The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	458904	526049	4875835	protease,tail,head,terminase,portal,lysis,capsid,integrase	Enterobacteria_phage(44.0%)	75	456003:456017	507109:507123
456003:456017	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|458904_459726_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|459825_459909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|460001_460337_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|460733_461987_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|462093_462987_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|463121_464342_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|464466_465162_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|465114_466407_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|466565_467180_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|467222_468077_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|468078_468696_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|468706_471130_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001295396.1|473810_474116_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|474223_474934_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|474936_475497_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|475531_475873_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|476007_476334_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001370501.1|476539_477754_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|477765_478785_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|478842_478971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|478972_480253_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|480287_480524_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048286.1|480611_483083_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001083273.1|483176_483368_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001331023.1|483364_483553_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|483953_484106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|484092_484308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|484467_484623_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|484888_485308_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|485408_485690_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|485673_486099_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|486170_487241_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|487281_487704_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|488044_490042_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625668.1|490105_491383_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|491513_492395_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|492391_493084_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|493095_494295_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|494806_494914_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|494958_495171_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|495338_495617_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|495618_496668_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|496680_497055_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|497051_497873_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|498772_498904_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|499270_499699_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|499870_500245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|500496_500712_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|500711_501209_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|501425_501608_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|501698_501992_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|502354_502549_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_000453566.1|502937_503483_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001609942.1|503457_505383_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198150.1|505379_505586_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_094322808.1|505582_507184_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.8e-307
507109:507123	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_000123295.1|507164_508484_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_001513196.1|508493_508826_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063218.1|508881_509907_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|509948_510344_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|510355_510709_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|510720_511299_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|511295_511691_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001609944.1|511698_512439_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479169.1|512454_512877_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459488.1|512858_513293_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_094322806.1|513285_515847_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.8	0.0e+00
WP_000847379.1|515843_516173_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032330060.1|516172_516871_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.0e-134
WP_053887856.1|516876_517620_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_000090917.1|517556_518189_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_094322805.1|518249_521663_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_001230353.1|521732_522332_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_072005420.1|522396_525468_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001593356.1|525467_526049_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 2
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	747222	799045	4875835	coat,tail,tRNA,terminase,lysis,integrase	Escherichia_phage(50.0%)	55	766725:766741	804646:804662
WP_097344277.1|747222_747831_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	3.8e-101
WP_106087011.1|747830_751184_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_061342618.1|751248_751848_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_106087012.1|751914_755313_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
WP_050574668.1|755373_755982_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	92.6	1.9e-100
WP_106087013.1|755918_756662_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	3.2e-142
WP_106087014.1|756667_757366_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.4e-131
WP_000024051.1|757365_757704_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_106087015.1|757696_760930_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	2.4e-114
WP_012565075.1|761403_761763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106087016.1|761913_762876_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	1.0e-55
WP_000144678.1|762902_763295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029819.1|763291_763672_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524259.1|763672_764056_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
WP_000634211.1|764055_764451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079403889.1|764673_765813_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	7.4e-159
WP_106087017.1|765911_766676_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	6.6e-87
766725:766741	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_097291823.1|766780_767893_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	2.3e-112
WP_106087018.1|767876_769283_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.5	8.8e-186
WP_106087019.1|769285_770587_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	5.2e-148
WP_106087020.1|770567_771662_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	7.7e-113
WP_000126788.1|771665_771875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|771852_772785_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_106087021.1|772777_773572_-	ParB N-terminal domain-containing protein	NA	U3PCR3	Lactobacillus_phage	40.8	9.7e-49
WP_001697073.1|773709_775167_-	TrkG potassium ion Trk transporter	NA	NA	NA	NA	NA
WP_077613672.1|775363_775549_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	77.2	1.1e-14
WP_001135296.1|775765_776263_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839596.1|776262_776478_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000640107.1|777762_778305_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|778301_778592_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_001595669.1|778591_779191_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.9e-105
WP_001326322.1|780063_780402_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001595668.1|781014_781683_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000686865.1|781953_782226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595666.1|782362_782785_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	6.5e-60
WP_106087022.1|782800_783562_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.3	3.8e-119
WP_001595663.1|783584_784331_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	3.4e-112
WP_001595662.1|784337_785195_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	74.1	1.5e-74
WP_000693801.1|785207_785630_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
WP_001072343.1|785626_785881_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|785960_786380_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169150.1|786815_786968_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560211.1|787378_787600_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.0e-37
WP_000245522.1|787593_787770_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
WP_001314664.1|787844_788120_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001595659.1|788221_790822_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	62.8	1.5e-247
WP_000166313.1|790814_791624_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001317028.1|791680_791875_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001595656.1|791867_792056_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
WP_000079604.1|792155_792371_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|792372_793608_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157377.1|793659_794595_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123738.1|794723_796097_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|796574_797558_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|797812_799045_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
804646:804662	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 3
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	1851380	1914532	4875835	transposase,holin,integrase	Enterobacteria_phage(50.0%)	52	1881617:1881631	1917504:1917518
WP_000131044.1|1851380_1853414_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001351501.1|1853542_1854130_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089063.1|1854143_1855616_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1855629_1857300_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001616491.1|1857994_1858129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295805.1|1858374_1858938_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|1859267_1860062_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|1860215_1860977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|1862122_1863316_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|1863499_1864165_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|1864410_1865106_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|1865098_1866526_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|1866536_1867256_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|1867785_1868640_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001352368.1|1870119_1871328_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000474074.1|1871637_1871874_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1871885_1872479_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1872638_1873508_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|1873756_1874614_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092556.1|1874734_1878988_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|1880103_1880205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1880567_1880831_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1880830_1880971_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1881005_1881233_-	hypothetical protein	NA	NA	NA	NA	NA
1881617:1881631	attL	TATCCCTTACCCTTA	NA	NA	NA	NA
WP_001296902.1|1882055_1882598_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|1882672_1883260_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716392.1|1883317_1883986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131077.1|1884011_1886537_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001330883.1|1886526_1888170_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|1888138_1888849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|1889161_1889491_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1889738_1890353_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070693.1|1890770_1891460_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643328.1|1891456_1892413_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|1892409_1894608_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|1894617_1895574_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1895552_1895963_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000783650.1|1896581_1898915_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|1898929_1899250_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106087034.1|1899385_1899841_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244665.1|1899833_1900121_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980231.1|1900113_1900713_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
WP_001149160.1|1900709_1900976_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283027.1|1901527_1902262_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
WP_000638629.1|1902258_1902759_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446152.1|1902832_1903405_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_001273463.1|1905438_1906104_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	41.1	1.5e-31
WP_001609341.1|1906386_1906731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067395.1|1907081_1908008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857772.1|1909146_1910988_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_000068781.1|1911068_1913006_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032195659.1|1913197_1914532_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1917504:1917518	attR	TATCCCTTACCCTTA	NA	NA	NA	NA
>prophage 4
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	1962369	2024642	4875835	transposase,tRNA,protease,plate	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611738.1|1962369_1962783_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|1962786_1964637_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|1964600_1965683_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|1965707_1966988_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1966984_1967509_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|1967511_1968843_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|1968847_1969609_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001766987.1|1969617_1972461_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.6	1.0e-79
WP_000088859.1|1972457_1973201_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|1973205_1974618_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|1974726_1978161_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|1978171_1979524_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1979547_1980030_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|1980073_1980988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1980997_1981477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1981613_1982399_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1982938_1983670_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1983734_1984202_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1984198_1984921_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052710.1|1984954_1985710_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1985781_1987140_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211689.1|1987187_1987958_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1988035_1988836_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|1989076_1989991_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1989987_1990791_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1996549_1997122_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1997309_1998341_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1998333_1998987_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1999026_1999842_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1999959_2000364_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2000360_2001068_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|2001179_2002898_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|2003978_2004959_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|2005208_2005919_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635316.1|2005932_2006355_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|2006351_2006897_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2007062_2007263_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|2007249_2007510_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|2007558_2008857_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2008921_2009311_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|2009367_2011509_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|2011607_2012567_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|2012579_2016062_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|2016098_2016695_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|2016691_2017840_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2017839_2018628_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2018631_2019087_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|2019191_2020217_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2020220_2020706_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2020827_2023260_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|2023289_2024642_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	2346597	2383627	4875835	transposase,integrase	Escherichia_phage(27.27%)	41	2345347:2345364	2369489:2369506
2345347:2345364	attL	AATATCTCATGGAGATAT	NA	NA	NA	NA
WP_001218329.1|2346597_2347863_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001327226.1|2348555_2348753_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761685.1|2348772_2349261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094443.1|2349257_2349635_-	toxin	NA	NA	NA	NA	NA
WP_001285607.1|2349724_2350093_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692350.1|2350172_2350394_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186165.1|2350480_2350957_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206664.1|2350971_2351457_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001175163.1|2351548_2352367_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_001278287.1|2352456_2352690_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097301.1|2352695_2353373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282919.1|2353520_2354201_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010383.1|2354403_2355288_-	GTPase	NA	NA	NA	NA	NA
WP_000126799.1|2355393_2356356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499035.1|2356352_2357222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778605.1|2358826_2359357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075491.1|2360026_2360758_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001611347.1|2360973_2361753_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_001295213.1|2361752_2362775_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_123906543.1|2362788_2363283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538703.1|2363227_2363710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072164.1|2363913_2364417_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000218942.1|2364419_2365196_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001617303.1|2365474_2365822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609855.1|2366472_2367276_+	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
WP_000387046.1|2367461_2368013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001609859.1|2368261_2368711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900255.1|2368748_2369570_+	hypothetical protein	NA	NA	NA	NA	NA
2369489:2369506	attR	ATATCTCCATGAGATATT	NA	NA	NA	NA
WP_000902464.1|2369640_2370432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|2370568_2371435_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2371431_2371731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001325745.1|2372255_2372996_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001352368.1|2374694_2375903_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|2376268_2377474_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|2377917_2378238_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|2378230_2378617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|2378624_2379311_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|2379288_2379912_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|2379993_2381199_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|2381311_2381905_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|2382418_2383627_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 6
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	2405336	2448995	4875835	transposase,tRNA,integrase	Escherichia_phage(21.43%)	38	2416741:2416800	2445339:2445957
WP_001218930.1|2405336_2406602_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_001514390.1|2407107_2407317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294545.1|2407399_2408902_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2409020_2410103_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2410102_2411203_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2411469_2412981_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2413114_2413558_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|2413557_2416413_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_106087038.1|2416468_2416747_-	hypothetical protein	NA	NA	NA	NA	NA
2416741:2416800	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_001059414.1|2417519_2418023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2418068_2418485_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000086237.1|2418646_2419651_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001309158.1|2419751_2419982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331059.1|2419968_2421312_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000412211.1|2422704_2423364_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|2423564_2423942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|2424008_2426975_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2426977_2427538_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2427663_2428014_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|2428216_2429230_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_003159191.1|2429390_2429945_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|2430039_2430672_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000777555.1|2430740_2431214_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_000679427.1|2431974_2432322_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2432315_2433155_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2433282_2433783_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|2433957_2434740_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|2434729_2436253_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|2437966_2438827_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|2438829_2440545_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000993386.1|2441286_2441523_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2441519_2441882_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2441899_2443594_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2443645_2444068_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2444103_2444379_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2444392_2444743_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2444814_2445249_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001143760.1|2445989_2448995_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
2445339:2445957	attR	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
>prophage 7
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	3931011	4000555	4875835	transposase,tRNA,integrase	Enterobacteria_phage(22.22%)	58	3969090:3969149	3992723:3993340
WP_000003071.1|3931011_3932529_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192790.1|3932571_3933120_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3933174_3933246_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|3933242_3933368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3933369_3934818_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001626722.1|3935253_3937173_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3937172_3937661_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3937696_3939064_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3939099_3940416_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|3940433_3941834_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_000583615.1|3941998_3944869_-	molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit	NA	NA	NA	NA	NA
WP_000572462.1|3944865_3945645_-	molybdopterin-dependent oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_000906280.1|3945695_3947024_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_000502404.1|3947026_3950125_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_001272856.1|3950446_3951025_-	molybdenum cofactor cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298920.1|3951127_3951898_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_001020377.1|3951945_3953571_+	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_000037992.1|3953611_3954544_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001264457.1|3954591_3955977_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_001107117.1|3956029_3957241_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_000110493.1|3957298_3958495_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_001303128.1|3958552_3959740_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_000417808.1|3960218_3961997_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001016606.1|3962036_3962516_-	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
WP_000459182.1|3962512_3963391_-	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_000388150.1|3963401_3965699_-	xanthine dehydrogenase molybdenum-binding subunit XdhA	NA	NA	NA	NA	NA
WP_001272558.1|3966113_3966869_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_000676929.1|3967254_3968865_+	hypothetical protein	NA	NA	NA	NA	NA
3969090:3969149	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000412211.1|3970080_3970740_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3970940_3971318_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|3971384_3974351_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3974353_3974914_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3975039_3975390_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|3975592_3976606_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_003159191.1|3976766_3977321_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|3977415_3978048_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000777555.1|3978116_3978590_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_123906544.1|3978834_3979185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|3979351_3979699_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3979692_3980532_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001163403.1|3981334_3982117_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|3982106_3983630_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|3985347_3986208_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|3986210_3987926_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|3987964_3988633_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|3988668_3988905_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|3988901_3989264_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|3989281_3990976_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|3991027_3991450_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|3991485_3991761_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3991774_3992125_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|3992196_3992631_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001143760.1|3993372_3996378_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
3992723:3993340	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
WP_001235713.1|3996541_3997099_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|3997281_3998142_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000566300.1|3998921_3999137_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_106087047.1|3999177_3999378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|3999346_4000555_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 8
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4137370	4144510	4875835		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4137370_4138009_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|4138005_4139268_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|4139264_4140173_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|4140338_4141136_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|4141186_4141843_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|4141948_4144510_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 9
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4214541	4305863	4875835	transposase,protease,tail,tRNA,terminase,portal,lysis,integrase	Enterobacteria_phage(47.17%)	87	4207807:4207821	4230522:4230536
4207807:4207821	attL	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_000169527.1|4214541_4214841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001746364.1|4214837_4215704_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_000577254.1|4215855_4217574_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000448925.1|4219397_4219814_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|4219852_4221082_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_001352368.1|4222052_4223261_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000531801.1|4223468_4224644_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.9e-147
WP_001331174.1|4224604_4224811_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|4224870_4225086_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001242730.1|4225082_4225445_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_106087053.1|4225435_4225972_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	2.0e-98
WP_000196297.1|4226610_4227090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|4227497_4228172_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4228262_4228463_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515836.1|4228506_4229064_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_001250269.1|4229239_4229419_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001610668.1|4229408_4230350_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	7.5e-141
WP_001331408.1|4230346_4230841_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
4230522:4230536	attR	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_001610667.1|4230840_4231494_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4231490_4231817_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|4231813_4232203_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061397.1|4232222_4233020_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_001625103.1|4233027_4234017_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	5.2e-193
WP_001204819.1|4234034_4234400_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038607.1|4234484_4234931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4235201_4235405_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4235555_4236608_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4236674_4236890_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135251.1|4236889_4237387_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
WP_001442864.1|4237383_4237851_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	99.4	2.9e-77
WP_001139680.1|4237838_4237991_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000373425.1|4238666_4239161_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934130.1|4239160_4241263_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072975.1|4241259_4241472_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|4241399_4242980_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_077248791.1|4242924_4244952_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4245038_4245362_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4245354_4245630_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|4245641_4246220_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079408.1|4246216_4246618_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	7.0e-72
WP_000211105.1|4246628_4247372_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
WP_001429942.1|4247432_4247819_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
WP_001352368.1|4247986_4249195_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001615060.1|4249466_4252523_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.8	0.0e+00
WP_001610655.1|4252522_4252852_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152385.1|4252861_4253560_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_001619743.1|4253565_4254309_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_003887348.1|4254206_4254854_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	8.6e-112
WP_001230388.1|4258378_4258978_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_024262335.1|4259042_4262069_+|tail	tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001631692.1|4262068_4262653_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	1.9e-105
WP_001610640.1|4263207_4265196_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000011690.1|4265192_4265831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072748.1|4266280_4267201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|4267945_4268428_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4268559_4269036_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4269025_4269316_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4269377_4269719_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4269867_4271529_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4271614_4272493_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4272615_4273209_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4273263_4274550_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|4274570_4275437_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4275528_4276890_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4277138_4277387_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4277405_4277954_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4277984_4278752_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4278793_4279141_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4279217_4279700_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969042.1|4279715_4280942_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4280931_4281450_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168054.1|4282202_4283273_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225217.1|4283283_4284405_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200098.1|4284447_4285608_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4285706_4285754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4285857_4286199_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4286469_4287207_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|4287341_4288322_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|4288318_4289050_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4289179_4291753_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230378.1|4297607_4298906_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.4	4.3e-46
WP_000464877.1|4298902_4299247_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4299271_4300627_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082949.1|4300740_4303401_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|4303432_4304131_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4304199_4304619_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_089454903.1|4304825_4305863_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4772952	4782394	4875835		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|4772952_4773879_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4773883_4774615_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4774595_4774703_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|4774762_4775494_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4775715_4777401_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4777397_4778117_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4778163_4778634_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4778674_4779136_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|4779260_4781261_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|4781257_4782394_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
