The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	1347549	1354689	4695904		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1347549_1348188_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1348184_1349447_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1349443_1350352_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1350517_1351315_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|1351365_1352022_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1352127_1354689_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	1965040	1974482	4695904		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1965040_1965967_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|1965971_1966703_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1966683_1966791_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1966850_1967582_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1967803_1969489_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1969485_1970205_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1970251_1970722_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_024176190.1|1970762_1971224_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
WP_001317947.1|1971348_1973349_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1973345_1974482_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	2543045	2571648	4695904	lysis,integrase,tail	Escherichia_phage(25.0%)	31	2544110:2544124	2567888:2567902
WP_000041556.1|2543045_2545472_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2544110:2544124	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|2545670_2545976_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2546083_2546794_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2546796_2547357_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2547391_2547733_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2547867_2548194_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2548399_2549614_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2549625_2550645_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2550702_2550813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2550832_2552113_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2552147_2552384_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2552471_2554943_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2555036_2555228_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2555224_2555413_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2555496_2555739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2555719_2556685_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2556725_2557148_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2557277_2558222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2558769_2560119_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2560436_2561039_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2561398_2562379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2562898_2563006_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2563050_2563263_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2563478_2563730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2563796_2564075_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|2564076_2565126_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|2565138_2565513_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|2565509_2566331_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|2567076_2569239_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2567888:2567902	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|2570070_2571468_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|2571522_2571648_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 4
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	2973073	2983851	4695904	integrase	Enterobacteria_phage(40.0%)	11	2971046:2971069	2982554:2982577
2971046:2971069	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2973073_2975029_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2977393_2977933_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2978115_2978427_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2978423_2979104_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2979100_2979259_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2979255_2980320_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2980473_2980692_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2980739_2980979_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2981118_2981355_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2981344_2982487_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2982600_2983851_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2982554:2982577	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	3298227	3306997	4695904	integrase	Salmonella_phage(90.0%)	12	3297897:3297910	3307039:3307052
3297897:3297910	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3298227_3298416_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3298574_3300968_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3300964_3301822_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3301818_3302046_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3302045_3302279_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3302346_3302688_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3302805_3303102_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3303109_3303619_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3303651_3303873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3304018_3304897_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3304908_3305853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3305944_3306997_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3307039:3307052	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	3386580	3412836	4695904	lysis,integrase,tail	Enterobacteria_phage(46.88%)	41	3388496:3388510	3412910:3412924
WP_001356070.1|3386580_3387870_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3387928_3388405_+	kinase inhibitor	NA	NA	NA	NA	NA
3388496:3388510	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3389150_3390482_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3390555_3390732_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3390881_3391550_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3392440_3393001_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3393389_3393623_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3393679_3394090_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3394441_3394594_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3394622_3394829_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3395045_3395543_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3395542_3395758_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3397027_3397987_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3398179_3398704_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3398859_3399237_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3399322_3399463_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3399459_3399822_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3399818_3400109_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3400101_3400272_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3400271_3400727_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3400723_3400825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3400917_3401370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3401366_3401927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3402411_3402705_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001182899.1|3403467_3404007_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3404076_3404307_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3404345_3405101_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|3405223_3405973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3405969_3406797_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3407305_3407512_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3407587_3407884_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3407889_3408675_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3408671_3409352_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3409348_3409531_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3409503_3409695_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3409705_3409987_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3410085_3410307_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3410517_3411120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3411362_3411530_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3411569_3411788_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3411765_3412836_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3412910:3412924	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4197341	4218730	4695904	integrase,tail	Escherichia_phage(56.0%)	25	4198867:4198886	4218961:4218980
WP_000202566.1|4197341_4198928_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
4198867:4198886	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
WP_001378647.1|4199480_4199777_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
WP_001378643.1|4200112_4200616_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	100.0	1.1e-90
WP_001171282.1|4201571_4202534_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001681074.1|4202537_4203065_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	98.3	1.9e-93
WP_000972143.1|4203093_4203627_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_000217632.1|4204483_4204909_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047105.1|4205189_4205942_-	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_001360050.1|4205955_4206945_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_108711101.1|4206952_4207309_-	hypothetical protein	NA	A0A291AX14	Escherichia_phage	95.9	2.0e-33
WP_000210170.1|4207305_4207632_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001373594.1|4207631_4208126_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	100.0	3.9e-88
WP_001677149.1|4208122_4208941_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_001446924.1|4208937_4209162_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_001446923.1|4209166_4210003_-	Immunity region from phage	NA	A0A291AWU3	Escherichia_phage	100.0	1.0e-152
WP_000521508.1|4209999_4210551_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4210594_4210795_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4210885_4211560_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000135682.1|4212226_4212589_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001763729.1|4212654_4213479_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001401560.1|4213607_4214144_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001242749.1|4214134_4214497_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001377405.1|4214496_4215117_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001419254.1|4215549_4217250_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001680166.1|4217506_4218730_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
4218961:4218980	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4307036	4313595	4695904	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4307036_4307993_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4307993_4308761_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4309318_4309576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4310627_4311779_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4311698_4312049_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4312149_4312722_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4312770_4313595_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 9
NZ_CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4557435	4580852	4695904	lysis,integrase	Shigella_phage(36.0%)	29	4548700:4548713	4567418:4567431
4548700:4548713	attL	GTTACCAGATGAAA	NA	NA	NA	NA
WP_000332259.1|4557435_4558533_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_001217553.1|4558593_4558842_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000543834.1|4559064_4559616_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001678535.1|4559593_4560964_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001753753.1|4561401_4563555_-	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	53.6	1.4e-211
WP_000839596.1|4564805_4565021_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4565088_4566141_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_001355891.1|4566290_4566485_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_046657263.1|4566731_4567898_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	1.7e-12
4567418:4567431	attR	GTTACCAGATGAAA	NA	NA	NA	NA
WP_046657265.1|4567894_4569121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016159280.1|4569113_4569458_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_001360050.1|4569475_4570465_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061404.1|4570472_4571270_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767133.1|4571289_4571679_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_032235543.1|4571675_4572002_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	98.1	6.6e-52
WP_000066917.1|4571998_4572652_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072165319.1|4572651_4573146_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021527492.1|4573142_4573961_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_001446924.1|4573957_4574182_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_032181493.1|4574186_4575023_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	2.6e-137
WP_000515860.1|4575019_4575571_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|4575614_4575815_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|4575905_4576580_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135682.1|4577246_4577609_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001753751.1|4577674_4578499_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000610754.1|4578685_4579468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093912.1|4579504_4579774_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
WP_000019186.1|4579807_4580356_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
WP_000287252.1|4580378_4580852_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP029123	Escherichia coli strain AR434 plasmid unnamed1, complete sequence	97471	2205	49895	97471	transposase,integrase	Escherichia_phage(33.33%)	40	19131:19146	47124:47139
WP_009364894.1|2205_2910_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_011977797.1|2900_3749_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	43.3	3.3e-47
WP_011977798.1|4389_4911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108711103.1|4968_5745_-	dihydrofolate reductase	NA	A0A1C9LW38	Vibrio_phage	40.6	4.0e-15
WP_001067855.1|5913_6618_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050576375.1|6608_9641_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.2	0.0e+00
WP_000429836.1|9835_10270_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|10348_11353_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000338626.1|11758_11875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|11995_12370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|12483_13209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410269.1|13183_13387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|13341_17595_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_001326394.1|17566_18007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009364894.1|18378_19083_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
19131:19146	attL	GTGCCCGCCGATGCGC	NA	NA	NA	NA
WP_072199448.1|19573_19993_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014342213.1|20325_20451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342212.1|21962_22112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|22078_23215_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|23265_23493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|23516_23708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|24189_24732_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|24744_25605_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_085940656.1|25737_26882_-|transposase	IS3-like element ISAba14 family transposase	transposase	S5WIU1	Leptospira_phage	28.1	2.3e-14
WP_108711104.1|27686_29747_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017781026.1|29760_30588_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_001324342.1|32900_34424_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|34413_35196_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|35730_36231_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|36358_37198_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|37191_37539_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_063865160.1|39038_39938_+	class A extended-spectrum beta-lactamase VEB-5	NA	NA	NA	NA	NA
WP_088498802.1|40671_41724_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	NA	NA	NA	NA
WP_000259031.1|41887_42727_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|42720_43068_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_032488579.1|43236_43791_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_002075255.1|43960_44974_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|45279_45837_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|45839_48812_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
47124:47139	attR	GTGCCCGCCGATGCGC	NA	NA	NA	NA
WP_000427620.1|48890_49895_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
