4279447_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032408708.1|4279433_4279574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|4279566_4279914_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4279953_4280721_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004180952.1|4280752_4281301_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4281319_4281568_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4281827_4283192_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4283355_4284147_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4284166_4285453_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4285572_4286163_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4286287_4287166_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004180954.1|4287252_4288914_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004145681.1|4288939_4289080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914160.1|4289061_4289403_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|4289469_4289760_-	RnfH family protein	NA	NA	NA	NA	NA
WP_031281023.1|4289749_4290226_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4290336_4290819_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4291282:4291328	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_022631377.1|4291422_4291800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631378.1|4291827_4292046_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
WP_020323978.1|4292112_4293210_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.6e-174
WP_020323988.1|4293206_4293692_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
WP_073578773.1|4293688_4296082_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	3.1e-106
WP_002896220.1|4296308_4296428_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_020324018.1|4296442_4296742_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
WP_002896201.1|4296794_4297310_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_020323990.1|4297319_4298492_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
WP_020324016.1|4298639_4299803_-|tail	tail fiber protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
WP_020324004.1|4299830_4300049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323992.1|4300049_4302158_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
WP_020323993.1|4302163_4302757_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
WP_020324006.1|4302749_4303658_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
WP_020323996.1|4303644_4304007_-	lysozyme	NA	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
WP_020323981.1|4304003_4304576_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
WP_020323986.1|4304644_4305091_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
WP_002896172.1|4305083_4305515_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_073578772.1|4305477_4305636_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.2	7.6e-14
WP_020323995.1|4305610_4306039_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_020323982.1|4306035_4306419_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_020323999.1|4306423_4306933_-	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
WP_004144702.1|4306913_4307129_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_004144701.1|4307132_4307336_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_020323987.1|4307335_4307800_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
WP_004185715.1|4307896_4308547_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
WP_020324020.1|4308550_4309615_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_020323980.1|4309631_4310465_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
WP_019704191.1|4310605_4312369_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_020323991.1|4312368_4313403_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
WP_020324000.1|4313437_4314871_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_020324001.1|4315086_4315929_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
WP_020323985.1|4315928_4316147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323998.1|4316433_4316667_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
WP_020324007.1|4316677_4316866_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_020324017.1|4317019_4319434_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
WP_020324002.1|4319430_4320288_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
WP_020324003.1|4320284_4320512_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
WP_020323984.1|4320511_4320745_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
WP_020806228.1|4320812_4321154_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
WP_019704179.1|4321117_4321318_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
WP_020806226.1|4321325_4321835_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_000102106.1|4321867_4322110_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_031281027.1|4322232_4322862_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
WP_022631381.1|4322864_4323878_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
4326159:4326205	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP029135	Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence	70613	0	44023	70613	transposase,integrase	Escherichia_phage(18.18%)	39	3022:3051	15596:15625
WP_004098982.1|1108_1984_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_022631495.1|2395_3034_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
3022:3051	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAG	NA	NA	NA	NA
WP_087759376.1|3080_4201_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_004201235.1|4571_6041_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001749988.1|6797_7367_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|7759_8773_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|8928_9402_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|9622_9889_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|10031_10796_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001288432.1|12305_13739_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|14120_14327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|14331_14844_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_020324562.1|14868_15573_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001039463.1|16324_16711_+	hypothetical protein	NA	NA	NA	NA	NA
15596:15625	attR	CTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_000861580.1|16719_16911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|17922_18678_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_032419526.1|19345_19480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317852.1|20301_20937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020326536.1|21072_22068_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
WP_020804881.1|22796_23495_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020804880.1|23789_24521_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_020314648.1|24558_24837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804876.1|25154_25766_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|25762_26716_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|26836_27103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|27122_27743_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_020804882.1|28780_29422_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
WP_032426086.1|29517_29841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|31246_31951_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000608644.1|32061_33324_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|33887_34445_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|34627_35488_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|35697_36237_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|36208_37045_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|37044_37848_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|37908_38724_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000427619.1|39410_40415_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|40493_43460_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_003124096.1|43462_44023_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
>prophage 2
NZ_CP029135	Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence	70613	48667	61196	70613	integrase	Escherichia_phage(33.33%)	13	40685:40699	66084:66098
40685:40699	attL	TCCACAACACGACGG	NA	NA	NA	NA
WP_001776119.1|48667_49195_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|49227_49659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|50138_51104_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|51573_53061_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|53466_53898_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|53897_55169_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|55250_56225_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|56224_57430_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|57844_58114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|58470_59337_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|59871_59976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|60104_60362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|60419_61196_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
66084:66098	attR	CCGTCGTGTTGTGGA	NA	NA	NA	NA
>prophage 3
NZ_CP029135	Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence	70613	66753	68262	70613		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|66753_68262_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 1
NZ_CP029136	Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence	190416	2086	71798	190416	integrase,protease,bacteriocin,transposase	Stx2-converting_phage(17.65%)	57	24764:24779	48645:48660
WP_004178051.1|2086_4408_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|4409_4688_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|5028_5508_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|5828_6107_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|6323_6401_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|6393_7251_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093215.1|7301_7460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|7544_7679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029505403.1|7887_8097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093087.1|8697_10893_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|10889_12206_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|12209_14519_-	ATPase	NA	NA	NA	NA	NA
WP_003846917.1|16224_17478_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|17529_20604_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|20725_21808_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|22268_23279_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427623.1|23682_24687_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
24764:24779	attL	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
WP_071527925.1|24984_25227_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|25557_25851_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|25949_26717_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|26717_27674_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|27670_28669_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|28665_29568_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|29612_31937_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|32022_32976_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|32972_33494_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|34455_34668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|34596_34764_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|35048_36176_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|36172_36766_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|36762_37611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|37610_38531_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|38543_40148_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|40192_41140_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|41147_42881_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|46703_47051_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004114613.1|47047_47425_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004118217.1|47981_48617_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|48613_49726_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
48645:48660	attR	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
WP_004118216.1|49718_51107_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|51106_51379_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_001067855.1|52539_53244_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|54099_54927_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|54923_55787_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|55795_56623_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|56631_57642_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|57635_58505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|59713_60694_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|61895_62159_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|62173_62437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|62680_62962_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|62996_63566_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|63680_66476_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|66475_66673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|66910_67660_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|67646_68609_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|70451_71798_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP029138	Klebsiella pneumoniae strain AR376 plasmid unnamed3, complete sequence	81137	2852	37133	81137	integrase,transposase,protease	Escherichia_phage(27.27%)	42	33098:33112	39493:39507
WP_001067834.1|2852_3557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000935452.1|3603_4908_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|4946_5615_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|5650_5887_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|5883_6246_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|6263_7958_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|8009_8432_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|8467_8743_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|8756_9107_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|9178_9613_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_048226988.1|9691_10696_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_108720392.1|11518_12532_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	2.3e-71
WP_000381802.1|12677_13211_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000654805.1|13377_14346_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_020316986.1|14466_15327_+	class A extended-spectrum beta-lactamase SHV-7	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
WP_002210513.1|15347_16109_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023307208.1|16216_19114_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|19208_19814_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|20396_22484_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_004206886.1|22496_23447_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|23457_24720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187436.1|24764_25160_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|25264_25648_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|25727_26381_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004187429.1|26472_26730_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_147810693.1|26698_27064_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|27156_27591_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_004187413.1|28965_29175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|29177_29396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206893.1|29440_30124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206894.1|30124_30382_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206895.1|30399_31674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206896.1|32201_32558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|32535_33114_+	hypothetical protein	NA	NA	NA	NA	NA
33098:33112	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
WP_004206898.1|33115_33523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|33675_34221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206900.1|34361_34832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|34818_35067_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206901.1|35059_35647_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187390.1|35643_36129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316874.1|36170_36374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187383.1|36392_37133_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
39493:39507	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
