The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	473254	600132	5275382	tRNA,tail,transposase	Escherichia_phage(25.64%)	95	NA	NA
WP_004175147.1|473254_474118_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_068814719.1|474128_474902_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
WP_002912636.1|475143_476037_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_068814721.1|476281_477643_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	3.9e-207
WP_004175198.1|477961_478684_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_068814723.1|478680_480159_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004149057.1|480155_481571_-	MFS transporter	NA	NA	NA	NA	NA
WP_009485875.1|481572_484650_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_004149055.1|484650_487773_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_068814724.1|487772_489011_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_068814726.1|489311_490592_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001101446.1|490623_491649_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118527.1|491967_492891_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|493230_494256_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021440454.1|494673_495285_-	positive transcription regulator	NA	NA	NA	NA	NA
WP_032411492.1|495400_495541_-	small membrane protein	NA	NA	NA	NA	NA
WP_000019449.1|495724_496705_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004899452.1|496977_497679_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068814727.1|497693_499550_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016531337.1|499838_501191_-	molecular chaperone	NA	NA	NA	NA	NA
WP_023282839.1|501328_502177_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_002912442.1|502291_502933_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|503023_503605_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_031591026.1|503635_505483_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_068814730.1|505714_507298_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_086910769.1|508063_508954_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
WP_031591033.1|509346_509976_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068814731.1|510935_512375_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_031591037.1|512520_513654_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024177910.1|513659_514094_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_068814732.1|514110_516273_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068814733.1|516345_517776_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_068814736.1|517799_519263_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023322974.1|519255_520386_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031591043.1|520394_521489_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_159080874.1|522033_522459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549031.1|522701_523976_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	46.5	1.4e-97
WP_158414492.1|523996_524158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322969.1|525089_526241_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001118616.1|526424_527348_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_031591050.1|527452_528859_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_068814737.1|529046_529970_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	2.7e-175
WP_004180506.1|530150_531566_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004899416.1|531587_532958_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_031589093.1|533121_534288_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_031589100.1|534480_535488_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
WP_004144151.1|536056_536179_-	small membrane protein	NA	NA	NA	NA	NA
WP_001118616.1|536346_537270_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|538119_539145_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118527.1|539463_540387_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|540726_541752_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021440454.1|542169_542781_-	positive transcription regulator	NA	NA	NA	NA	NA
WP_032411492.1|542896_543037_-	small membrane protein	NA	NA	NA	NA	NA
WP_000019449.1|543220_544201_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004899452.1|544473_545175_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068814727.1|545189_547046_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016531337.1|547334_548687_-	molecular chaperone	NA	NA	NA	NA	NA
WP_023282839.1|548824_549673_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_002912442.1|549787_550429_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|550519_551101_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_031591026.1|551131_552979_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_068814730.1|553210_554794_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_086910769.1|555559_556450_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
WP_031591033.1|556842_557472_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068814731.1|558431_559871_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_031591037.1|560016_561150_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024177910.1|561155_561590_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_068814732.1|561606_563769_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068814733.1|563841_565272_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_068814736.1|565295_566759_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023322974.1|566751_567882_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031591043.1|567890_568985_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_159080874.1|569529_569955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549031.1|570197_571472_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	46.5	1.4e-97
WP_158414492.1|571492_571654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322969.1|572585_573737_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001118616.1|573920_574844_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_031591050.1|574948_576355_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_068814737.1|576542_577466_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	2.7e-175
WP_004180506.1|577646_579062_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004899416.1|579082_580453_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_031589093.1|580616_581783_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_031589100.1|581975_582983_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
WP_004144151.1|583551_583674_-	small membrane protein	NA	NA	NA	NA	NA
WP_001118616.1|583841_584765_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|585614_586640_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118527.1|586958_587882_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002912373.1|590131_590899_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912371.1|590898_591639_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_068814743.1|591654_593550_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_068814745.1|593565_594720_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.7	8.5e-78
WP_031589117.1|594716_595610_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071549005.1|595807_596731_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
WP_031589124.1|597914_599123_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
WP_001118616.1|599208_600132_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 2
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	687469	697016	5275382	transposase	Burkholderia_phage(33.33%)	9	NA	NA
WP_001118616.1|687469_688393_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_002911596.1|688572_689718_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|690256_690538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|690580_691288_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004200343.1|691331_692765_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_004200342.1|692745_693240_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_004899215.1|693214_694126_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|694309_695221_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_040183072.1|695336_697016_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 3
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	836491	930428	5275382	holin,portal,plate,tail,capsid,terminase,transposase,head,protease,integrase	Vibrio_phage(29.11%)	114	846599:846616	901631:901648
WP_004175481.1|836491_837238_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|837717_838575_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004200323.1|838730_839711_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|839703_840504_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|840541_840664_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_002910764.1|841281_842223_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|842316_843306_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|843331_844663_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|844690_845899_+	propionate kinase	NA	NA	NA	NA	NA
WP_068814843.1|845927_848222_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
846599:846616	attL	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_058228726.1|848652_849768_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|849877_850792_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_068814845.1|850801_852088_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|852084_852960_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_068814850.1|852956_853676_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|853681_854575_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|854858_856502_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|856551_857028_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|857126_858053_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|858356_859652_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_068814852.1|859666_860473_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065803155.1|860713_861976_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
WP_016244760.1|862018_862264_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_029497927.1|862481_863231_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
WP_023312753.1|863227_863452_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_123640128.1|863683_863905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048265752.1|863975_864269_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_159080877.1|864937_865081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068814854.1|865422_866019_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
WP_048289165.1|866127_866340_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068814858.1|866360_866681_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_047666494.1|866876_867131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814860.1|867127_868222_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
WP_068814862.1|868248_868644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|868643_868865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814864.1|868857_869643_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
WP_040209280.1|870294_870558_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_068814868.1|870999_871275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161787.1|872139_872874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065520066.1|873905_874499_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
WP_068814873.1|874495_875266_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
WP_077269504.1|875262_875907_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
WP_068814875.1|875903_876503_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
WP_068814876.1|877140_877410_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
WP_068815639.1|877387_877888_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
WP_068814877.1|877884_878376_+	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
WP_068814879.1|878477_878828_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
WP_032424502.1|879139_879445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549025.1|879459_879810_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
WP_004884285.1|879939_880434_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_068814881.1|880430_882161_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_068814883.1|882355_883585_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
WP_068814885.1|883571_884225_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
WP_068814887.1|884239_885448_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
WP_077269505.1|885474_885690_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
WP_040186339.1|885686_886007_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004899632.1|886076_886274_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004899631.1|886275_886608_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
WP_032437723.1|886600_887140_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
WP_068814891.1|887136_887502_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
WP_000115125.1|887558_888050_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_001177591.1|888093_888447_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_031591515.1|888479_888743_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
WP_068814894.1|888807_889275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814896.1|889319_891764_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
WP_004207036.1|891763_892234_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_068814899.1|892230_892713_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
WP_064143746.1|892723_893104_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_159080878.1|893100_893241_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	93.3	1.8e-19
WP_048981108.1|893467_894031_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|894212_894437_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_004114537.1|896569_897517_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
WP_004114539.1|897521_897761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|897763_898051_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_064355300.1|898066_898684_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.6e-65
WP_068814901.1|898764_899262_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
WP_068814903.1|899221_899698_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
WP_068814905.1|899694_900249_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
WP_064176649.1|900245_900635_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
WP_141769813.1|900643_900907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|900911_901928_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
901631:901648	attR	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_068814908.1|902423_903002_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
WP_019704473.1|903004_903223_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
WP_068814910.1|903215_903623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814912.1|903610_904216_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
WP_068814914.1|904212_904443_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114566.1|904423_904726_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_004114568.1|904735_905023_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_068814916.1|905025_905301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114570.1|905290_905869_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
WP_068814917.1|905865_907455_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
WP_068814918.1|907454_909026_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
WP_023301732.1|909018_909861_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
WP_108676103.1|910049_911066_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
WP_068814921.1|911068_911968_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
WP_068814923.1|912044_912551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114585.1|912550_912991_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
WP_048981146.1|912990_913533_+	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
WP_068814926.1|913529_914141_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
WP_049086219.1|914143_914353_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_068814930.1|914354_915836_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
WP_068814932.1|915845_916199_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
WP_068814934.1|916202_916586_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
WP_068814936.1|916684_918493_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
WP_068814938.1|918492_919749_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
WP_068814940.1|919741_920833_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
WP_068814944.1|920823_921363_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
WP_068814946.1|921359_921812_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_068814950.1|921798_922875_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
WP_068814952.1|922859_923444_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
WP_068814954.1|923446_924259_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
WP_068814956.1|924258_925134_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
WP_068814961.1|925143_927129_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
WP_068814965.1|927494_930428_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 4
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	1481327	1492215	5275382		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1481327_1481948_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|1481940_1483206_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|1483217_1484120_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1484381_1485143_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023280043.1|1485163_1486024_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|1486321_1486582_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|1486668_1487757_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|1487787_1489053_-	MFS transporter	NA	NA	NA	NA	NA
WP_014907638.1|1489107_1492215_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	1933697	1990136	5275382	plate,portal,tail,capsid,terminase,tRNA,transposase,head,integrase	Enterobacteria_phage(51.43%)	62	1963896:1963955	1989157:1990213
WP_002901088.1|1933697_1934198_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|1934314_1934761_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|1934744_1935536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068815126.1|1935637_1936822_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|1936853_1937546_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|1937691_1938201_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|1938187_1938544_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190888.1|1938533_1938773_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004213128.1|1939037_1939289_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_068815128.1|1939332_1940472_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
WP_068815130.1|1940626_1941799_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
WP_032414481.1|1941798_1942314_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_004131585.1|1942359_1942677_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|1942676_1942835_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_068815132.1|1942821_1945797_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
WP_032457467.1|1945811_1946303_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
WP_068815134.1|1946618_1948106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457351.1|1948355_1949453_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
WP_009486478.1|1949452_1949665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815136.1|1949661_1952688_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
WP_068815138.1|1952677_1953601_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
WP_004131573.1|1953602_1953953_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_068815140.1|1953949_1954537_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
WP_068815142.1|1954533_1955169_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_068815144.1|1955165_1955633_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
WP_159080880.1|1955633_1955969_-	peptidase	NA	B6SD31	Bacteriophage	33.3	1.2e-05
WP_023339943.1|1956155_1956701_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|1956697_1956982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|1956972_1957173_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023339940.1|1957172_1957688_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_068815146.1|1957800_1958658_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
WP_004213107.1|1958707_1959742_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_068815147.1|1959751_1960591_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
WP_068815148.1|1960747_1962475_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
WP_050597847.1|1962468_1963530_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
1963896:1963955	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_001118616.1|1963951_1964875_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_068815150.1|1965195_1966020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815152.1|1966389_1966749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549017.1|1966998_1968738_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_068815154.1|1971437_1972454_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
WP_068815155.1|1972727_1973294_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
WP_004213098.1|1973290_1973515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213097.1|1973583_1973856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815159.1|1973871_1974249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328080.1|1974264_1974483_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|1974503_1974782_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_068815161.1|1974902_1975202_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
WP_068815163.1|1975317_1976331_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
WP_068815165.1|1976565_1977579_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
WP_004150782.1|1977636_1977738_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|1977737_1977812_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|1977929_1978055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1978114_1978378_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1978508_1979147_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|1979236_1980151_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|1980811_1981855_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|1982157_1983366_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023279889.1|1983439_1985224_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_068815169.1|1985230_1986121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|1986241_1987750_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|1988060_1988747_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001118616.1|1989212_1990136_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
1989157:1990213	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGTGTCAGTGAACCTCCGAACAGCTGTTTTACCCGGTACATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCATTCGCTGATTAGCCACTGCACGGTTACGGTCTGCATATTCACCGGGCCAGTAACCCGCACCTTTTCGGGGTGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACAGAGCCGGGTGTCGTAAGCGCCGTCTGCCGATGCTGCCCTGATTTTTCTGTGAGTCTGCCGGATAAGACCCGGGAAGGCTTCTGAGTCCGTCACATTGTTCAGCGACAGGTCAGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATACGGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGGTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGACATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGTAGCGGAACGTTCATCAGAGAAAAAATGGAATCAATAAAGCCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAGAAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	2241337	2250800	5275382	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_023279659.1|2241337_2243059_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_002898014.1|2243103_2243805_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2244158_2244377_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2244496_2246776_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2246806_2247124_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2247449_2247671_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2247747_2249688_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2249684_2250800_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	2701863	2776083	5275382	holin,plate,portal,tail,head,capsid,terminase,tRNA,transposase,integrase	Enterobacteria_phage(19.57%)	90	2723604:2723650	2768455:2768501
WP_002892491.1|2701863_2703381_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|2703712_2705188_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|2705247_2707395_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|2707477_2708812_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_004147422.1|2709177_2710746_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892402.1|2711038_2711311_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|2711411_2712332_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_004211259.1|2712842_2713709_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004147417.1|2713731_2714757_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023279772.1|2714758_2717194_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012068380.1|2717204_2717900_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004151792.1|2717958_2718519_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_020804404.1|2718990_2719653_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892375.1|2719630_2719936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|2719988_2721293_-	citrate synthase	NA	NA	NA	NA	NA
WP_002892370.1|2721803_2721974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|2722052_2722454_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|2722849_2723143_-	hypothetical protein	NA	NA	NA	NA	NA
2723604:2723650	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_074192281.1|2723805_2724012_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
WP_071549009.1|2725354_2726200_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068815281.1|2726201_2728145_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_025713552.1|2728562_2728877_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
WP_141769812.1|2729034_2729580_-	hypothetical protein	NA	A0A291LCK3	Klebsiella_phage	38.1	6.3e-15
WP_004176137.1|2729560_2730592_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_068815285.1|2730675_2730855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713554.1|2730907_2731504_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
WP_065954093.1|2731500_2732649_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
WP_068815287.1|2732638_2733088_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
WP_065954091.1|2733084_2733666_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049268057.1|2733662_2734748_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
WP_068815289.1|2734744_2736145_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_068815295.1|2736191_2738045_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|2738186_2738465_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896639.1|2738466_2738838_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068815297.1|2738841_2740353_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
WP_071549008.1|2740357_2740534_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065954087.1|2740536_2741082_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_068815298.1|2741078_2741438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815299.1|2741442_2741823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815300.1|2741824_2742874_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
WP_068815301.1|2742972_2743380_-|head	head decoration protein	head	NA	NA	NA	NA
WP_068815304.1|2743379_2743970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210580.1|2743971_2744838_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
WP_068815306.1|2744834_2746469_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
WP_000483310.1|2746468_2746732_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_068815311.1|2746740_2748867_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
WP_068815313.1|2748808_2749390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954080.1|2749651_2750290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954079.1|2750385_2750592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815315.1|2750825_2751215_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
WP_064148680.1|2751211_2751709_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
WP_064782731.1|2751686_2751956_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_068815318.1|2752499_2753183_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
WP_009308007.1|2753179_2753320_-	YlcG family protein	NA	NA	NA	NA	NA
WP_068815320.1|2753316_2753955_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
WP_068815322.1|2753947_2754616_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
WP_012542614.1|2754612_2754780_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
WP_068815323.1|2754760_2755228_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
WP_071549007.1|2755509_2755731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269509.1|2755911_2756760_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
WP_068815324.1|2756756_2757137_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
WP_077269510.1|2757136_2757970_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
WP_046181580.1|2757966_2758173_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_068815326.1|2758169_2758571_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
WP_064146426.1|2758567_2758870_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068815328.1|2758866_2759715_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_068815329.1|2760878_2761199_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
WP_019704103.1|2761248_2761464_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
WP_068815331.1|2761563_2762196_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
WP_008807814.1|2762632_2762839_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_068815333.1|2762920_2763205_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
WP_068815335.1|2763221_2763968_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
WP_068815338.1|2763964_2764588_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_032426563.1|2764616_2765144_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
WP_068815340.1|2765357_2765702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815341.1|2765694_2766372_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
WP_040217354.1|2766368_2766596_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
WP_068815344.1|2766592_2766814_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_064344914.1|2766813_2767053_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
WP_071549006.1|2767065_2767401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068815346.1|2767277_2768441_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	6.6e-203
WP_004143017.1|2768871_2769738_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2768455:2768501	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_023279775.1|2769739_2769952_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2769997_2771383_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|2771558_2772053_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004178782.1|2772056_2772779_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004178781.1|2772886_2773225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178780.1|2773321_2773831_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|2773827_2774895_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068815347.1|2775006_2776083_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP028990	Klebsiella pneumoniae strain AR_0142 chromosome, complete genome	5275382	2780582	2845723	5275382	tRNA,transposase,protease	Escherichia_phage(28.57%)	59	NA	NA
WP_020316413.1|2780582_2781209_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004177222.1|2781237_2782008_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012737523.1|2782066_2782921_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004177223.1|2783028_2783811_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_004177224.1|2783797_2784475_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_002892258.1|2784615_2785533_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004142979.1|2785529_2785988_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|2785984_2786395_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023279233.1|2786501_2789003_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	4.7e-113
WP_004151327.1|2789134_2789929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892205.1|2790131_2790611_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002892203.1|2790716_2792369_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004147385.1|2792638_2793859_+	MFS transporter	NA	NA	NA	NA	NA
WP_002892195.1|2794084_2795761_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002892192.1|2795796_2797101_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_002892189.1|2797164_2798127_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002892184.1|2798255_2798900_-	adenylate kinase	NA	NA	NA	NA	NA
WP_004177228.1|2799122_2800997_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_002892177.1|2801108_2801714_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|2801713_2802046_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004147381.1|2802103_2804011_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_004177230.1|2804103_2804655_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|2804805_2805183_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|2805252_2805780_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|2805792_2805966_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_023279779.1|2806033_2806933_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
WP_004177234.1|2806968_2810316_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_002892080.1|2810445_2811096_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_004177236.1|2811238_2812432_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_002892069.1|2812454_2815601_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|2816086_2816461_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|2816487_2816706_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|2816864_2817431_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892026.1|2817563_2818034_+	membrane protein	NA	NA	NA	NA	NA
WP_021313732.1|2818008_2819460_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|2819560_2820259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|2820255_2820396_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|2820395_2820659_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|2820774_2821845_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_004177240.1|2822115_2823387_+	maltoporin	NA	NA	NA	NA	NA
WP_002892003.1|2823523_2823838_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_023279781.1|2823902_2825960_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_064174663.1|2825991_2827194_-	galactosidase	NA	NA	NA	NA	NA
WP_004204761.1|2827198_2828050_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279783.1|2828060_2829368_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279784.1|2829430_2830663_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_068815348.1|2831019_2832129_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
WP_068815349.1|2832362_2833922_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002891985.1|2833956_2834229_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_023279787.1|2834393_2835257_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_068815351.1|2835301_2835898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|2835941_2836865_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|2837204_2838230_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004142688.1|2839858_2840074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147352.1|2840070_2840328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|2841236_2842262_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118616.1|2842601_2843525_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_071549005.1|2843826_2844750_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
WP_071549004.1|2844793_2845723_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	3.5e-175
>prophage 1
NZ_CP028991	Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence	85698	0	6440	85698		Enterobacteria_phage(66.67%)	5	NA	NA
WP_004152349.1|975_2181_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|2177_3152_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|3528_3861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|4085_4301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|4412_6440_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
NZ_CP028991	Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence	85698	11015	73103	85698	integrase,protease,transposase	Escherichia_phage(33.33%)	56	37309:37353	62651:62695
WP_004152342.1|11015_12284_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12403_12877_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|12968_13199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14090_14873_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|14872_15205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15211_15568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15635_15965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|15992_16301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16346_16553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|17217_17448_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|17444_17861_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016338369.1|19437_20715_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016338368.1|20704_22813_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338367.1|22812_23448_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_058650054.1|23555_23900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310051.1|24466_24730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|24911_25616_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_022631488.1|25769_26585_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
WP_000954592.1|26914_27091_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|27272_28277_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|30707_31412_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|31652_32357_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|32535_33300_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|33560_34775_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|34808_36242_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|36623_36830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|36834_37347_-	restriction endonuclease	NA	NA	NA	NA	NA
37309:37353	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTT	NA	NA	NA	NA
WP_001067855.1|38148_38853_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087759376.1|38950_40070_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_022631495.1|40117_40756_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
WP_004098982.1|41167_42043_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004098977.1|42667_43294_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_006788217.1|43413_43593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|45471_46980_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227969.1|47521_48598_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020324562.1|49310_50015_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_063840321.1|50158_50713_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|50904_51609_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550555.1|51754_52045_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
WP_001067855.1|52616_53321_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001144737.1|53408_53675_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|53895_54369_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|54524_55538_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|55930_56500_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_004201235.1|57256_58726_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_004201234.1|59245_59983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201232.1|60120_60807_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020324562.1|62713_63418_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
62651:62695	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTT	NA	NA	NA	NA
WP_001039463.1|64169_64556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071549085.1|64564_64705_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004199413.1|64837_67855_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004152657.1|68351_68783_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152656.1|68828_70838_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
WP_004152655.1|70906_71149_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152654.1|71196_71709_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_004152756.1|72539_73103_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 3
NZ_CP028991	Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence	85698	76242	85055	85698		Pectobacterium_phage(16.67%)	13	NA	NA
WP_011977779.1|76242_76497_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|76684_76876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568046.1|76918_77425_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_004152356.1|77467_77896_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001568044.1|78575_79343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|79396_79816_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|79825_80047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|80046_80748_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568040.1|81184_81415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|81475_82147_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|82149_83121_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|83352_83784_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|83783_85055_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
>prophage 1
NZ_CP028992	Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence	68953	8763	64426	68953	capsid,terminase,portal,head,tail	Klebsiella_phage(85.71%)	52	NA	NA
WP_071042649.1|8763_9555_+	hypothetical protein	NA	O64341	Escherichia_phage	88.9	2.0e-134
WP_108720610.1|11911_13834_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	95.0	0.0e+00
WP_071042649.1|13888_14680_-	hypothetical protein	NA	O64341	Escherichia_phage	88.9	2.0e-134
WP_064161276.1|14676_14907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413547.1|14903_15068_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_102811957.1|15427_15811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103433624.1|15800_16373_-	DUF5448 family protein	NA	Q6UAU9	Klebsiella_phage	89.7	5.5e-86
WP_108720608.1|16490_16787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108720611.1|16779_20784_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_087731832.1|21034_21643_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	3.6e-104
WP_032408972.1|21723_21933_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408971.1|21922_22660_+	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_032408969.1|23071_23680_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	1.7e-98
WP_023339397.1|24280_24526_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_032408968.1|24518_24845_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
WP_023339395.1|24865_25093_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|25489_25777_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|25776_26085_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339391.1|26255_26477_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_032408967.1|26488_26716_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_023339389.1|26986_28048_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
WP_040118543.1|28106_28418_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	88.1	1.8e-43
WP_040118544.1|28414_28906_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	1.9e-82
WP_040118545.1|28922_29399_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_117037470.1|29346_29541_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408961.1|29652_29952_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_023339408.1|30121_31198_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	9.8e-36
WP_032414214.1|31181_31544_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
WP_023339407.1|31540_31825_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
WP_023339406.1|31821_32253_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	2.9e-39
WP_048993238.1|32755_33190_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.1	5.3e-73
WP_032408956.1|33224_34934_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
WP_048336123.1|35106_36366_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.8e-223
WP_048993239.1|36402_37323_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.8e-148
WP_108720612.1|37400_38687_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.3	2.0e-205
WP_047722540.1|38943_39141_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
WP_020317538.1|39121_39439_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|39435_39774_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|39754_40144_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|40140_40542_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|40573_41035_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023339374.1|41091_41457_+	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	88.5	8.1e-51
WP_023339373.1|41689_45070_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	71.6	0.0e+00
WP_017898999.1|45069_45408_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_020803197.1|45404_46160_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_023339372.1|46161_46872_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	6.5e-137
WP_021462612.1|46903_47254_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	38.1	3.9e-10
WP_014228919.1|47269_47881_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_108720613.1|47943_60648_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.9	0.0e+00
WP_108720614.1|60716_62216_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.1	1.9e-146
WP_023339380.1|62294_63260_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
WP_023339381.1|63262_64426_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
>prophage 1
NZ_CP028993	Klebsiella pneumoniae strain AR_0142 plasmid unnamed3, complete sequence	49476	27833	40362	49476	integrase	Escherichia_phage(33.33%)	12	22974:23033	46474:47294
22974:23033	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001776119.1|27833_28361_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|28393_28825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|29304_30270_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004152765.1|30739_32224_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|32632_33064_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|33063_34335_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|34416_35394_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|35390_36596_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|37010_37280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|37636_38503_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|39270_39528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|39585_40362_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
46474:47294	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTATTGCGTGACGTAGATTCGTGACGTATAGTTACTGCAACTTATTTGTTTATAACTACCGTCAGGTACAAAATTATGTCTCCCGTACAAGCTAAACAAAAGCAGCATGAACGCTACGAAGCCGTAGCGGTGCAGGTTTTGCGTGGTCGTGCCGGTTACAAACCTGCCGTGAAAAGCCGCTTCAGTAAGTCAGCTAGTAGCAAATTCGCTCATACTATCGCTTTTGCCTGATCCTGAACTTTGAGGCACAATAAACCATCATTCGCTGATGGTTTTTTTATGCCTGTTCAAGACGTTATTCCCCCCTATGAGCAGATGTACCTGCTAAATCAGCAGCTGATCTGCAACGCTGATCAGTTCAAACATGCCGTTATCACAGTTGGCGGTCAGGCTGTGCAATACTGGATATCCTATTATCATGCACAATACGGCGACAGATTGCCTGATGAGCGCCTCACCACATCTGTTGACTGCGACTACAGCGCCCGGAAAGATGATATTGCGGCTATAGCAAAAACGCTCAACGTTAAGACGTGGGAGAACAAAGACGGTCAGCCCCCATCCCTTGCGCAGTTTATGCTTATCGATCAGGATACACACGATATCAAACGGGATGATGGACGCTTATTTGCCGTACCGGATGCGCCTGACGAGCCAAATGTGGTGGATATTATCGACCGCCCCGGAGGCTTTGACCGTTCTGATTTTCAGGGGAAAAAGCTTTACCTGTATACCGCCCCGTTTTATGTAGAAGCAACCG	NA	NA	NA	NA
