The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	6	27210	4688906	tail,lysis,integrase	Enterobacteria_phage(47.06%)	43	1922:1936	27284:27298
WP_001356070.1|6_1296_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|1354_1831_+	kinase inhibitor	NA	NA	NA	NA	NA
1922:1936	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|2576_3908_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3981_4158_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|4307_4976_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|5866_6427_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|6815_7049_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|7105_7516_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|7867_8020_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|8048_8255_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|8471_8969_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|8968_9184_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|10453_11413_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|11605_12130_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|12285_12663_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|12748_12889_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|12885_13248_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|13244_13535_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|13527_13698_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|13697_14153_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|14149_14251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|14343_14796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|14792_15353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|15837_16131_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|16127_16829_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|16825_17755_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|17841_18381_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|18450_18681_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|18719_19475_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000389051.1|19597_20347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|20343_21171_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|21679_21886_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|21961_22258_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|22263_23049_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|23045_23726_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|23722_23905_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|23877_24069_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|24079_24361_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|24459_24681_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|24891_25494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|25736_25904_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|25943_26162_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|26139_27210_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
27284:27298	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 2
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	515960	541180	4688906	integrase,lysis,portal	Shigella_phage(38.46%)	27	511805:511864	537265:537324
511805:511864	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_099010529.1|515960_519719_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	87.5	0.0e+00
WP_000985945.1|521091_522600_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
WP_001135250.1|522626_523124_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|523123_523339_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_029365220.1|523406_524459_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	3.6e-208
WP_001355891.1|524608_524803_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_001564338.1|525051_526212_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.0	6.4e-57
WP_001564336.1|526214_526904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025377.1|526872_527913_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	8.7e-98
WP_021534260.1|527992_528346_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.5	5.8e-54
WP_024172633.1|528363_529353_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.8e-193
WP_086625103.1|529360_529708_-	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	98.1	7.0e-52
WP_033547788.1|529710_530652_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	1.1e-139
WP_001250269.1|530641_530821_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000526668.1|530996_531554_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001191669.1|531546_531807_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001020632.1|531904_532597_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|533299_533662_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081270.1|533727_534552_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001506964.1|534679_535216_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
WP_001506963.1|535206_535569_+	phage protein	NA	U5P092	Shigella_phage	99.2	1.4e-66
WP_000206735.1|535568_535874_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
WP_000433939.1|535873_536224_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|536100_537264_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893260.1|537468_538722_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
537265:537324	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|538733_539837_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|540124_541180_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 3
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	841683	858727	4688906	tail,integrase	Enterobacteria_phage(38.46%)	13	847264:847278	860708:860722
WP_099010532.1|841683_845385_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	85.5	0.0e+00
WP_047657079.1|845449_846049_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.6e-107
WP_086625106.1|846117_849597_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
847264:847278	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_000090882.1|849657_850260_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_032300617.1|850196_850940_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_128684128.1|851356_851557_+	hypothetical protein	NA	A0A2I6TC81	Escherichia_phage	63.2	7.4e-06
WP_000135680.1|851571_851934_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|851999_852824_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_021551571.1|852951_853488_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_001242714.1|853478_853841_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_086625077.1|853840_854461_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	89.8	9.1e-111
WP_086625076.1|854788_857395_-	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	41.1	1.7e-20
WP_086625075.1|857503_858727_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.8e-235
860708:860722	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 4
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	935489	996610	4688906	protease,integrase,tRNA,transposase	Escherichia_phage(14.29%)	54	956082:956109	963396:963423
WP_000998019.1|935489_936875_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|937113_938472_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937735.1|938850_939042_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|939204_939462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|940748_941528_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|941527_942550_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001283626.1|943171_943693_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|943689_944643_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|944729_947054_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001376066.1|947098_948001_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|947997_948996_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|948992_949949_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|949949_950717_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|951274_951532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|952583_953735_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|953654_954005_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|954105_954678_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|954726_955551_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
956082:956109	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_000749342.1|956588_957053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145203.1|957293_957788_+	membrane protein	NA	NA	NA	NA	NA
WP_000331917.1|957848_958694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190110.1|958707_959268_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000085626.1|959597_959927_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_001261095.1|960932_961265_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_023148066.1|961397_963308_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000061768.1|963678_964698_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
963396:963423	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_001376011.1|964827_966330_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_086625050.1|966490_967573_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|967572_968673_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|968939_970451_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|970708_971152_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|971151_974007_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_001680070.1|974060_975257_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059398.1|975449_975953_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|975998_976415_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012904.1|976576_977581_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000036437.1|977637_979233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336307.1|979355_979808_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001375985.1|979952_980546_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500727.1|980616_981330_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|981460_981856_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|982136_982271_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|982274_983210_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|983222_983684_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|983756_984143_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|984348_987045_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|987185_987239_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|987423_988371_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|988489_989911_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001375992.1|989960_991616_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|992009_994148_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|994307_994772_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|994816_995203_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162184.1|995257_996610_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 5
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	1845627	1883649	4688906	integrase,transposase	Bacillus_phage(44.44%)	31	1834080:1834094	1858106:1858120
1834080:1834094	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|1845627_1846470_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000169527.1|1846940_1847240_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1847236_1848103_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_099975594.1|1848221_1849841_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_001049180.1|1849840_1851289_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_108711119.1|1851329_1852886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|1852897_1853824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|1854176_1854476_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|1855039_1856866_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|1857034_1857385_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|1857531_1857963_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001377740.1|1858207_1859689_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
1858106:1858120	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000697968.1|1859681_1860362_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|1860551_1861937_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|1861964_1862318_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|1862431_1863724_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574029.1|1863734_1866881_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758224.1|1866967_1867408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353604.1|1867534_1869982_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|1870022_1870220_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|1870253_1870991_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|1871279_1871729_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001378117.1|1871963_1873781_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_086625094.1|1873780_1874677_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|1874716_1875097_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|1875101_1876031_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|1876085_1876766_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|1876762_1878163_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|1878380_1878815_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001028905.1|1879473_1880526_-	DUF2776 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|1882375_1883649_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 6
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	2666187	2679370	4688906		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|2666187_2666949_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|2666942_2667569_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2667708_2668848_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2668910_2669903_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|2669996_2671361_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|2671449_2672226_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2672230_2672869_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2672865_2674128_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2674124_2675033_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|2675198_2675996_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|2676046_2676703_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2676808_2679370_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 7
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3532291	3560494	4688906	terminase,integrase,holin,transposase	Klebsiella_phage(21.88%)	45	3534247:3534266	3560667:3560686
WP_000019585.1|3532291_3533035_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|3533075_3533471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046659708.1|3533523_3534303_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
3534247:3534266	attL	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
WP_046659706.1|3534299_3535559_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
WP_016244760.1|3535601_3535847_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_046659703.1|3536006_3536225_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
WP_046659701.1|3536221_3536422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086625037.1|3536576_3536780_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
WP_086625036.1|3536886_3537270_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
WP_046659679.1|3537269_3537464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269967.1|3537662_3537860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|3537896_3538079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|3538075_3538339_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_001297096.1|3538831_3539611_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|3539610_3540633_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024194779.1|3541209_3541500_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
WP_029363688.1|3541496_3541859_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
WP_001548467.1|3541855_3541996_+	YlcG family protein	NA	NA	NA	NA	NA
WP_046659669.1|3541992_3542682_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	3.2e-56
WP_122633140.1|3543137_3543437_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.9	1.4e-40
WP_046659668.1|3543433_3543973_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
WP_032412824.1|3543969_3544317_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
WP_046659666.1|3544313_3544589_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
WP_046659665.1|3544539_3544737_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
WP_024623185.1|3544834_3545143_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
WP_046659662.1|3545139_3545406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659660.1|3545575_3546004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|3546350_3546839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659658.1|3546789_3548190_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
WP_001085714.1|3548412_3549864_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
WP_000233062.1|3549919_3550468_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
WP_046659655.1|3550499_3550922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659652.1|3550977_3552180_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.3	2.4e-99
WP_000528476.1|3552183_3552678_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_020804064.1|3552689_3553631_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
WP_000725700.1|3553670_3553952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659650.1|3553920_3554340_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
WP_025269952.1|3554336_3554843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312779.1|3554842_3555229_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|3555323_3555764_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_162403646.1|3555917_3556658_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.2	1.8e-68
WP_025270001.1|3556657_3557539_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_126875314.1|3557790_3559875_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_025270003.1|3559883_3560063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025270004.1|3560176_3560494_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
3560667:3560686	attR	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3842651	3871243	4688906	tail,lysis,integrase	Escherichia_phage(25.0%)	31	3843716:3843730	3867483:3867497
WP_000041556.1|3842651_3845078_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
3843716:3843730	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|3845276_3845582_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3845689_3846400_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3846402_3846963_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3846997_3847339_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3847473_3847800_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3848005_3849220_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|3849231_3850251_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|3850308_3850419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|3850438_3851719_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|3851753_3851990_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|3852077_3854549_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|3854642_3854834_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3854830_3855019_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|3855102_3855345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|3855325_3856291_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|3856331_3856754_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|3856883_3857828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|3858375_3859725_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|3860042_3860645_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_108711128.1|3861023_3861974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|3862493_3862601_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|3862645_3862858_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|3863073_3863325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|3863391_3863670_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|3863671_3864721_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|3864733_3865108_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|3865104_3865926_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|3866671_3868834_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
3867483:3867497	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|3869665_3871063_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|3871117_3871243_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 9
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	4272668	4285406	4688906	integrase,transposase	Enterobacteria_phage(33.33%)	13	4270641:4270664	4284109:4284132
4270641:4270664	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|4272668_4274624_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|4276988_4277528_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|4277710_4278022_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|4278018_4278699_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|4278695_4278854_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|4278850_4279915_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|4280068_4280287_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|4280334_4280574_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|4280713_4280950_+	excisionase	NA	NA	NA	NA	NA
WP_000255956.1|4281073_4282096_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|4282095_4282875_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086625063.1|4282917_4284042_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.0e-206
WP_000444487.1|4284155_4285406_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
4284109:4284132	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 10
NZ_CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	4600559	4609329	4688906	integrase	Salmonella_phage(90.0%)	12	4600229:4600242	4609371:4609384
4600229:4600242	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|4600559_4600748_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|4600906_4603300_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|4603296_4604154_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|4604150_4604378_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|4604377_4604611_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|4604678_4605020_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|4605137_4605434_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|4605441_4605951_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|4605983_4606205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|4606350_4607229_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|4607240_4608185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|4608276_4609329_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
4609371:4609384	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP029103	Escherichia coli strain AR437 plasmid unnamed1, complete sequence	89643	6	89486	89643	tail,portal,holin,terminase,plate,integrase,lysis,head	Escherichia_phage(62.5%)	84	11275:11291	63231:63247
WP_075851197.1|6_807_+	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
WP_053287802.1|836_1682_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
WP_000934731.1|1850_2555_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.6	1.3e-134
WP_000509939.1|3565_4075_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|4086_4668_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041757.1|4703_5519_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
WP_029487601.1|5528_7118_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	2.4e-301
WP_059338140.1|7178_8885_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
WP_075851199.1|9110_10112_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.4	1.1e-177
WP_001285362.1|10128_11325_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
11275:11291	attL	CATTCTGTTTGCTCTTT	NA	NA	NA	NA
WP_001076427.1|11882_12743_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_075851201.1|13061_13454_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_075851203.1|13631_14054_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
WP_075851205.1|14093_14882_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
WP_001177862.1|15343_15628_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|15620_16526_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_075851207.1|16522_19564_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.5	0.0e+00
WP_000467133.1|21126_21561_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|21560_21725_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_001702255.1|21980_22124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276605.1|22197_23562_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
WP_001189128.1|23561_23864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075851211.1|23860_24835_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.1	5.5e-187
WP_073884958.1|24881_25514_-|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	99.4	7.7e-89
WP_000212018.1|25506_26523_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_075851213.1|26524_27310_-|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
WP_000896806.1|27296_28025_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_075851215.1|28028_29246_-|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	4.1e-224
WP_000235786.1|29255_29633_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840930.1|29779_30025_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_075851217.1|30027_30606_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
WP_000096174.1|30672_30828_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484108.1|31329_31956_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
WP_075851219.1|31952_32630_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
WP_075851232.1|32626_33328_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
WP_075851234.1|33629_34892_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
WP_077902027.1|36214_38071_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	38.2	8.3e-75
WP_000506730.1|39407_39797_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_001190712.1|39869_40091_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|40090_40471_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001339207.1|40475_40655_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_023356283.1|40682_41726_+	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
WP_001326849.1|41814_42267_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000219625.1|42352_43546_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
WP_000124150.1|43545_45030_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611657.1|45055_45907_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
WP_000874154.1|46017_46227_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|46822_47044_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_046660036.1|47051_48083_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
WP_024245510.1|48133_48445_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
WP_023155281.1|48691_49252_+	Ref family protein	NA	Q71TG3	Escherichia_phage	96.8	3.6e-98
WP_075851364.1|49441_50083_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
WP_077902034.1|50173_51214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245513.1|51213_51723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747846.1|51781_52030_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|52026_52467_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_075851366.1|52500_59268_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
WP_075851368.1|59344_61054_+|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.6	0.0e+00
WP_046659817.1|61046_62066_+|head	head processing protein	head	Q71TR6	Escherichia_phage	95.9	1.9e-177
WP_001345478.1|62357_62915_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_001615669.1|63083_63572_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.1e-87
63231:63247	attR	AAAGAGCAAACAGAATG	NA	NA	NA	NA
WP_075851370.1|63774_64569_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	8.0e-144
WP_001376906.1|64598_64916_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
WP_075851372.1|64905_67893_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.4	0.0e+00
WP_045904054.1|67905_68271_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
WP_075851374.1|68267_70187_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
WP_000164724.1|70188_70791_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_075851376.1|70777_71221_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	98.0	2.0e-80
WP_029487765.1|71217_71547_-|holin	holin	holin	Q37876	Escherichia_phage	99.1	3.0e-52
WP_029487766.1|71614_71896_-	hypothetical protein	NA	A0A1B0VBS6	Salmonella_phage	90.3	9.1e-42
WP_075851178.1|72314_72725_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.6e-23
WP_089438726.1|72724_77425_-	hypothetical protein	NA	Q71TP5	Escherichia_phage	57.9	4.1e-296
WP_001286322.1|77436_77871_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	98.6	2.8e-74
WP_001561131.1|77949_78786_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487598.1|78785_80219_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_000002800.1|80215_80572_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_089438725.1|80571_84312_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	87.4	0.0e+00
WP_000926345.1|84393_85275_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523980.1|85289_85901_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|85911_86478_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_001033469.1|86558_87098_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000039791.1|87101_87614_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245712.1|88233_88455_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_075851195.1|88451_89486_+	phage antirepressor Ant	NA	A0A077SLI1	Escherichia_phage	99.1	4.5e-187
>prophage 1
NZ_CP029104	Escherichia coli strain AR437 plasmid unnamed2, complete sequence	76919	16429	22265	76919	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000959884.1|16429_17392_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001414994.1|17394_17745_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_024181414.1|17853_18273_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	50.0	1.6e-18
WP_000005461.1|18207_19089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|19561_20266_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|20302_20959_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|20955_21465_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_001067855.1|21560_22265_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP029107	Escherichia coli strain AR437 plasmid unnamed5, complete sequence	93435	12690	52720	93435	protease,integrase,transposase	Escherichia_phage(50.0%)	35	45083:45099	62884:62900
WP_000156883.1|12690_13713_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|14117_14375_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|14609_14684_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032152935.1|14676_15534_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|16472_17126_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|17218_17476_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|17408_17810_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|17946_20844_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|20938_21544_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|22320_22713_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|22850_23735_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|23766_24966_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|25071_25722_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|25753_25996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|27617_28322_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|28465_29020_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|29150_29981_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|30612_31317_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|33638_33971_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|34017_34893_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_050011420.1|35148_35511_-|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
WP_001067855.1|35501_36206_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|37435_38020_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|38019_39258_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|39254_40160_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|40281_40986_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024193849.1|41010_41385_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_000255956.1|42464_43487_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_162542248.1|43486_44266_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	4.9e-138
WP_000977394.1|45004_45796_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
45083:45099	attL	TTGGACTTTCGCCAGCC	NA	NA	NA	NA
WP_001496335.1|45802_47773_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|49015_49288_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|50134_51304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|51670_51859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|51979_52720_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
62884:62900	attR	GGCTGGCGAAAGTCCAA	NA	NA	NA	NA
>prophage 2
NZ_CP029107	Escherichia coli strain AR437 plasmid unnamed5, complete sequence	93435	84590	92970	93435	transposase	Stx2-converting_phage(50.0%)	13	NA	NA
WP_032181561.1|84590_85274_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_001104873.1|85274_85496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|85509_85944_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001006251.1|85988_86759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001666994.1|87295_87598_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|87644_88067_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_086625070.1|88172_88949_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_000139363.1|89003_89564_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|89697_89910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077779935.1|90210_90378_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
WP_001339397.1|90354_91032_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|91031_91379_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_023149734.1|91398_92970_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
