The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	313	7218	5319773	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|313_1792_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1788_2511_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|2829_4191_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|4436_5330_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|5570_6344_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|6354_7218_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 2
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	206112	266044	5319773	tRNA,terminase,holin,protease,portal,head,capsid,tail	Enterobacteria_phage(17.78%)	69	NA	NA
WP_009307375.1|206112_206925_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|206924_207938_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009307374.1|208001_209138_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_023282884.1|209248_210226_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|210312_211488_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|211697_212918_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023301691.1|213076_215065_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|215126_215408_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|215439_215988_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|215987_216797_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|216796_217621_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_023287874.1|217623_218709_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	7.7e-89
WP_040181913.1|218750_219683_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|219850_220402_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|220422_220908_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004174952.1|221117_223262_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|223261_224572_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|224731_225016_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_004149222.1|225383_226712_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|226773_227535_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|227824_228754_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
WP_032422721.1|228960_229332_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
WP_019705521.1|229288_229528_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
WP_077255527.1|230078_230531_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_019705523.1|230620_230980_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190607.1|231631_232054_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	8.0e-26
WP_074177881.1|232131_232314_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
WP_040181868.1|232325_233126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181865.1|235171_238249_-	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_040181864.1|238245_238626_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_040181862.1|238638_239115_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	63.9	3.4e-49
WP_004884312.1|239101_239575_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_040181859.1|239596_242983_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	4.7e-302
WP_016530182.1|243043_243277_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_004177139.1|243350_243656_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_021313622.1|243658_244063_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_040181857.1|244093_244798_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_016530186.1|244854_245202_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|245198_245648_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_019705271.1|245644_245983_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705272.1|245991_246309_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_040181854.1|246386_247625_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	3.9e-153
WP_000999827.1|247634_248234_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_000923127.1|248226_249453_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_064162524.1|249600_251352_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.0	3.3e-251
WP_001119413.1|251355_251853_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_040181844.1|252011_252362_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	4.1e-52
WP_040181841.1|252434_252890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077256034.1|252925_253051_-	hypothetical protein	NA	M1FJ79	Enterobacteria_phage	66.7	2.4e-07
WP_040181839.1|253088_253277_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	77.0	3.2e-19
WP_040181834.1|253537_253813_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.6	1.0e-05
WP_040181832.1|253815_254445_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	2.5e-87
WP_000243811.1|254444_254726_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|254712_255099_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_094083851.1|255338_255944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181825.1|256050_256629_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_040181823.1|256642_257623_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	8.4e-135
WP_040181820.1|257635_258013_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_040181816.1|258022_258832_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	1.3e-109
WP_060618150.1|258828_259743_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_071557781.1|259699_259912_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_004213338.1|260149_260611_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|260636_260834_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|260938_261586_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_040181807.1|262432_262732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181805.1|262731_263517_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	7.6e-62
WP_040181802.1|263516_264593_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.8	1.5e-148
WP_040181799.1|265184_265397_+	hypothetical protein	NA	R9TNC2	Aeromonas_phage	97.1	8.6e-37
WP_040181798.1|265396_266044_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.3	1.2e-44
>prophage 3
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	2951523	3004359	5319773	tRNA,terminase,holin,protease,portal,head,capsid,integrase,tail	Klebsiella_phage(42.86%)	75	2964233:2964279	3004831:3004877
WP_002892267.1|2951523_2952150_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004146399.1|2952117_2952804_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
WP_004183225.1|2952800_2955215_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142997.1|2955396_2956542_+	porin	NA	NA	NA	NA	NA
WP_004151323.1|2956649_2957726_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_040182117.1|2957837_2958905_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_020802618.1|2958901_2959411_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004893771.1|2959507_2959846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151320.1|2959953_2960676_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|2960679_2961174_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|2961349_2962735_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2962780_2962993_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2962994_2963861_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2964233:2964279	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_021441323.1|2964292_2965456_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_071531921.1|2965332_2965668_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040182114.1|2965669_2965888_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_040182113.1|2965884_2966412_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182112.1|2966440_2967064_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182110.1|2967060_2967807_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182107.1|2967823_2968108_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_069914298.1|2968115_2969087_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	2.3e-39
WP_008807814.1|2969167_2969374_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_061355324.1|2969810_2970014_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.9e-18
WP_032429932.1|2970379_2970745_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	49.1	1.3e-19
WP_020804196.1|2971006_2971126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191591.1|2971186_2971846_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
WP_004191589.1|2971954_2972173_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_043875707.1|2972212_2972434_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_024622726.1|2972519_2973317_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
WP_064155319.1|2973376_2974342_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.0	2.6e-64
WP_040181695.1|2974338_2975076_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|2975072_2975375_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|2975371_2975794_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_040181701.1|2975790_2976051_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|2976582_2976795_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|2977423_2977837_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_040181178.1|2978337_2978793_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
WP_040181180.1|2978792_2978963_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
WP_040181182.1|2978955_2979594_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_040181184.1|2979590_2979731_+	YlcG family protein	NA	NA	NA	NA	NA
WP_040181186.1|2979727_2980537_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_031281242.1|2980915_2981173_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_032416155.1|2981078_2981525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|2982087_2982483_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|2982469_2982751_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_058842802.1|2982750_2983380_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.7e-104
WP_020317342.1|2983387_2983663_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	1.4e-15
WP_032420712.1|2983613_2983805_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	3.2e-22
WP_032426434.1|2983836_2984037_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
WP_004216876.1|2984101_2984347_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_023301206.1|2984418_2984625_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	5.1e-34
WP_017880218.1|2984696_2984987_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	99.0	1.4e-53
WP_017880219.1|2984999_2985209_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|2985330_2985765_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|2985774_2987307_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|2987309_2988587_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077254200.1|2988592_2989273_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_058842800.1|2989284_2990448_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	3.1e-213
WP_044067369.1|2990484_2990727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|2990674_2991001_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|2991061_2991259_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_004184710.1|2991260_2991593_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|2991585_2992125_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_000561415.1|2992121_2992487_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|2992543_2993035_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|2993078_2993462_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004899621.1|2993464_2993728_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	90.8	7.9e-40
WP_058842799.1|2993791_2994169_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_058842798.1|2994230_2996777_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.6	0.0e+00
WP_004899614.1|2996776_2997256_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|2997242_2997725_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|2997734_2998115_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_058842797.1|2998111_3001171_+	kinase	NA	A0A286S259	Klebsiella_phage	91.0	0.0e+00
WP_071854268.1|3003213_3004014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181289.1|3004119_3004359_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
3004831:3004877	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	3734329	3803945	5319773	tRNA,terminase,plate,portal,head,capsid,integrase,tail	Enterobacteria_phage(51.43%)	80	3761525:3761542	3798701:3798718
WP_004150803.1|3734329_3735436_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|3735492_3735951_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|3735967_3736618_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|3736858_3738109_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004213085.1|3738381_3739095_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|3739091_3739484_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|3739476_3739800_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_019704434.1|3740042_3740228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|3740248_3740476_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|3740588_3741782_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_137013050.1|3741997_3742186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|3742405_3742591_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|3742681_3743176_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|3743202_3743709_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|3743725_3744613_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|3744668_3746075_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|3746071_3747082_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|3747197_3747395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3747961_3748594_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153236426.1|3748572_3748761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3749210_3749897_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023302066.1|3750207_3751716_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|3751836_3752727_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302065.1|3752733_3754518_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|3754591_3755800_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|3756102_3757146_+	type II asparaginase	NA	NA	NA	NA	NA
WP_023302064.1|3757807_3758722_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|3758811_3759450_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|3759580_3759844_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|3759903_3760029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892898.1|3760146_3760221_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|3760220_3760322_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|3760379_3761393_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3761525:3761542	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_040181453.1|3761657_3762641_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004213095.1|3762756_3763056_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|3763176_3763455_+	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|3763475_3763694_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_040181449.1|3763709_3764087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|3764102_3764375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|3764443_3764668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329528.1|3764664_3765231_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_040181444.1|3765463_3766420_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_040181442.1|3769309_3771580_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181440.1|3771579_3772371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289843.1|3773215_3774277_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181438.1|3774270_3775998_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_040181436.1|3776154_3776994_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_023328071.1|3777003_3778038_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181433.1|3778087_3778945_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_040181431.1|3779057_3779573_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_004131559.1|3779572_3779773_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213110.1|3779763_3780048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339943.1|3780044_3780590_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_158246032.1|3780776_3781112_+	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_040181428.1|3781112_3781580_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020316957.1|3781576_3782212_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|3782208_3782796_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_040181426.1|3782792_3783143_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_023300878.1|3783144_3784068_+	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181424.1|3784057_3787084_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023339950.1|3787080_3787293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181419.1|3787292_3788390_+|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_052450975.1|3788989_3790213_+	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181417.1|3790230_3790893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181415.1|3791356_3791830_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181412.1|3791845_3794821_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_075604421.1|3794807_3794966_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_004131585.1|3794965_3795283_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|3795328_3795844_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_040181409.1|3795843_3797016_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_040181406.1|3797170_3798310_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_004213128.1|3798353_3798605_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004176548.1|3798869_3799109_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3798701:3798718	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_004150779.1|3799098_3799455_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_020802835.1|3799441_3799951_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|3800096_3800789_+	CTP synthase	NA	NA	NA	NA	NA
WP_004148041.1|3800820_3802005_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|3802106_3802898_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3802881_3803328_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004892876.1|3803444_3803945_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	3923317	3938949	5319773	integrase	Salmonella_phage(50.0%)	22	3920241:3920254	3939320:3939333
3920241:3920254	attL	ATGGTGACGGTGCG	NA	NA	NA	NA
WP_004140269.1|3923317_3924127_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|3924128_3925121_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|3925120_3926011_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_086528371.1|3926187_3927375_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004892750.1|3927595_3927835_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_048289847.1|3927842_3928151_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
WP_016160779.1|3928147_3928759_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_004190719.1|3928751_3929090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289848.1|3929124_3930234_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_048289849.1|3930246_3933285_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.2	1.0e-292
WP_012967861.1|3933422_3933578_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_004179600.1|3933586_3933778_-	YebW family protein	NA	NA	NA	NA	NA
WP_101516259.1|3933884_3933983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050485525.1|3934166_3934601_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_023320775.1|3934705_3934933_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_032445502.1|3934935_3935472_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.9	6.3e-60
WP_004215886.1|3935822_3936743_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_004215885.1|3936739_3937483_+	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
WP_032423776.1|3937475_3937844_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_019705292.1|3937840_3938044_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_032445503.1|3938036_3938273_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	90.7	7.1e-32
WP_032445505.1|3938748_3938949_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	57.5	3.2e-09
3939320:3939333	attR	CGCACCGTCACCAT	NA	NA	NA	NA
>prophage 6
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	3943381	3964624	5319773	terminase,holin,tail	Pseudomonas_phage(30.0%)	26	NA	NA
WP_086528372.1|3943381_3943981_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	3.8e-90
WP_048289850.1|3944189_3944771_+	protein ninG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
WP_086528373.1|3944767_3944908_+	YlcG family protein	NA	NA	NA	NA	NA
WP_048289851.1|3944904_3945726_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
WP_024176410.1|3946483_3946783_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_004184488.1|3946779_3947319_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_048289852.1|3947315_3947660_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	2.6e-38
WP_004190672.1|3947656_3947932_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_048289853.1|3949020_3950016_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_016946682.1|3949999_3951313_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_048267898.1|3951314_3952715_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_048289854.1|3952698_3953811_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	1.6e-110
WP_048289855.1|3954323_3955103_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.0	2.7e-67
WP_048289856.1|3955113_3956067_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	6.5e-132
WP_133060713.1|3956075_3956348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048289857.1|3956388_3956784_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	4.3e-13
WP_048289858.1|3956785_3957040_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	3.0e-20
WP_072072127.1|3957049_3957283_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	6.4e-09
WP_048289859.1|3957269_3957653_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	1.6e-20
WP_012967909.1|3957654_3958206_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_012967910.1|3958202_3958595_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_048289860.1|3958618_3959791_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_012967912.1|3959845_3960328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967913.1|3960465_3960663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129693861.1|3960730_3961129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077264109.1|3961708_3964624_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.2	4.9e-90
>prophage 7
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	4234882	4245770	5319773		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4234882_4235503_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_032423485.1|4235495_4236761_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|4236772_4237675_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4237936_4238698_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|4238718_4239579_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|4239876_4240137_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_040182017.1|4240223_4241312_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176258.1|4241342_4242608_-	MFS transporter	NA	NA	NA	NA	NA
WP_040182019.1|4242662_4245770_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP024038	Klebsiella pneumoniae strain QS17-0029 chromosome, complete genome	5319773	4902790	4986082	5319773	tRNA,terminase,plate,lysis,head,integrase,coat,tail	Escherichia_phage(21.05%)	95	4938001:4938016	4985472:4985487
WP_004891136.1|4902790_4904047_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4904317_4904929_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004891134.1|4904925_4905777_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4905960_4906908_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004189412.1|4907032_4908712_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_023301802.1|4908713_4909760_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4909980_4910256_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_009307591.1|4910528_4911113_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4911230_4912322_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004145442.1|4912402_4912732_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|4912815_4913730_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048289900.1|4913861_4915277_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|4915296_4915740_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019704158.1|4915742_4916285_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|4916259_4917306_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_040181246.1|4917305_4919069_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029498250.1|4919202_4922169_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181245.1|4922633_4923845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108702443.1|4923849_4924077_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032413757.1|4924911_4925319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148791.1|4925811_4926708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342696.1|4926722_4928750_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_009307584.1|4928752_4931380_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_009307583.1|4931838_4933536_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004175498.1|4933539_4934193_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307582.1|4934189_4935530_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|4936095_4936425_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|4936494_4937079_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4937104_4937803_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_048289904.1|4937994_4938477_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
4938001:4938016	attL	ATGAACGGAACAATCA	NA	NA	NA	NA
WP_074422971.1|4939451_4939658_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	1.9e-09
WP_040181289.1|4939767_4940007_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_108702444.1|4940112_4940913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094083855.1|4943001_4945479_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	5.1e-197
WP_094083854.1|4945465_4945861_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	9.5e-37
WP_032419293.1|4945857_4946328_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_075208395.1|4946327_4946747_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_071854269.1|4946917_4947331_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|4947350_4947530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181305.1|4947570_4950141_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	8.5e-94
WP_071854270.1|4950232_4950703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255485.1|4950758_4951010_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
WP_094083853.1|4951192_4951666_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_023339090.1|4951634_4951832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181310.1|4951978_4952536_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
WP_040181312.1|4952753_4953467_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
WP_023339086.1|4954358_4954742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181318.1|4954738_4955107_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_040181321.1|4955109_4955472_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
WP_038434988.1|4955471_4955645_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_032439723.1|4955644_4956025_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_029884066.1|4956027_4956267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094083852.1|4956299_4957355_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.0	2.5e-100
WP_016529582.1|4957351_4957813_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040181327.1|4957812_4959168_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_020804668.1|4959218_4959422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749279.1|4959418_4960432_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
WP_040181330.1|4960349_4961798_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
WP_040181332.1|4961809_4963378_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
WP_069377345.1|4963374_4964025_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	6.2e-102
WP_040181192.1|4964233_4964701_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_040181191.1|4964697_4965201_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_012967717.1|4965203_4965518_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_040181186.1|4966344_4967154_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_040181184.1|4967150_4967291_-	YlcG family protein	NA	NA	NA	NA	NA
WP_065802495.1|4967287_4967926_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	3.2e-74
WP_049089532.1|4967918_4968089_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	3.7e-14
WP_064151812.1|4968094_4968691_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_087750241.1|4969096_4969510_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_004141386.1|4970138_4970351_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_040181701.1|4970882_4971143_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_052450983.1|4971139_4971592_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.6	4.4e-14
WP_040182091.1|4971828_4972122_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_040182092.1|4972118_4972967_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_040182094.1|4972963_4973839_-	replication protein	NA	K7PGT1	Enterobacteria_phage	49.0	3.0e-59
WP_040181693.1|4973925_4974246_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
WP_040182097.1|4974285_4974507_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
WP_029363661.1|4974609_4975305_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
WP_129111273.1|4975324_4975759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4976410_4976605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076996993.1|4976693_4976978_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	2.5e-39
WP_094083903.1|4976993_4977839_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_129693859.1|4977835_4978456_+	hypothetical protein	NA	A0A076GAP8	Staphylococcus_phage	43.8	5.5e-23
WP_040181683.1|4978448_4979135_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_016529279.1|4979131_4979290_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181681.1|4979286_4979814_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_040181679.1|4979810_4980581_+	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_065802489.1|4980797_4981562_+	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
WP_040218332.1|4981558_4981750_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_032431536.1|4981746_4981956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483816.1|4981952_4982171_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_040181674.1|4982174_4982420_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_094083902.1|4982462_4983725_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	2.3e-233
WP_032413763.1|4983965_4984772_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175494.1|4984786_4986082_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
4985472:4985487	attR	ATGAACGGAACAATCA	NA	NA	NA	NA
>prophage 1
NZ_CP024040	Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence	122082	2964	47827	122082	transposase,integrase	Salmonella_phage(30.0%)	38	20:33	7614:7627
20:33	attL	ACCGGAAGACAAGC	NA	NA	NA	NA
WP_004152342.1|2964_4233_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|4352_4826_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|4917_5148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|6039_6822_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|6821_7154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|7160_7517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|7584_7914_-	hypothetical protein	NA	NA	NA	NA	NA
7614:7627	attR	ACCGGAAGACAAGC	NA	NA	NA	NA
WP_004152336.1|7941_8250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|8295_8502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123806157.1|9123_9717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|9857_10886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568022.1|11030_13835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568020.1|14434_15850_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568019.1|15846_17574_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568018.1|18019_18268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632385.1|18264_18837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|18867_19362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|19594_19903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|20396_20945_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|20991_21426_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567368.1|21696_23100_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|23991_24996_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|25074_28041_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|28115_28406_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|28402_28804_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|28793_29150_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|29404_29719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|30145_31327_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|31986_32592_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_000027057.1|36592_37453_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|38152_38977_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|39036_39825_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_063840280.1|39894_40449_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|40682_41240_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|41803_43066_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|43321_44197_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|44243_44576_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|47122_47827_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP024040	Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence	122082	108377	120471	122082		Escherichia_phage(25.0%)	12	NA	NA
WP_004152355.1|108377_109079_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568040.1|109515_109746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322266.1|109808_110480_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_032414078.1|110482_111454_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|111685_112117_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|112116_113388_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|113788_114685_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|115006_116212_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|116208_117183_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|117559_117892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|118116_118332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|118443_120471_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 1
NZ_CP024039	Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ndm, complete sequence	125285	13858	65226	125285	transposase,integrase,protease	Escherichia_phage(37.5%)	47	32717:32776	56612:57084
WP_048266692.1|13858_15130_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	27.6	6.9e-12
WP_001190712.1|17642_17864_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|17863_18244_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|18248_18428_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|18455_18815_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|19101_19419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|19646_20663_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|20870_22274_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|22260_23193_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000361612.1|26346_27324_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066942.1|27608_28349_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|28469_28595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|29794_30964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|31159_31453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|31558_31834_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|31833_32118_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
32717:32776	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000428546.1|35160_35754_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|35866_37072_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_094083863.1|37150_37777_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|37754_38441_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|38448_38835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|38827_39091_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_094083872.1|39845_40115_+	chloramphenicol acetyltransferase	NA	A0A1I9LJQ7	Stx_converting_phage	98.9	4.7e-48
WP_000656305.1|40315_40693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|40759_43726_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|43728_44289_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|44414_44765_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|44967_45981_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|46125_46623_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|46734_47025_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|47030_47822_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|47985_48333_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|48326_49166_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|49570_51112_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|51424_52456_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|52466_53105_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|53109_53475_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|53478_54291_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_001067855.1|54849_55554_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|56864_57266_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
56612:57084	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCGGAACTTCAAAACTGCGCAAAACACGCAAATACGCACAAGAAAGTAGGGCTGCGCTTGGAATTCGGAAAATAAACCACATCAAAACTACTTTTTAGCCAAATAACGTTTGGGAATCACCAGAATGGTGGGACAACAGCGGTTTTAGTGCCCTAAATCGTACGTTTTCATCCAGTTGCCCCTCAAACCCCATGTTCAAGTCAGAATAGTGGACAGGCGGCCAAGAACTTCGTTCATGATAGTCTCCGGAACCCGTTCGAGTCGTTTTCCGCCCCGTGCTTTCATATCAATTGTCCGGGGTTGATCGCAACGTACAACACCTGTGGTACGTATGCCAACACCATCCAACGACACCGCAAAGCCGGCAGTGCGGGCAAAATTGCCTCCGCTGGTTACGGGCACAACAACAGGCAGG	NA	NA	NA	NA
WP_000557619.1|57198_57456_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|57548_58202_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021740570.1|59125_62143_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_000130948.1|62381_63239_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|63231_63306_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083821.1|63541_63799_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000156883.1|64203_65226_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
