The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	0	6855	5140918		Archaeal_BJ1_virus(100.0%)	6	NA	NA
WP_033648252.1|719_1994_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_039566268.1|2098_3376_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_154067230.1|3759_4044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039566272.1|4251_4998_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_039566275.1|5105_6011_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033648247.1|5994_6855_-	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	26.2	5.7e-10
>prophage 2
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	17948	34384	5140918		Tupanvirus(50.0%)	11	NA	NA
WP_033634447.1|17948_20150_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	9.1e-20
WP_060420559.1|20466_20742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125460888.1|20738_21026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139291254.1|21108_22635_+	MchC protein	NA	NA	NA	NA	NA
WP_033648240.1|22653_23094_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_033648239.1|23121_26928_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	25.7	3.3e-33
WP_048321526.1|26927_31073_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.7	1.8e-40
WP_049196799.1|31317_31578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154067229.1|31602_31770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025302730.1|31812_32100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033648237.1|32284_34384_-	peptidase domain-containing ABC transporter	NA	A0A1V0SE00	Indivirus	28.2	7.6e-16
>prophage 3
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	43433	43760	5140918		uncultured_virus(100.0%)	1	NA	NA
WP_033648230.1|43433_43760_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.9	1.2e-24
>prophage 4
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	49013	50153	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_033638454.1|49013_50153_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-24
>prophage 5
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	62004	62694	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_043147414.1|62004_62694_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	33.3	2.2e-17
>prophage 6
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	69355	70264	5140918		Lactobacillus_phage(100.0%)	1	NA	NA
WP_048321521.1|69355_70264_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.1	2.4e-06
>prophage 7
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	100953	101619	5140918		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_033654781.1|100953_101619_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.8	1.4e-08
>prophage 8
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	108409	109684	5140918	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_033648189.1|108409_109684_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	6.7e-84
>prophage 9
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	116701	117223	5140918		Salmonella_phage(100.0%)	1	NA	NA
WP_048321514.1|116701_117223_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	68.6	1.9e-61
>prophage 10
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	128370	136312	5140918		Streptomyces_phage(16.67%)	9	NA	NA
WP_033638376.1|128370_129189_+	C40 family peptidase	NA	A0A2H4PI41	Streptomyces_phage	43.9	7.0e-18
WP_004931333.1|129388_129967_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.4	2.6e-43
WP_019455989.1|130028_130118_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_033638375.1|130442_131468_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.5	5.5e-28
WP_033648176.1|131464_132409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033638373.1|132532_133744_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.9	2.5e-11
WP_033638372.1|134088_135240_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.0	2.0e-82
WP_033648175.1|135313_135607_-	peptidase inhibitor	NA	NA	NA	NA	NA
WP_033638371.1|135661_136312_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	9.8e-23
>prophage 11
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	143051	148208	5140918		Tupanvirus(33.33%)	5	NA	NA
WP_039566382.1|143051_144278_-	cysteine desulfurase SufS	NA	A0A2K9L2Y3	Tupanvirus	35.9	3.1e-70
WP_033646297.1|144274_145561_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016927936.1|145535_146282_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SJ29	Klosneuvirus	27.4	3.2e-09
WP_033638360.1|146325_147822_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004931368.1|147836_148208_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	38.2	9.2e-18
>prophage 12
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	154476	160010	5140918		Hokovirus(33.33%)	4	NA	NA
WP_033646300.1|154476_156855_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	3.9e-170
WP_004931377.1|157353_158175_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_033646301.1|158372_159419_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.0	5.7e-81
WP_033646302.1|159524_160010_+	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	36.7	6.4e-11
>prophage 13
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	165467	170771	5140918		Cedratvirus(33.33%)	5	NA	NA
WP_033646306.1|165467_166253_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_048321511.1|166290_167733_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	8.8e-56
WP_033646308.1|167990_168722_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_033638762.1|169233_170247_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_016927954.1|170306_170771_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	33.6	4.3e-12
>prophage 14
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	174240	243969	5140918	coat,protease,tRNA	Tupanvirus(25.0%)	64	NA	NA
WP_033647431.1|174240_176223_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-21
WP_033638338.1|176222_177203_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	B9UDL7	Salmonella_phage	32.4	3.1e-36
WP_033646312.1|177189_178344_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.2	1.2e-28
WP_043147376.1|178741_179497_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-05
WP_033646314.1|179502_180054_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_033638330.1|180099_181107_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_033638328.1|181285_181702_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004931414.1|182251_182548_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_033646315.1|182552_184940_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.8e-05
WP_004931416.1|184954_185938_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_151498502.1|186184_186280_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931417.1|186349_186706_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004931418.1|186749_186947_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048233542.1|187045_187597_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_025159696.1|187600_189529_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_033646316.1|189744_190368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646317.1|190607_191657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646318.1|192041_192731_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_033646319.1|192767_193901_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638320.1|194051_195335_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039566431.1|195592_196930_-	cytochrome c	NA	NA	NA	NA	NA
WP_004931432.1|196942_198724_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_033638317.1|198726_199452_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004931439.1|199759_200425_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_033638315.1|200534_200834_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_033638313.1|200965_201910_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638312.1|201906_202797_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	2.5e-08
WP_033638311.1|202796_203657_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_048321510.1|203656_204511_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_033646323.1|204750_205620_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033638308.1|205655_206216_-	membrane protein	NA	NA	NA	NA	NA
WP_033646324.1|206401_207682_+|protease	protease	protease	NA	NA	NA	NA
WP_033638306.1|207745_208411_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_048321509.1|208834_209383_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_086579715.1|209558_210956_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_048321508.1|211019_211829_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_048321507.1|211838_212942_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_048321506.1|213097_213817_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_048321505.1|213992_215003_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033646328.1|214999_216136_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_033646329.1|216137_217001_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048321504.1|217003_217807_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048321503.1|217853_218645_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_033646331.1|218876_220271_+	MFS transporter	NA	NA	NA	NA	NA
WP_048321502.1|220371_221079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638291.1|221316_222195_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_033638289.1|222504_224553_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638287.1|224572_225283_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638286.1|225379_225877_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_048322071.1|226132_227380_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_048322070.1|227348_229979_+	PqiB family protein	NA	NA	NA	NA	NA
WP_048321501.1|230081_231518_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033638282.1|231792_232332_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071883799.1|232334_232838_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033646335.1|232837_233392_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_048321500.1|233416_234181_+	molecular chaperone	NA	NA	NA	NA	NA
WP_048322069.1|234326_236669_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_048321499.1|236689_237625_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004931517.1|237760_238000_+	YebV family protein	NA	NA	NA	NA	NA
WP_033646337.1|238055_238655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|238659_239052_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004931526.1|239831_240041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033638272.1|240574_241918_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	56.1	1.2e-27
WP_033653893.1|242349_243969_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.3e-140
>prophage 15
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	271012	271225	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_048321487.1|271012_271225_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	9.3e-23
>prophage 16
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	281421	290232	5140918	tRNA	Morganella_phage(25.0%)	9	NA	NA
WP_033646368.1|281421_281871_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	2.2e-29
WP_033638224.1|281945_283199_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.0e-20
WP_033653870.1|283330_283957_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_033638222.1|283979_284318_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_041034763.1|284327_284774_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_048321482.1|284880_285981_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048321481.1|286029_287898_-	low affinity potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.1	1.8e-69
WP_033638217.1|288212_288839_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_033638215.1|288861_290232_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	6.5e-109
>prophage 17
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	294011	295031	5140918		Catopsilia_pomona_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_033638206.1|294011_295031_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	24.3	1.0e-05
>prophage 18
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	302676	306813	5140918	tail	Serratia_phage(50.0%)	4	NA	NA
WP_048322063.1|302676_303813_-|tail	tail fiber domain-containing protein	tail	A0A1Z1LZI1	Serratia_phage	27.5	5.2e-19
WP_004941154.1|304112_305342_-	peptidase T	NA	NA	NA	NA	NA
WP_101456414.1|305399_305672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646378.1|305697_306813_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.4	6.4e-30
>prophage 19
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	313671	317445	5140918		Vibrio_phage(50.0%)	4	NA	NA
WP_033638183.1|313671_314508_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	4.1e-21
WP_048321473.1|314519_315440_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_033646382.1|315493_316741_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_033638178.1|316740_317445_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.9	3.3e-32
>prophage 20
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	323279	329097	5140918		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_048321468.1|323279_324968_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	9.7e-22
WP_004941087.1|325016_325871_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	7.5e-47
WP_033653850.1|325929_326739_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_033646389.1|326735_327134_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_048321467.1|327178_328012_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_048321466.1|328011_329097_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.0	9.7e-07
>prophage 21
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	332520	336391	5140918	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_004941061.1|332520_333468_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	6.0e-45
WP_043147272.1|333653_333932_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_028128042.1|334233_334824_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_043147268.1|334861_336391_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	37.8	6.0e-79
>prophage 22
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	354242	360722	5140918	protease	Agrobacterium_phage(50.0%)	6	NA	NA
WP_033638144.1|354242_354836_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.0	3.8e-58
WP_033646406.1|354879_355209_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_043147254.1|355205_355520_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043147252.1|355622_357125_-	amino acid permease	NA	NA	NA	NA	NA
WP_043147250.1|357183_357636_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_043147248.1|357632_360722_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.7	3.7e-152
>prophage 23
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	372975	377405	5140918		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_043147242.1|372975_373740_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	6.6e-18
WP_043147241.1|373879_374800_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025160279.1|374864_375905_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033646419.1|375920_377405_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.0e-11
>prophage 24
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	389759	392685	5140918		Pectobacterium_phage(50.0%)	4	NA	NA
WP_033642715.1|389759_389990_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.7	6.3e-17
WP_033646426.1|390021_390975_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_033638066.1|391167_391593_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004928833.1|392016_392685_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.5	2.6e-18
>prophage 25
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	406297	406756	5140918	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_033646433.1|406297_406756_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.9	2.4e-15
>prophage 26
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	415654	416404	5140918		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_033646439.1|415654_416404_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	3.9e-15
>prophage 27
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	421456	423102	5140918		Streptococcus_virus(50.0%)	2	NA	NA
WP_033646441.1|421456_422464_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	38.4	4.9e-05
WP_033646442.1|422463_423102_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	2.2e-27
>prophage 28
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	426396	427522	5140918		Ralstonia_phage(50.0%)	2	NA	NA
WP_004719003.1|426396_426633_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.0e-09
WP_016928193.1|426787_427522_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.3	1.3e-15
>prophage 29
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	438500	438740	5140918		Enterobacteria_phage(100.0%)	1	NA	NA
WP_033638037.1|438500_438740_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	55.3	1.1e-16
>prophage 30
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	447209	451984	5140918		Morganella_phage(50.0%)	4	NA	NA
WP_033638030.1|447209_448130_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.0	1.6e-66
WP_033642669.1|448231_448516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646458.1|448717_449956_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_033638027.1|450430_451984_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	58.0	2.7e-159
>prophage 31
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	471254	476483	5140918		Planktothrix_phage(50.0%)	3	NA	NA
WP_033646466.1|471254_473192_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	37.6	1.5e-34
WP_033646467.1|473195_474563_+	TolC family protein	NA	NA	NA	NA	NA
WP_033646468.1|474980_476483_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	2.3e-54
>prophage 32
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	498936	499365	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_033637941.1|498936_499365_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	48.3	4.0e-25
>prophage 33
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	503364	504576	5140918		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_033646541.1|503364_504576_+	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	29.2	2.7e-34
>prophage 34
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	517920	521001	5140918		Leptospira_phage(100.0%)	1	NA	NA
WP_033646554.1|517920_521001_-	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	7.9e-54
>prophage 35
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	532790	533450	5140918	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004928091.1|532790_533450_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.8	4.7e-41
>prophage 36
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	540046	542101	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033637897.1|540046_542101_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.3	4.8e-15
>prophage 37
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	556997	562241	5140918		Tupanvirus(50.0%)	3	NA	NA
WP_033637886.1|556997_558902_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	9.8e-47
WP_089185444.1|558907_561034_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_089185378.1|561131_562241_+	MOSC domain-containing protein	NA	A0A222YX16	Synechococcus_phage	38.4	5.4e-05
>prophage 38
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	567781	568555	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033646586.1|567781_568555_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	1.4e-28
>prophage 39
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	571566	580542	5140918	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_033646589.1|571566_573267_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.1	1.8e-15
WP_033646591.1|573522_574728_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033637870.1|574940_576341_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.3	1.6e-83
WP_049235552.1|576645_577770_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.9	6.7e-120
WP_039566691.1|578014_579205_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_033646596.1|579281_579929_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033637866.1|579993_580542_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	31.6	7.0e-06
>prophage 40
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	594555	602739	5140918		Morganella_phage(40.0%)	7	NA	NA
WP_004928241.1|594555_594777_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	48.4	4.2e-10
WP_019454537.1|594999_595209_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	69.2	2.7e-19
WP_039566697.1|595734_597141_+	VOC family protein	NA	NA	NA	NA	NA
WP_039566698.1|597143_598124_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_021504329.1|598123_599872_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.3	5.4e-60
WP_080377022.1|599907_602178_-	ComEC family protein	NA	Q0H255	Geobacillus_phage	30.9	1.1e-20
WP_004928264.1|602454_602739_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.4	3.2e-10
>prophage 41
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	607009	608095	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_033637853.1|607009_608095_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	7.0e-82
>prophage 42
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	612731	637485	5140918	protease,tRNA	Tetraselmis_virus(16.67%)	18	NA	NA
WP_048321409.1|612731_615014_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	5.7e-158
WP_033637850.1|615293_616034_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	8.0e-21
WP_033637849.1|616083_617235_-	MFS transporter	NA	NA	NA	NA	NA
WP_039566712.1|617398_617764_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_033637847.1|617815_619108_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	5.8e-91
WP_048322053.1|619217_620504_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	3.1e-76
WP_019454555.1|620571_621183_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_048321408.1|621381_624972_-	hypothetical protein	NA	A0A218M9A2	Mycobacterium_phage	47.0	1.4e-86
WP_004928318.1|625092_625587_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_033637844.1|626241_627213_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.9	1.2e-61
WP_048321407.1|627453_629220_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	2.2e-24
WP_048321406.1|629222_630962_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	5.7e-17
WP_033637838.1|630991_631717_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|631822_632041_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025302261.1|632246_634526_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	8.7e-167
WP_004928347.1|634553_634874_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_004928349.1|635229_635451_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_039566730.1|635538_637485_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.3	6.1e-36
>prophage 43
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	649129	650686	5140918		Vibrio_phage(100.0%)	1	NA	NA
WP_039566743.1|649129_650686_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.3	3.0e-09
>prophage 44
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	654791	657766	5140918		Agrobacterium_phage(33.33%)	4	NA	NA
WP_033646661.1|654791_655628_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.2	1.0e-11
WP_033637822.1|655747_656071_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	43.3	4.9e-15
WP_033637821.1|656230_656773_+	lipoprotein	NA	NA	NA	NA	NA
WP_038884338.1|657037_657766_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	3.9e-28
>prophage 45
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	661200	670232	5140918		uncultured_Caudovirales_phage(20.0%)	11	NA	NA
WP_033646666.1|661200_661485_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	57.4	5.0e-24
WP_033646667.1|661481_662609_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.3e-27
WP_048321404.1|662678_663158_-	YbjO family protein	NA	NA	NA	NA	NA
WP_016928360.1|663262_664108_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_033646669.1|664104_665067_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_033637812.1|665091_666225_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	33.5	2.1e-28
WP_033637811.1|666347_667457_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004938666.1|667863_668343_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_033646671.1|668478_669381_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	36.6	4.7e-39
WP_033646672.1|669435_669738_-	YbjC family protein	NA	NA	NA	NA	NA
WP_004938676.1|669968_670232_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
>prophage 46
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	674954	679336	5140918	integrase	Salmonella_phage(66.67%)	5	672811:672826	679428:679443
672811:672826	attL	ATCGGGTTTTTTGTTG	NA	NA	NA	NA
WP_048321403.1|674954_675464_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	51.9	1.1e-37
WP_048321402.1|675496_675718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321401.1|675861_676434_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	35.4	1.4e-25
WP_048321400.1|676437_678207_+	AIPR family protein	NA	NA	NA	NA	NA
WP_048321399.1|678301_679336_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.5	4.3e-113
679428:679443	attR	ATCGGGTTTTTTGTTG	NA	NA	NA	NA
>prophage 47
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	692571	693336	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_033646689.1|692571_693336_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.3	6.6e-18
>prophage 48
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	708152	711192	5140918		Stx2-converting_phage(50.0%)	2	NA	NA
WP_086579344.1|708152_709382_-	hypothetical protein	NA	B6DZZ7	Stx2-converting_phage	46.3	3.9e-97
WP_033646711.1|709824_711192_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	36.9	1.9e-47
>prophage 49
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	717805	718651	5140918		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_048321391.1|717805_718651_-	carbon-nitrogen hydrolase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	32.4	2.9e-19
>prophage 50
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	723556	724456	5140918		Cellulophaga_phage(100.0%)	1	NA	NA
WP_033646732.1|723556_724456_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	81.6	5.5e-08
>prophage 51
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	730001	732104	5140918		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_033646740.1|730001_730622_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.6	9.4e-15
WP_004938815.1|730697_732104_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.4	5.9e-41
>prophage 52
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	740153	743154	5140918		Escherichia_phage(33.33%)	3	NA	NA
WP_033646754.1|740153_741035_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	38.6	3.4e-42
WP_033646757.1|741035_741569_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.2	2.0e-53
WP_048321389.1|742140_743154_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.9	8.5e-82
>prophage 53
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	746424	748197	5140918		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_033637754.1|746424_748197_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	33.7	1.7e-16
>prophage 54
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	754976	757841	5140918		Bacillus_phage(50.0%)	2	NA	NA
WP_033637752.1|754976_756350_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.9	4.8e-35
WP_106024991.1|756413_757841_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	6.9e-53
>prophage 55
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	763617	768293	5140918		uncultured_Mediterranean_phage(66.67%)	4	NA	NA
WP_071998120.1|763617_764124_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	46.6	1.5e-07
WP_033637744.1|764120_765359_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_033637743.1|765359_767600_-	TIM barrel protein	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	35.3	2.7e-35
WP_033637742.1|767603_768293_-	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.6	2.2e-09
>prophage 56
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	772575	776612	5140918		Bacillus_phage(66.67%)	3	NA	NA
WP_033637738.1|772575_773469_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	4.0e-51
WP_033638708.1|773522_774419_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.3	4.9e-57
WP_033646770.1|775028_776612_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.8	2.3e-41
>prophage 57
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	780048	785604	5140918	tRNA	Saccharomonospora_phage(33.33%)	5	NA	NA
WP_004938917.1|780048_780630_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	9.3e-33
WP_004938922.1|780756_781398_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
WP_033646772.1|781629_782259_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_033646773.1|782304_783417_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_048321387.1|783576_785604_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.8	3.7e-52
>prophage 58
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	794419	795928	5140918		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_033637724.1|794419_795928_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	4.5e-10
>prophage 59
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	799701	803950	5140918		Cellulophaga_phage(50.0%)	4	NA	NA
WP_004938969.1|799701_800367_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	9.9e-55
WP_033646786.1|800611_801769_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_016928453.1|801874_802795_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089187587.1|802831_803950_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	6.0e-36
>prophage 60
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	808956	819406	5140918		Planktothrix_phage(20.0%)	8	NA	NA
WP_033646794.1|808956_810834_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.8e-14
WP_033646796.1|810853_811810_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_033646798.1|812167_812704_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	32.3	4.6e-18
WP_033646800.1|812861_814100_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_033646802.1|814102_814858_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_033646804.1|814909_816502_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	3.2e-59
WP_033646806.1|817179_818484_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	38.0	1.4e-65
WP_033646807.1|818506_819406_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-11
>prophage 61
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	838291	849289	5140918	holin	Bacillus_phage(50.0%)	10	NA	NA
WP_033646828.1|838291_839959_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.3	1.8e-52
WP_033646830.1|840097_841570_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004939107.1|841584_842187_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_033647477.1|842586_844626_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.3	8.4e-20
WP_033637683.1|844670_845141_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_033637682.1|845206_845497_-	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_048321381.1|845556_846333_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033646833.1|846343_846955_-	cytochrome b561	NA	NA	NA	NA	NA
WP_033646834.1|847105_847819_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	3.9e-33
WP_033646836.1|847822_849289_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	4.0e-24
>prophage 62
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	859492	866965	5140918		Escherichia_phage(80.0%)	9	NA	NA
WP_033637675.1|859492_860164_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	7.0e-32
WP_033637674.1|860304_860931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646856.1|860943_861549_+	thioredoxin reductase	NA	NA	NA	NA	NA
WP_033637672.1|861541_862309_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048321379.1|862431_862959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033637671.1|863108_863879_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	62.1	4.3e-78
WP_033646860.1|864162_865077_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	75.5	4.0e-115
WP_080281273.1|865076_866336_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	59.8	3.2e-126
WP_033637668.1|866332_866965_+	aldolase	NA	A0A077SK32	Escherichia_phage	77.5	2.2e-88
>prophage 63
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	871853	882323	5140918		Enterobacteria_phage(16.67%)	11	NA	NA
WP_033637662.1|871853_872372_-	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	34.8	8.4e-17
WP_004939202.1|872772_873660_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_033646871.1|873792_874260_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_033647478.1|874241_874793_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	27.8	5.1e-12
WP_004939215.1|875147_875651_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.6	5.8e-07
WP_033646872.1|875791_876058_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	51.1	1.8e-15
WP_004939223.1|876394_877138_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004939229.1|877240_877900_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004939230.1|877896_878619_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.5e-35
WP_033646873.1|878773_880984_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_033646874.1|881018_882323_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.8	2.3e-15
>prophage 64
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	902546	907646	5140918		Bacillus_phage(50.0%)	5	NA	NA
WP_033646901.1|902546_904745_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	6.9e-44
WP_033646903.1|904811_905204_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_048321371.1|905193_905526_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_048321370.1|905650_906307_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033646909.1|906548_907646_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	52.9	1.3e-107
>prophage 65
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	910805	912260	5140918		Mycobacterium_phage(100.0%)	1	NA	NA
WP_033646916.1|910805_912260_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.1	9.3e-13
>prophage 66
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	916825	917761	5140918		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_033637623.1|916825_917761_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.2e-07
>prophage 67
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	935175	936693	5140918		Bacillus_virus(50.0%)	2	NA	NA
WP_033646968.1|935175_935874_-	urea ABC transporter ATP-binding subunit UrtE	NA	G3M9Y6	Bacillus_virus	23.6	3.6e-15
WP_033646969.1|935886_936693_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.3	1.3e-13
>prophage 68
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	947107	954071	5140918		Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus(33.33%)	6	NA	NA
WP_033646988.1|947107_949675_-	peptidase M60	NA	A0A1B1MQU5	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus	26.1	9.2e-48
WP_004939471.1|949852_950317_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	3.8e-37
WP_033637591.1|950425_951325_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_033637590.1|951321_952185_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_025302014.1|952263_953196_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033637589.1|953237_954071_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.4	2.5e-15
>prophage 69
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	963859	964117	5140918		Erwinia_phage(100.0%)	1	NA	NA
WP_033637577.1|963859_964117_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	45.5	4.7e-05
>prophage 70
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	979998	980634	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_033637564.1|979998_980634_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	47.2	8.6e-48
>prophage 71
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	988249	989029	5140918		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_033647038.1|988249_989029_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	6.1e-11
>prophage 72
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	995890	996811	5140918		Burkholderia_virus(100.0%)	1	NA	NA
WP_033647045.1|995890_996811_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.1	1.9e-19
>prophage 73
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1003253	1003679	5140918		Salmonella_phage(100.0%)	1	NA	NA
WP_033647052.1|1003253_1003679_+	PAS sensor domain-containing protein	NA	A0A1B0V854	Salmonella_phage	46.4	6.2e-18
>prophage 74
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1007198	1013825	5140918		Acanthocystis_turfacea_Chlorella_virus(33.33%)	8	NA	NA
WP_033647057.1|1007198_1007915_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	33.0	1.7e-15
WP_033647059.1|1008513_1009365_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033637547.1|1009422_1010013_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_033647061.1|1010218_1010686_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033647063.1|1010685_1011228_+	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	43.9	2.6e-21
WP_033647064.1|1011332_1012184_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_033653481.1|1012314_1013127_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_033637541.1|1013285_1013825_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	42.3	3.3e-24
>prophage 75
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1035364	1044185	5140918	tRNA	Planktothrix_phage(25.0%)	8	NA	NA
WP_047568805.1|1035364_1036411_+	ferric ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.2e-22
WP_033637517.1|1036657_1036924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321351.1|1036965_1037898_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_048321350.1|1037982_1038942_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.5	7.0e-17
WP_033653500.1|1039056_1040439_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	7.4e-52
WP_041033964.1|1040736_1041435_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_033647110.1|1041453_1042440_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_048321349.1|1042448_1044185_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	2.8e-24
>prophage 76
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1050881	1051799	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_033637504.1|1050881_1051799_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	26.8	2.0e-21
>prophage 77
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1059738	1061013	5140918		Klosneuvirus(100.0%)	1	NA	NA
WP_033637498.1|1059738_1061013_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	2.4e-20
>prophage 78
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1067130	1067919	5140918		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_033647135.1|1067130_1067919_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.3	2.2e-08
>prophage 79
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1073926	1075414	5140918		Cedratvirus(100.0%)	1	NA	NA
WP_033647493.1|1073926_1075414_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.0	1.9e-13
>prophage 80
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1084652	1091443	5140918		Edwardsiella_phage(25.0%)	5	NA	NA
WP_033647150.1|1084652_1085705_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.7	2.6e-81
WP_033638694.1|1085917_1086523_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033647152.1|1086519_1089720_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.5	1.5e-34
WP_033637476.1|1089719_1090682_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.1	7.0e-25
WP_033637475.1|1090717_1091443_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.0	3.5e-21
>prophage 81
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1113036	1118406	5140918		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_015376974.1|1113036_1114803_-	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.9	2.0e-17
WP_004939891.1|1114803_1115151_-	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
WP_004939893.1|1115144_1115534_-	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_016928730.1|1116264_1117557_+	citrate synthase	NA	NA	NA	NA	NA
WP_033647160.1|1117614_1118406_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.7	2.1e-11
>prophage 82
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1125160	1126591	5140918		Catovirus(100.0%)	1	NA	NA
WP_033647168.1|1125160_1126591_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	4.8e-54
>prophage 83
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1130158	1135586	5140918		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_033647173.1|1130158_1132228_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.3	7.0e-30
WP_033647498.1|1132246_1132816_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_033647175.1|1132889_1135586_+	two-component system sensor histidine kinase KdbD	NA	W8CYF6	Bacillus_phage	28.1	1.6e-18
>prophage 84
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1139932	1140706	5140918		Mycobacterium_phage(100.0%)	1	NA	NA
WP_080281277.1|1139932_1140706_+	esterase	NA	W0LNB3	Mycobacterium_phage	33.6	1.7e-05
>prophage 85
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1148102	1149767	5140918	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_033647183.1|1148102_1149767_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	88.4	4.2e-296
>prophage 86
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1158326	1159991	5140918		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_033637446.1|1158326_1159991_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	38.7	6.1e-85
>prophage 87
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1164388	1165444	5140918		Pseudomonas_phage(100.0%)	1	NA	NA
WP_033637443.1|1164388_1165444_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.0	1.4e-47
>prophage 88
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1171331	1172057	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_033637437.1|1171331_1172057_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	8.4e-31
>prophage 89
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1175406	1177989	5140918	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_033637432.1|1175406_1177989_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.3	3.2e-189
>prophage 90
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1184298	1193622	5140918		Synechococcus_phage(16.67%)	11	NA	NA
WP_033637427.1|1184298_1185372_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	47.2	1.2e-14
WP_033637426.1|1185552_1186764_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	50.8	1.3e-105
WP_033637425.1|1186868_1187135_+	YbeD family protein	NA	NA	NA	NA	NA
WP_086556840.1|1187278_1187938_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_025301835.1|1187930_1188896_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004940019.1|1188990_1189206_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_043146784.1|1189424_1190492_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	5.6e-15
WP_004940022.1|1190889_1191273_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	5.2e-24
WP_033637421.1|1191561_1192158_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048321340.1|1192164_1193355_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	3.3e-24
WP_004940030.1|1193412_1193622_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.7e-21
>prophage 91
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1198345	1201837	5140918		Indivirus(50.0%)	4	NA	NA
WP_048321337.1|1198345_1199173_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.4	2.0e-12
WP_033637415.1|1199209_1199719_-	glyoxalase	NA	NA	NA	NA	NA
WP_033647218.1|1199884_1200364_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_048322042.1|1200388_1201837_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.5	3.1e-16
>prophage 92
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1205082	1207619	5140918	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
WP_004940177.1|1205082_1205949_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	9.0e-32
WP_004940179.1|1205959_1206172_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_033637393.1|1206233_1207619_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	34.7	2.9e-40
>prophage 93
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1215164	1219630	5140918	protease	Planktothrix_phage(50.0%)	5	NA	NA
WP_004940192.1|1215164_1215851_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.8e-30
WP_141240923.1|1215818_1216460_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_033637386.1|1216486_1217263_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048321333.1|1217340_1218195_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_033637384.1|1218478_1219630_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	43.6	4.5e-79
>prophage 94
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1229557	1230700	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_048321328.1|1229557_1230700_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.2	2.6e-42
>prophage 95
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1234014	1235796	5140918		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_043146758.1|1234014_1235796_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	28.9	1.2e-43
>prophage 96
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1240503	1243215	5140918		uncultured_virus(100.0%)	1	NA	NA
WP_048321325.1|1240503_1243215_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	2.6e-109
>prophage 97
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1248315	1253706	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_159084293.1|1248315_1253706_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.4	4.2e-204
>prophage 98
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1265739	1266903	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_048321319.1|1265739_1266903_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.1	3.6e-44
>prophage 99
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1270443	1276032	5140918		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_086556839.1|1270443_1272315_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.1	1.8e-114
WP_004940263.1|1272453_1273059_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_004940264.1|1273058_1273388_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_043146745.1|1273429_1275388_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.0	3.0e-43
WP_015376864.1|1275480_1276032_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	2.9e-28
>prophage 100
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1285913	1286627	5140918		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_048321317.1|1285913_1286627_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.1e-14
>prophage 101
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1308339	1311886	5140918		Bacillus_phage(100.0%)	2	NA	NA
WP_033647297.1|1308339_1310118_-	multidrug efflux ABC transporter permease/ATP-binding subunit SmdB	NA	W8CYL7	Bacillus_phage	27.4	1.4e-39
WP_033647298.1|1310110_1311886_-	multidrug efflux ABC transporter permease/ATP-binding subunit SmdA	NA	W8CYL7	Bacillus_phage	29.3	3.1e-47
>prophage 102
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1316422	1317121	5140918		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004940343.1|1316422_1317121_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	69.0	5.1e-86
>prophage 103
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1320312	1325389	5140918	protease	Burkholderia_virus(25.0%)	4	NA	NA
WP_004940351.1|1320312_1320585_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	1.2e-19
WP_033647305.1|1320801_1323156_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.2	7.7e-227
WP_004940354.1|1323350_1324622_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	2.1e-130
WP_004940356.1|1324765_1325389_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	3.4e-65
>prophage 104
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1340928	1342506	5140918		Moraxella_phage(100.0%)	1	NA	NA
WP_050438924.1|1340928_1342506_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	3.8e-28
>prophage 105
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1350737	1358026	5140918	tRNA	uncultured_Mediterranean_phage(60.0%)	8	NA	NA
WP_033637299.1|1350737_1351208_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	7.8e-30
WP_033637298.1|1351315_1352425_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.4	1.6e-49
WP_004940387.1|1352435_1352885_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_033647317.1|1353060_1353621_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_033647318.1|1353684_1354653_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.3	7.7e-48
WP_071845295.1|1354663_1356511_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004940391.1|1356535_1356868_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	1.7e-10
WP_033647322.1|1356901_1358026_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.5	1.1e-90
>prophage 106
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1370753	1381318	5140918		Bacillus_phage(50.0%)	9	NA	NA
WP_004940434.1|1370753_1372070_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.7	3.2e-28
WP_004940438.1|1372094_1372784_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.1	1.7e-36
WP_043146704.1|1372999_1374232_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_043146702.1|1374228_1377480_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	28.4	3.0e-11
WP_033647330.1|1377711_1378560_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_033637281.1|1378556_1378943_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033637280.1|1378939_1379173_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_043146700.1|1379275_1380190_-	fructokinase	NA	NA	NA	NA	NA
WP_004940461.1|1380406_1381318_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.6	3.9e-102
>prophage 107
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1388456	1390238	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033637266.1|1388456_1390238_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.5	1.8e-26
>prophage 108
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1410736	1411912	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_033647376.1|1410736_1411912_-	type I restriction enzyme R protein	NA	A0A1S5SAB0	Streptococcus_phage	28.6	7.7e-34
>prophage 109
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1433783	1434308	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_079656961.1|1433783_1434308_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	45.4	3.4e-18
>prophage 110
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1439724	1439943	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_015376761.1|1439724_1439943_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	58.5	1.4e-13
>prophage 111
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1459634	1470297	5140918	integrase	Enterobacteria_phage(57.14%)	11	1462824:1462838	1468684:1468698
WP_033647425.1|1459634_1460189_+	3'-5' exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	30.6	2.8e-10
WP_033647427.1|1460190_1461297_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_048321301.1|1461641_1463975_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
1462824:1462838	attL	CTGGAACAGTGCGGC	NA	NA	NA	NA
WP_048321300.1|1463986_1464322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321299.1|1464318_1464582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321298.1|1464578_1465124_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
WP_048321297.1|1465110_1465326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321296.1|1465322_1465586_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_033649938.1|1466321_1467512_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_086556832.1|1467930_1469190_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
1468684:1468698	attR	GCCGCACTGTTCCAG	NA	NA	NA	NA
WP_033637217.1|1469193_1470297_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
>prophage 112
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1487470	1488052	5140918		Caulobacter_phage(100.0%)	1	NA	NA
WP_004930220.1|1487470_1488052_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	2.2e-13
>prophage 113
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1504934	1512104	5140918		Bradyrhizobium_phage(25.0%)	8	NA	NA
WP_004930195.1|1504934_1505678_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	1.8e-41
WP_033649910.1|1505750_1506218_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.4	1.4e-50
WP_033637192.1|1506214_1506934_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033649909.1|1506978_1507734_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_033653353.1|1507805_1509191_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.9	7.5e-12
WP_071883769.1|1509243_1510038_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_033649907.1|1510369_1511257_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033649906.1|1511300_1512104_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.2	7.8e-30
>prophage 114
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1518070	1520644	5140918		Enterobacteria_phage(100.0%)	1	NA	NA
WP_025301647.1|1518070_1520644_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.0	7.6e-127
>prophage 115
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1526632	1530242	5140918		Escherichia_coli_O157_typing_phage(25.0%)	5	NA	NA
WP_033650022.1|1526632_1527709_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.2e-89
WP_004932469.1|1528215_1528980_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_025301641.1|1529229_1529451_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	38.4	2.6e-07
WP_033650023.1|1529434_1529950_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	65.5	1.1e-58
WP_033637183.1|1530014_1530242_+	transcriptional regulator	NA	Q37973	Salmonella_virus	64.3	1.3e-19
>prophage 116
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1540602	1546039	5140918	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_004091602.1|1540602_1540788_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033649274.1|1541040_1543668_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.3	7.1e-80
WP_033649272.1|1543801_1544314_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004932541.1|1544374_1545439_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_033649270.1|1545550_1546039_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	7.9e-25
>prophage 117
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1554027	1554786	5140918		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_033649286.1|1554027_1554786_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.9	4.2e-17
>prophage 118
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1558161	1564555	5140918		uncultured_Mediterranean_phage(40.0%)	5	NA	NA
WP_043148268.1|1558161_1560717_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	19.6	8.9e-27
WP_004932578.1|1560796_1561795_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_071883767.1|1561849_1562866_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	8.2e-08
WP_033637164.1|1563173_1563800_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	7.0e-34
WP_033637163.1|1563793_1564555_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	4.3e-54
>prophage 119
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1569207	1572449	5140918		Planktothrix_phage(33.33%)	4	NA	NA
WP_038871895.1|1569207_1569930_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	3.1e-33
WP_033637158.1|1569982_1570309_-	DUF3561 family protein	NA	NA	NA	NA	NA
WP_077791443.1|1570393_1571083_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	38.4	1.2e-07
WP_048321284.1|1571021_1572449_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.7e-35
>prophage 120
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1581351	1582023	5140918		Vibrio_phage(100.0%)	1	NA	NA
WP_033649243.1|1581351_1582023_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	33.6	3.6e-12
>prophage 121
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1585748	1594943	5140918		Catovirus(25.0%)	7	NA	NA
WP_019455102.1|1585748_1587284_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	2.2e-89
WP_033649240.1|1587386_1588781_+	amino acid permease	NA	NA	NA	NA	NA
WP_033649237.1|1588817_1590011_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	29.2	2.3e-17
WP_080281313.1|1590047_1590443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033649235.1|1590439_1591630_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033637140.1|1591928_1593224_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.5	4.1e-129
WP_033637139.1|1593305_1594943_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
>prophage 122
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1598429	1604077	5140918	protease	Erysipelothrix_phage(33.33%)	3	NA	NA
WP_033649231.1|1598429_1599779_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	4.4e-33
WP_033649229.1|1599845_1602572_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.1	1.8e-49
WP_033649228.1|1602637_1604077_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	5.5e-26
>prophage 123
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1608530	1608875	5140918		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_033649222.1|1608530_1608875_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	2.0e-27
>prophage 124
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1617678	1618722	5140918		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_015376656.1|1617678_1618722_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.1	3.1e-103
>prophage 125
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1646099	1653804	5140918		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_033649198.1|1646099_1647818_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.5	6.1e-56
WP_033649196.1|1648134_1649943_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.5	8.2e-43
WP_033649194.1|1650409_1651357_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_106024890.1|1652055_1652139_+	leu operon leader peptide	NA	NA	NA	NA	NA
WP_004932820.1|1652229_1653804_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.5	9.7e-08
>prophage 126
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1664614	1674164	5140918		Planktothrix_phage(25.0%)	7	NA	NA
WP_025301552.1|1664614_1665319_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	7.4e-24
WP_099785722.1|1665422_1665521_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_048321279.1|1665632_1667327_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.8	6.5e-58
WP_016929110.1|1667330_1667624_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_048321278.1|1667653_1668430_-	DedA family protein	NA	NA	NA	NA	NA
WP_048321277.1|1668644_1671011_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.1e-34
WP_033649175.1|1671257_1674164_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.4	5.2e-23
>prophage 127
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1681973	1685422	5140918		Salmonella_phage(50.0%)	3	NA	NA
WP_033637075.1|1681973_1682825_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	29.7	1.3e-06
WP_048321275.1|1682869_1684759_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_033637073.1|1684939_1685422_-	type 3 dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	42.9	3.4e-28
>prophage 128
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1693425	1694574	5140918		Halovirus(100.0%)	1	NA	NA
WP_072071884.1|1693425_1694574_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.8	3.4e-50
>prophage 129
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1702659	1712812	5140918	tRNA	Bodo_saltans_virus(25.0%)	8	NA	NA
WP_033649149.1|1702659_1705476_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	25.9	3.8e-63
WP_033649147.1|1705508_1706447_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_158500239.1|1706580_1706736_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
WP_004932960.1|1706837_1707101_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004932962.1|1707172_1708072_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_033649145.1|1708264_1709431_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	52.1	9.8e-90
WP_033637051.1|1709667_1710792_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.4	1.1e-26
WP_004932972.1|1710898_1712812_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.3e-144
>prophage 130
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1715949	1716903	5140918		Synechococcus_phage(100.0%)	1	NA	NA
WP_033637049.1|1715949_1716903_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	5.7e-11
>prophage 131
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1730132	1736896	5140918		Bacillus_phage(66.67%)	5	NA	NA
WP_086581141.1|1730132_1732052_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	38.8	7.9e-12
WP_033649138.1|1732700_1733306_+	YfiR family protein	NA	NA	NA	NA	NA
WP_033649137.1|1733302_1734550_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.6	7.9e-13
WP_033649136.1|1734588_1735086_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025159620.1|1735228_1736896_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.9	1.3e-42
>prophage 132
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1743620	1744895	5140918		Enterococcus_phage(100.0%)	1	NA	NA
WP_033649128.1|1743620_1744895_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.2	1.0e-87
>prophage 133
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1751804	1753127	5140918		Geobacillus_virus(100.0%)	1	NA	NA
WP_033649123.1|1751804_1753127_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.6	1.8e-79
>prophage 134
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1757966	1761010	5140918		Salmonella_phage(50.0%)	3	NA	NA
WP_004857650.1|1757966_1758128_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	1.7e-13
WP_033637016.1|1758289_1758904_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_004933094.1|1759420_1761010_-	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	25.8	3.0e-33
>prophage 135
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1766324	1767410	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033648510.1|1766324_1767410_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.1	5.8e-20
>prophage 136
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1777009	1777750	5140918		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_016929185.1|1777009_1777750_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	3.7e-10
>prophage 137
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1789423	1790545	5140918	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_071883866.1|1789423_1790545_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.4	4.4e-164
>prophage 138
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1802748	1804762	5140918		Tupanvirus(50.0%)	2	NA	NA
WP_033648541.1|1802748_1803861_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	31.7	1.2e-36
WP_043148189.1|1803955_1804762_+	alpha/beta hydrolase	NA	A0A223FN69	NY_014_poxvirus	29.0	2.5e-23
>prophage 139
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1815749	1817000	5140918		Pteropox_virus(100.0%)	1	NA	NA
WP_039567548.1|1815749_1817000_-	phospholipase	NA	A0A1B1MR92	Pteropox_virus	23.2	1.1e-22
>prophage 140
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1835265	1836270	5140918		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_043148198.1|1835265_1836270_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	30.1	1.5e-30
>prophage 141
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1841953	1845225	5140918		Bacillus_virus(66.67%)	3	NA	NA
WP_033648578.1|1841953_1842745_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	5.9e-30
WP_033648579.1|1842777_1843860_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.4e-90
WP_043148199.1|1844445_1845225_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	1.7e-29
>prophage 142
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1862027	1868348	5140918		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_033648593.1|1862027_1868348_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.6	1.1e-49
>prophage 143
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1872138	1881189	5140918	transposase	Cellulophaga_phage(33.33%)	6	NA	NA
WP_122019626.1|1872138_1875648_-	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.1	7.0e-06
WP_139639892.1|1876287_1876542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033636886.1|1876597_1877365_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	46.4	2.5e-49
WP_033648617.1|1877395_1878361_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106024894.1|1878360_1879746_+	gluconate permease	NA	NA	NA	NA	NA
WP_106024895.1|1879832_1881189_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.3	2.0e-78
>prophage 144
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1891502	1898975	5140918	holin,tRNA	Mycoplasma_phage(33.33%)	5	NA	NA
WP_033636874.1|1891502_1893014_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	1.3e-46
WP_033631663.1|1893098_1893548_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_033648627.1|1893560_1896437_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	3.0e-140
WP_033636872.1|1896637_1897141_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033648629.1|1897367_1898975_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	30.3	1.9e-59
>prophage 145
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1903605	1914103	5140918		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_033636864.1|1903605_1904541_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_033636863.1|1904553_1905018_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004933379.1|1905175_1905562_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_048321254.1|1905765_1908753_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	30.8	8.1e-64
WP_048321253.1|1908789_1911183_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_048321252.1|1911394_1914103_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	25.6	2.7e-34
>prophage 146
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1920569	1923341	5140918		Vibrio_phage(100.0%)	2	NA	NA
WP_015376445.1|1920569_1922708_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	1.7e-268
WP_041037638.1|1922876_1923341_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	59.7	7.2e-52
>prophage 147
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1930397	1931908	5140918		Bacillus_virus(50.0%)	2	NA	NA
WP_033648648.1|1930397_1931186_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.4	3.8e-13
WP_033636844.1|1931203_1931908_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	1.4e-06
>prophage 148
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1940506	1940815	5140918		Spodoptera_frugiperda_granulovirus(100.0%)	1	NA	NA
WP_139818296.1|1940506_1940815_+	GIY-YIG nuclease family protein	NA	A0A0C5AS36	Spodoptera_frugiperda_granulovirus	47.6	1.1e-11
>prophage 149
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1950923	1952846	5140918		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_033641661.1|1950923_1952846_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.9	9.6e-50
>prophage 150
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1958237	1960925	5140918		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_033636822.1|1958237_1960925_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	2.3e-25
>prophage 151
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1966267	1968199	5140918	protease	Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_004933529.1|1966267_1968199_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.0	1.3e-118
>prophage 152
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1971609	1973330	5140918		Bacillus_phage(100.0%)	2	NA	NA
WP_033648677.1|1971609_1972272_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	36.9	1.3e-30
WP_033648679.1|1972268_1973330_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	23.2	1.3e-11
>prophage 153
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1976489	1978308	5140918		Indivirus(33.33%)	3	NA	NA
WP_033636815.1|1976489_1977461_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.8	1.2e-05
WP_033648681.1|1977509_1977866_-	putative DNA-binding transcriptional regulator	NA	A0A2P9JZG7	Alteromonadaceae_phage	37.7	4.9e-08
WP_033636812.1|1978047_1978308_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.1	5.5e-17
>prophage 154
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	1983046	1986441	5140918		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_004933587.1|1983046_1984051_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.1	1.4e-71
WP_033636809.1|1984096_1985650_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	7.1e-11
WP_004933594.1|1985910_1986441_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	3.9e-54
>prophage 155
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2009125	2013617	5140918		Lactococcus_phage(50.0%)	3	NA	NA
WP_048321236.1|2009125_2011600_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.7	1.5e-66
WP_033636784.1|2011659_2012085_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_033654892.1|2012318_2013617_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.1	3.4e-67
>prophage 156
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2019042	2022781	5140918		Wolbachia_phage(50.0%)	2	NA	NA
WP_048321234.1|2019042_2020926_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.4	2.9e-59
WP_033648705.1|2020948_2022781_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	1.0e-16
>prophage 157
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2026772	2027318	5140918		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_033636776.1|2026772_2027318_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.0e-29
>prophage 158
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2034369	2038291	5140918		Lactobacillus_phage(50.0%)	5	NA	NA
WP_033648712.1|2034369_2036166_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.4	4.1e-18
WP_033648713.1|2036158_2036893_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004929673.1|2036908_2037301_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004929672.1|2037313_2037673_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_033648715.1|2037757_2038291_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	55.3	1.5e-48
>prophage 159
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2041556	2043541	5140918		Vibrio_phage(50.0%)	2	NA	NA
WP_048321232.1|2041556_2043203_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.2	1.3e-183
WP_004929661.1|2043247_2043541_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	37.9	5.6e-10
>prophage 160
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2053936	2062367	5140918		Tupanvirus(100.0%)	4	NA	NA
WP_033649956.1|2053936_2055565_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	A0A2K9L3I8	Tupanvirus	23.6	8.2e-18
WP_033649955.1|2055572_2056778_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_033649954.1|2056989_2058246_-	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_033649953.1|2058422_2062367_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	29.2	3.8e-61
>prophage 161
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2082123	2084082	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033649947.1|2082123_2084082_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.0	3.8e-86
>prophage 162
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2092256	2097723	5140918		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_049234649.1|2092256_2093846_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.7	3.1e-70
WP_033636738.1|2093894_2095178_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_079656126.1|2095227_2095899_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004929874.1|2095935_2096208_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	2.1e-19
WP_025160203.1|2096397_2096988_-	YjaG family protein	NA	NA	NA	NA	NA
WP_033649987.1|2097036_2097723_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	1.5e-18
>prophage 163
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2107428	2118153	5140918		Tupanvirus(33.33%)	5	NA	NA
WP_043148443.1|2107428_2108703_-	ATP-binding protein	NA	A0A2K9L0Z8	Tupanvirus	24.0	2.5e-14
WP_033655328.1|2108704_2109169_-	oxidoreductase	NA	NA	NA	NA	NA
WP_033649989.1|2109168_2109615_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021505232.1|2109782_2114006_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	2.9e-67
WP_033636721.1|2114124_2118153_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.1e-23
>prophage 164
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2122243	2126193	5140918		Tupanvirus(50.0%)	3	NA	NA
WP_015376315.1|2122243_2123428_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	3.4e-13
WP_033650029.1|2124474_2125023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033636718.1|2125242_2126193_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	3.2e-30
>prophage 165
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2136127	2136742	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_033649682.1|2136127_2136742_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.1	1.3e-21
>prophage 166
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2147753	2151064	5140918		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_033649673.1|2147753_2148524_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	3.2e-28
WP_048321229.1|2148527_2149085_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_033636704.1|2149088_2149352_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_033655130.1|2149432_2151064_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.6e-40
>prophage 167
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2163574	2165382	5140918		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_033649663.1|2163574_2164312_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.5	4.2e-14
WP_033649662.1|2164311_2165382_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.9	1.4e-21
>prophage 168
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2168703	2171409	5140918		Streptococcus_phage(33.33%)	3	NA	NA
WP_043148328.1|2168703_2169891_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.7	1.3e-17
WP_033649661.1|2169935_2170637_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	8.4e-12
WP_033649659.1|2170638_2171409_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.0	4.1e-12
>prophage 169
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2178979	2181769	5140918		Salicola_phage(50.0%)	3	NA	NA
WP_004934345.1|2178979_2179837_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.8	4.6e-44
WP_033636680.1|2180154_2181108_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004934337.1|2181097_2181769_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.2e-12
>prophage 170
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2185125	2192410	5140918	protease	Dickeya_phage(50.0%)	8	NA	NA
WP_033636676.1|2185125_2185752_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	1.7e-32
WP_033649652.1|2185794_2186172_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_033636674.1|2186227_2187691_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_048321227.1|2188372_2190691_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	1.3e-122
WP_033649650.1|2190750_2191026_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_033649649.1|2191025_2191223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025304890.1|2191284_2191530_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	1.2e-10
WP_033649648.1|2191750_2192410_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.7	1.3e-59
>prophage 171
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2199471	2200551	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_019452531.1|2199471_2200551_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	45.7	7.9e-09
>prophage 172
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2203900	2205733	5140918		Catovirus(100.0%)	1	NA	NA
WP_033649642.1|2203900_2205733_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.3	4.8e-83
>prophage 173
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2210215	2214084	5140918		Bacillus_phage(50.0%)	3	NA	NA
WP_108658195.1|2210215_2212378_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.8	7.1e-118
WP_033649639.1|2212456_2213173_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_016929495.1|2213172_2214084_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	32.7	1.2e-18
>prophage 174
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2231117	2237327	5140918		Enterobacteria_phage(40.0%)	6	NA	NA
WP_033636640.1|2231117_2232248_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.6	3.9e-19
WP_033649869.1|2232234_2232966_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_033649870.1|2232943_2233825_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.9	5.3e-104
WP_033649871.1|2233873_2234941_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.9e-101
WP_033649872.1|2234937_2236200_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.4	2.8e-21
WP_033649873.1|2236196_2237327_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.4	2.2e-25
>prophage 175
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2241539	2246989	5140918		Streptomyces_phage(33.33%)	4	NA	NA
WP_033636629.1|2241539_2241866_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	47.8	6.6e-20
WP_004934183.1|2241997_2243284_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	32.0	2.9e-42
WP_033636627.1|2243289_2244786_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_004934177.1|2244964_2246989_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	5.4e-112
>prophage 176
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2267341	2269308	5140918		Bacillus_virus(50.0%)	2	NA	NA
WP_033636613.1|2267341_2268331_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	5.0e-18
WP_004934132.1|2268327_2269308_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	2.5e-14
>prophage 177
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2273636	2275328	5140918		Orgyia_leucostigma_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_033636610.1|2273636_2275328_-	chitinase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	61.2	1.8e-201
>prophage 178
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2283199	2283799	5140918		Salmonella_phage(100.0%)	1	NA	NA
WP_048321224.1|2283199_2283799_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	45.7	6.0e-27
>prophage 179
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2307750	2308743	5140918		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_033649523.1|2307750_2308743_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.1	1.3e-10
>prophage 180
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2312550	2314392	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_033649527.1|2312550_2314392_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	9.9e-12
>prophage 181
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2323202	2325878	5140918		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_004934003.1|2323202_2323823_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	7.8e-62
WP_033649534.1|2323949_2325878_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	1.8e-11
>prophage 182
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2349117	2350095	5140918		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_033636542.1|2349117_2350095_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	29.2	6.0e-24
>prophage 183
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2356406	2357349	5140918		Synechococcus_phage(100.0%)	2	NA	NA
WP_004933922.1|2356406_2356835_-	heat shock chaperone IbpB	NA	A0A0E3FMZ3	Synechococcus_phage	36.3	2.5e-14
WP_004933919.1|2356935_2357349_-	heat shock chaperone IbpA	NA	A0A1Z1LWH0	Synechococcus_phage	37.8	1.1e-19
>prophage 184
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2362667	2367332	5140918		Bacillus_virus(50.0%)	3	NA	NA
WP_033636532.1|2362667_2365082_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	4.3e-116
WP_004933895.1|2365100_2366186_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004933892.1|2366231_2367332_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.9	1.8e-53
>prophage 185
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2377388	2390861	5140918		Moraxella_phage(16.67%)	13	NA	NA
WP_033649560.1|2377388_2378726_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.8	8.7e-66
WP_033649561.1|2378960_2379365_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033649562.1|2379411_2380080_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004933841.1|2380076_2380817_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025304748.1|2380818_2381532_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019455482.1|2381613_2382453_-	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	81.6	8.5e-11
WP_033636521.1|2382621_2383356_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004933831.1|2383367_2384144_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.3	7.6e-14
WP_033636520.1|2384192_2385083_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004933822.1|2385084_2386041_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_033636519.1|2386132_2387173_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	38.0	5.7e-49
WP_033649563.1|2387508_2389338_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	42.5	8.1e-131
WP_033649564.1|2389487_2390861_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	29.7	2.3e-21
>prophage 186
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2407117	2414970	5140918		Enterobacteria_phage(50.0%)	7	NA	NA
WP_033636508.1|2407117_2408986_+	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	29.2	1.0e-64
WP_033649571.1|2409156_2409576_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_033636505.1|2409583_2411089_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	7.1e-16
WP_019455467.1|2411095_2412064_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_033649580.1|2412088_2412976_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.0	9.6e-05
WP_033649572.1|2413037_2413964_+	ribokinase	NA	NA	NA	NA	NA
WP_033649573.1|2413968_2414970_+	ribose operon transcriptional repressor RbsR	NA	C6ZCU4	Enterobacteria_phage	30.8	9.5e-33
>prophage 187
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2427460	2430262	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033649753.1|2427460_2430262_+	DNA polymerase I	NA	J9PVA4	Bacillus_phage	34.3	1.2e-40
>prophage 188
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2434524	2436995	5140918		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_048322032.1|2434524_2435937_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	9.0e-05
WP_004931246.1|2435945_2436995_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.6e-09
>prophage 189
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2445723	2447124	5140918		environmental_Halophage(100.0%)	1	NA	NA
WP_038872554.1|2445723_2447124_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	83.6	2.0e-57
>prophage 190
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2451397	2454481	5140918		Bordetella_phage(50.0%)	3	NA	NA
WP_019452189.1|2451397_2453509_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.1e-10
WP_004931221.1|2453527_2453803_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_033636481.1|2453857_2454481_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	7.5e-20
>prophage 191
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2461347	2465933	5140918		Xanthomonas_phage(25.0%)	7	NA	NA
WP_122302054.1|2461347_2461803_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	2.8e-48
WP_086557015.1|2461783_2462998_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	9.1e-38
WP_033654522.1|2463184_2463868_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004931195.1|2464130_2464367_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002442576.1|2464378_2464546_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_033649742.1|2464627_2465443_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.4	1.4e-21
WP_033631353.1|2465447_2465933_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.7	9.9e-28
>prophage 192
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2474787	2475765	5140918		Catovirus(100.0%)	1	NA	NA
WP_033649734.1|2474787_2475765_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.7	8.7e-07
>prophage 193
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2480231	2488528	5140918		Synechococcus_phage(20.0%)	8	NA	NA
WP_016929696.1|2480231_2481161_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.3	2.0e-29
WP_033636462.1|2481401_2482598_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.7	4.6e-34
WP_033649729.1|2482607_2483633_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	3.0e-18
WP_033649728.1|2483674_2484628_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_033649727.1|2484630_2485965_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	31.2	9.7e-09
WP_033649726.1|2485974_2487519_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_033649725.1|2487816_2488251_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004931142.1|2488279_2488528_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	49.3	1.2e-13
>prophage 194
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2493179	2495269	5140918		Bacillus_phage(50.0%)	2	NA	NA
WP_033636450.1|2493179_2494574_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.3	4.9e-19
WP_004931124.1|2494570_2495269_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
>prophage 195
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2503136	2511621	5140918		Salmonella_phage(33.33%)	8	NA	NA
WP_033649888.1|2503136_2504321_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.3	4.1e-11
WP_033649889.1|2504351_2505362_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_033649890.1|2505490_2506999_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004931095.1|2507041_2507887_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	2.0e-15
WP_004931092.1|2508411_2508651_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_004931090.1|2508711_2509197_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_033636436.1|2509272_2510190_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_033636435.1|2510286_2511621_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	29.0	3.8e-45
>prophage 196
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2533535	2534267	5140918		Synechococcus_phage(100.0%)	1	NA	NA
WP_019452251.1|2533535_2534267_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	57.2	1.4e-46
>prophage 197
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2539495	2541367	5140918		Acinetobacter_phage(100.0%)	1	NA	NA
WP_033649900.1|2539495_2541367_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	6.1e-09
>prophage 198
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2553031	2554678	5140918		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_033649964.1|2553031_2554678_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-63
>prophage 199
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2573060	2575055	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_043148351.1|2573060_2575055_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	34.7	4.1e-19
>prophage 200
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2581932	2588106	5140918	protease	Bacillus_phage(50.0%)	3	NA	NA
WP_050498747.1|2581932_2585025_+|protease	autotransporter serine protease	protease	A0A127AWU5	Bacillus_phage	26.9	9.5e-07
WP_033636393.1|2585480_2586332_+	response regulator	NA	NA	NA	NA	NA
WP_033636392.1|2586321_2588106_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.0	9.0e-26
>prophage 201
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2594155	2594617	5140918		Rock_bream_iridovirus(100.0%)	1	NA	NA
WP_033649388.1|2594155_2594617_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	38.2	6.5e-21
>prophage 202
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2601745	2603245	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033636380.1|2601745_2603245_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	1.7e-14
>prophage 203
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2607873	2608455	5140918		Klosneuvirus(100.0%)	1	NA	NA
WP_048322131.1|2607873_2608455_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	28.5	3.1e-12
>prophage 204
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2623304	2640512	5140918		Tupanvirus(60.0%)	5	NA	NA
WP_048322018.1|2623304_2624798_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	4.3e-13
WP_048322017.1|2625890_2628965_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	25.4	6.6e-61
WP_048322016.1|2629026_2630826_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	32.8	6.4e-80
WP_048322015.1|2630865_2636361_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	37.4	1.4e-53
WP_048322130.1|2636438_2640512_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.0	2.1e-70
>prophage 205
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2654522	2655200	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033636353.1|2654522_2655200_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.9	1.2e-23
>prophage 206
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2686427	2688875	5140918		Dickeya_phage(100.0%)	1	NA	NA
WP_033636332.1|2686427_2688875_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	84.5	9.4e-34
>prophage 207
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2702812	2705218	5140918		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_033649338.1|2702812_2705218_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	4.8e-14
>prophage 208
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2716771	2722909	5140918		Bacillus_phage(50.0%)	7	NA	NA
WP_033649331.1|2716771_2717734_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	1.3e-07
WP_033649330.1|2717739_2718045_+	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
WP_004709363.1|2718302_2719022_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_033636312.1|2719018_2720389_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.9	8.2e-11
WP_033636311.1|2720423_2720903_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004930730.1|2720899_2721163_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_015379308.1|2721289_2722909_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	1.9e-139
>prophage 209
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2733268	2734513	5140918		Enterobacteria_phage(100.0%)	1	NA	NA
WP_048322009.1|2733268_2734513_+	DNA uptake porin HofQ	NA	D0U174	Enterobacteria_phage	24.7	1.1e-11
>prophage 210
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2737842	2738655	5140918		Vibrio_phage(100.0%)	1	NA	NA
WP_004930319.1|2737842_2738655_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	5.8e-65
>prophage 211
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2752332	2761887	5140918		Catovirus(16.67%)	8	NA	NA
WP_033636286.1|2752332_2752902_+	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
WP_048322007.1|2753058_2754744_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	5.2e-225
WP_048322006.1|2754743_2755469_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043148391.1|2755764_2756034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043148392.1|2756244_2757771_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_033636278.1|2757843_2758419_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_033649310.1|2758550_2759768_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	6.1e-26
WP_033649309.1|2759808_2761887_-	membrane protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
>prophage 212
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2768264	2772627	5140918		Bacillus_virus(50.0%)	4	NA	NA
WP_033649303.1|2768264_2769032_+	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	37.0	8.8e-39
WP_033631937.1|2769028_2769865_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_039569235.1|2769861_2770710_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_033649301.1|2770713_2772627_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	5.9e-76
>prophage 213
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2782428	2788030	5140918		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_033636259.1|2782428_2782818_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	45.0	1.7e-17
WP_033636258.1|2782825_2783185_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_033636257.1|2783194_2783482_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004930426.1|2783625_2784000_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004956203.1|2784096_2784567_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_033636256.1|2784660_2786775_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.3	2.3e-57
WP_015376315.1|2786845_2788030_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	3.4e-13
>prophage 214
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2807597	2811917	5140918	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_048322003.1|2807597_2808542_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	33.6	2.4e-06
WP_033636244.1|2808559_2809069_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	4.4e-18
WP_048322002.1|2809202_2810324_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_033650013.1|2810295_2810769_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004929705.1|2810794_2811340_+	Zn-finger domain-containing protein (topoisomerase type I-like)	NA	NA	NA	NA	NA
WP_033650012.1|2811347_2811917_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	28.5	6.4e-10
>prophage 215
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2831196	2834892	5140918		Dickeya_phage(100.0%)	1	NA	NA
WP_108658212.1|2831196_2834892_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.9	2.9e-26
>prophage 216
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2839365	2840358	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_033649699.1|2839365_2840358_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.4e-28
>prophage 217
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2862969	2864079	5140918		Mycoplasma_phage(100.0%)	1	NA	NA
WP_033636214.1|2862969_2864079_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	2.3e-16
>prophage 218
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2874824	2875433	5140918		Lactococcus_phage(100.0%)	1	NA	NA
WP_004936736.1|2874824_2875433_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.9	6.6e-13
>prophage 219
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2881778	2884300	5140918		Salmonella_phage(50.0%)	2	NA	NA
WP_025160134.1|2881778_2883203_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	77.0	6.2e-195
WP_033649713.1|2883220_2884300_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	1.7e-27
>prophage 220
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2888710	2898305	5140918		Tupanvirus(20.0%)	9	NA	NA
WP_033649716.1|2888710_2889763_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.6	1.1e-79
WP_033636192.1|2889992_2892821_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	3.7e-308
WP_004936793.1|2893098_2893629_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	85.8	1.1e-56
WP_033649717.1|2893691_2894441_-	3-oxoacyl-ACP reductase FabG	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	32.6	4.8e-05
WP_033636189.1|2894590_2894851_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_033636188.1|2895047_2895491_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_033649718.1|2895487_2896156_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_033649719.1|2896203_2896611_+	VOC family protein	NA	NA	NA	NA	NA
WP_033636185.1|2896943_2898305_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.3	4.6e-163
>prophage 221
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2902971	2923809	5140918		Tupanvirus(25.0%)	4	NA	NA
WP_108658198.1|2902971_2920824_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.6	1.4e-163
WP_033649103.1|2920872_2921568_-	CTP synthase	NA	A0A0R6PHX8	Moraxella_phage	27.5	2.4e-19
WP_033648968.1|2921686_2922607_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	52.7	7.5e-77
WP_033648969.1|2922903_2923809_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	38.4	6.8e-38
>prophage 222
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2936823	2937867	5140918		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003855260.1|2936823_2937867_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 223
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2975900	2984785	5140918		Thermobifida_phage(20.0%)	11	NA	NA
WP_015379177.1|2975900_2976755_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	1.9e-05
WP_004937036.1|2976884_2977331_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004937038.1|2977501_2977789_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_033648997.1|2977812_2979246_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004937040.1|2979298_2980024_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	4.2e-22
WP_004937045.1|2980030_2980570_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_033636134.1|2980538_2981117_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_021505108.1|2981113_2981668_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	86.0	5.9e-61
WP_033648998.1|2981685_2982672_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_025160120.1|2982688_2983666_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_028127533.1|2983969_2984785_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.0	1.5e-20
>prophage 224
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2988852	2991370	5140918	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_033636127.1|2988852_2989911_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	5.5e-23
WP_033636125.1|2989999_2991370_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	2.5e-20
>prophage 225
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	2995384	2995885	5140918	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004937084.1|2995384_2995885_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.8	6.2e-25
>prophage 226
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3005224	3013762	5140918		Hokovirus(33.33%)	8	NA	NA
WP_033649005.1|3005224_3007564_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.5	3.2e-39
WP_048321981.1|3007801_3008455_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_048321980.1|3008451_3009183_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_033636114.1|3009222_3009798_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004937103.1|3009807_3010398_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	1.9e-12
WP_086556960.1|3010449_3010803_-	YraN family protein	NA	NA	NA	NA	NA
WP_041036809.1|3010799_3012836_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004937108.1|3012898_3013762_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.9	4.8e-49
>prophage 227
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3028294	3029269	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_033649013.1|3028294_3029269_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.1	2.5e-38
>prophage 228
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3035605	3040118	5140918		Hokovirus(33.33%)	3	NA	NA
WP_033649019.1|3035605_3037225_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	24.6	5.3e-17
WP_033649020.1|3037240_3038731_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.8	2.0e-15
WP_048321975.1|3038852_3040118_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	5.4e-25
>prophage 229
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3045181	3089939	5140918	capsid,portal,plate,terminase,tRNA,tail,lysis,integrase,head	Erwinia_phage(45.0%)	54	3045039:3045089	3080328:3080378
3045039:3045089	attL	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_049279097.1|3045181_3046216_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
WP_048321973.1|3046219_3046804_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
WP_048321972.1|3046913_3047135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379133.1|3047165_3047675_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
WP_048322123.1|3047685_3047865_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_031221632.1|3047876_3048179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321971.1|3048242_3048485_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048321970.1|3048484_3048796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321969.1|3048795_3049014_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.9	5.6e-15
WP_072071910.1|3049019_3049601_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	58.4	1.7e-58
WP_048321968.1|3049723_3050005_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_048321967.1|3050001_3052218_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.3	3.1e-238
WP_072071909.1|3052256_3052469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071908.1|3052629_3054426_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_072071907.1|3054422_3055505_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_072071906.1|3055889_3056144_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.6e-16
WP_033633573.1|3056143_3056485_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_048321966.1|3056529_3057564_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
WP_033632041.1|3057563_3059336_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	5.2e-292
WP_048321965.1|3059478_3060294_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.5	7.1e-71
WP_048321964.1|3060336_3061521_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	4.5e-159
WP_033649039.1|3061523_3062183_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_033639340.1|3062276_3062765_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_048321963.1|3062764_3062968_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	1.8e-20
WP_031231709.1|3062972_3063182_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_048321962.1|3063165_3063678_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	6.7e-59
WP_048321961.1|3063674_3064103_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.0	4.6e-13
WP_048321960.1|3064198_3064675_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	1.1e-50
WP_048321959.1|3064661_3065111_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	61.1	7.2e-41
WP_072071905.1|3065193_3067023_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	24.7	3.7e-11
WP_048321958.1|3067104_3067734_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.3	1.1e-76
WP_108658200.1|3067749_3068016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321956.1|3068012_3068363_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
WP_048321955.1|3068367_3069276_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.9	2.4e-107
WP_048321954.1|3069268_3069802_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	1.6e-76
WP_108658201.1|3069808_3072469_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.8e-61
WP_072071904.1|3072474_3072894_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	2.6e-16
WP_048321952.1|3073169_3074339_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
WP_023447563.1|3074354_3074864_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_048321951.1|3074918_3075200_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	9.1e-26
WP_023456045.1|3075232_3075355_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_048321950.1|3075347_3078176_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.1	2.8e-106
WP_015379102.1|3078175_3078661_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_048321949.1|3078657_3079818_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.4	7.4e-138
WP_033644586.1|3079901_3080132_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
WP_033649053.1|3080555_3081044_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3080328:3080378	attR	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_033636080.1|3081119_3082961_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_025304325.1|3083118_3084867_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_001144069.1|3085003_3085219_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_033649054.1|3085544_3086558_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
WP_033636078.1|3086588_3087227_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_033636077.1|3087334_3087694_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_033649055.1|3087830_3088655_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_033649056.1|3088694_3089939_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	45.4	2.8e-90
>prophage 230
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3095228	3102630	5140918		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_033649059.1|3095228_3096659_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	3.1e-37
WP_033654817.1|3096717_3096993_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_033636071.1|3097410_3098064_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.0	6.6e-43
WP_043148023.1|3098117_3099650_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_033649061.1|3099973_3100756_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_033649062.1|3100803_3101964_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	46.0	2.5e-93
WP_015379087.1|3101967_3102630_-	DUF1190 family protein	NA	A0A191ZBZ0	Erwinia_phage	47.0	8.1e-41
>prophage 231
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3113803	3120215	5140918		Bacillus_virus(100.0%)	5	NA	NA
WP_025304305.1|3113803_3115699_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	3.4e-92
WP_033649070.1|3115782_3116697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033638602.1|3116702_3117011_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033636059.1|3117044_3117626_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048321948.1|3117941_3120215_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.6	1.3e-85
>prophage 232
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3129797	3133601	5140918		Pseudomonas_phage(50.0%)	3	NA	NA
WP_033649077.1|3129797_3131966_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.1	2.5e-102
WP_033649078.1|3132029_3132635_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_039569291.1|3132776_3133601_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.4	1.2e-62
>prophage 233
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3141193	3142603	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033649109.1|3141193_3142603_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.5	2.4e-18
>prophage 234
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3158113	3160442	5140918		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_033649092.1|3158113_3158953_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.8	3.7e-46
WP_004937338.1|3158930_3159827_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	45.7	1.1e-64
WP_033636033.1|3159827_3160442_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J122	uncultured_Caudovirales_phage	42.6	2.3e-37
>prophage 235
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3189045	3189480	5140918		Ralstonia_phage(100.0%)	1	NA	NA
WP_048321940.1|3189045_3189480_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	64.5	2.2e-47
>prophage 236
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3216079	3217507	5140918		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_086012780.1|3216079_3217507_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	3.9e-40
>prophage 237
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3223529	3227660	5140918		Mamastrovirus(33.33%)	4	NA	NA
WP_048321938.1|3223529_3225197_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	44.8	4.5e-19
WP_048234659.1|3225295_3225832_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	1.3e-17
WP_033635923.1|3225869_3226526_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_033635922.1|3226736_3227660_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.9	8.2e-23
>prophage 238
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3234807	3236355	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_071883846.1|3234807_3236355_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	32.5	1.3e-28
>prophage 239
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3239484	3241914	5140918		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_048321932.1|3239484_3241914_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	29.7	1.1e-39
>prophage 240
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3247022	3247820	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_043148003.1|3247022_3247820_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	29.1	8.6e-13
>prophage 241
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3251302	3252457	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033654692.1|3251302_3252457_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.7	9.0e-128
>prophage 242
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3256789	3256945	5140918		Stx_converting_phage(100.0%)	1	NA	NA
WP_015379015.1|3256789_3256945_+	Hok/Gef family protein	NA	A0A1I9LJU7	Stx_converting_phage	54.9	2.0e-06
>prophage 243
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3266068	3271667	5140918		Mycobacterium_phage(33.33%)	5	NA	NA
WP_043147999.1|3266068_3266887_+	alpha/beta hydrolase	NA	G1BRG0	Mycobacterium_phage	27.9	7.8e-09
WP_041036613.1|3266883_3267678_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	4.6e-06
WP_043147995.1|3267693_3268488_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_033649626.1|3268504_3269974_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039567914.1|3270026_3271667_+	thiamine pyrophosphate-binding protein	NA	G8DDL3	Micromonas_pusilla_virus	23.7	1.1e-25
>prophage 244
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3279607	3280678	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_039567242.1|3279607_3280678_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.4e-28
>prophage 245
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3290928	3291627	5140918		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_039567247.1|3290928_3291627_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.4	3.6e-07
>prophage 246
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3301678	3303232	5140918		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_033649426.1|3301678_3303232_-	sugar ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	28.7	4.3e-08
>prophage 247
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3308115	3309354	5140918		Catovirus(100.0%)	1	NA	NA
WP_025304156.1|3308115_3309354_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	3.4e-101
>prophage 248
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3317478	3320358	5140918		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_048321928.1|3317478_3320358_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.9	1.3e-265
>prophage 249
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3330972	3332490	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033649443.1|3330972_3332490_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.0	4.8e-12
>prophage 250
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3349012	3357571	5140918	tRNA	Brevibacillus_phage(25.0%)	6	NA	NA
WP_033638574.1|3349012_3349912_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.0	1.1e-29
WP_039567312.1|3349938_3350655_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_033635823.1|3350661_3352395_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	4.4e-62
WP_096242572.1|3352561_3353659_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_033649459.1|3353669_3355187_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.2	7.7e-87
WP_048321920.1|3355573_3357571_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.6	1.1e-21
>prophage 251
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3363521	3369426	5140918		Microcystis_virus(33.33%)	5	NA	NA
WP_033635813.1|3363521_3364274_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.2	8.4e-10
WP_033635812.1|3364308_3365166_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033649511.1|3365347_3367117_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.3	4.1e-47
WP_033649464.1|3367126_3367723_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_033649465.1|3367881_3369426_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.9	1.5e-21
>prophage 252
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3379075	3384309	5140918		Pithovirus(33.33%)	3	NA	NA
WP_048321914.1|3379075_3381199_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	32.0	5.0e-15
WP_080430921.1|3381227_3382367_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.8	8.6e-06
WP_048321912.1|3382356_3384309_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.2	7.8e-31
>prophage 253
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3387748	3388297	5140918	integrase	Escherichia_phage(100.0%)	1	3378508:3378522	3395934:3395948
3378508:3378522	attL	CTGGCGCCGATGCAT	NA	NA	NA	NA
WP_033635795.1|3387748_3388297_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.3	9.7e-48
WP_033635795.1|3387748_3388297_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.3	9.7e-48
3395934:3395948	attR	CTGGCGCCGATGCAT	NA	NA	NA	NA
>prophage 254
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3396087	3396639	5140918	integrase	Escherichia_phage(100.0%)	1	3390110:3390124	3402817:3402831
3390110:3390124	attL	ACGCTGGAGCAGGTG	NA	NA	NA	NA
WP_033649485.1|3396087_3396639_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.5	1.8e-49
WP_033649485.1|3396087_3396639_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.5	1.8e-49
3402817:3402831	attR	ACGCTGGAGCAGGTG	NA	NA	NA	NA
>prophage 255
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3405785	3407513	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_048321908.1|3405785_3407513_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.9	4.3e-09
>prophage 256
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3412160	3417761	5140918		Bovine_gammaherpesvirus(50.0%)	5	NA	NA
WP_033649495.1|3412160_3413423_+	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	26.4	2.4e-09
WP_004931828.1|3413450_3413753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033635775.1|3413758_3414103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033649496.1|3414262_3415282_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_048321906.1|3415502_3417761_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.9	4.9e-69
>prophage 257
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3423105	3429992	5140918		Moraxella_phage(33.33%)	6	NA	NA
WP_033635765.1|3423105_3423822_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.6	3.7e-47
WP_033635764.1|3423925_3424612_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004931849.1|3425308_3425836_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_033649500.1|3425848_3428095_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	6.0e-11
WP_033635761.1|3428317_3429190_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_048321904.1|3429197_3429992_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	71.2	2.6e-118
>prophage 258
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3435666	3451143	5140918	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_033649514.1|3435666_3438555_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	6.4e-74
WP_048321899.1|3438551_3442103_+	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	22.2	1.1e-09
WP_043147960.1|3442099_3443950_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	29.0	3.9e-32
WP_033635753.1|3443987_3445313_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_033635752.1|3445552_3446806_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	2.7e-13
WP_033635751.1|3447465_3448602_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004931886.1|3448686_3449493_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.1	4.2e-15
WP_033649797.1|3449483_3449918_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_048321898.1|3449937_3451143_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.1e-74
>prophage 259
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3454449	3457665	5140918		Bacillus_phage(50.0%)	3	NA	NA
WP_033649799.1|3454449_3455208_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.6	3.8e-10
WP_019455737.1|3455260_3456625_-	LOG family protein	NA	NA	NA	NA	NA
WP_033649800.1|3456819_3457665_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	40.3	1.1e-42
>prophage 260
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3480677	3481436	5140918		Flavobacterium_phage(100.0%)	1	NA	NA
WP_033635737.1|3480677_3481436_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.9e-25
>prophage 261
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3490369	3494534	5140918		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_033635733.1|3490369_3490963_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.8	8.6e-26
WP_048321892.1|3491045_3494534_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.3	1.4e-203
>prophage 262
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3504511	3505963	5140918		Acinetobacter_phage(100.0%)	1	NA	NA
WP_033635723.1|3504511_3505963_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.1	5.2e-48
>prophage 263
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3514682	3515714	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_004932012.1|3514682_3515714_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.2	1.8e-34
>prophage 264
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3522510	3523821	5140918		Burkholderia_virus(100.0%)	1	NA	NA
WP_033649758.1|3522510_3523821_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.4	5.0e-42
>prophage 265
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3528866	3529286	5140918		Streptomyces_phage(100.0%)	1	NA	NA
WP_004928868.1|3528866_3529286_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	5.9e-13
>prophage 266
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3541140	3542343	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033649772.1|3541140_3542343_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	4.9e-28
>prophage 267
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3546840	3554560	5140918		Faustovirus(25.0%)	10	NA	NA
WP_043147847.1|3546840_3547812_-	patatin-like phospholipase family protein	NA	A0A141ZNL4	Faustovirus	32.2	8.0e-37
WP_048321887.1|3548018_3548963_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048321886.1|3549114_3549855_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_039568654.1|3549919_3550114_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_039568721.1|3550191_3550479_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_039568652.1|3550478_3550766_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_033635683.1|3550809_3551781_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	77.2	2.5e-139
WP_049232496.1|3551789_3553934_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	1.8e-206
WP_033649781.1|3553915_3554320_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_033635681.1|3554329_3554560_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	53.4	2.0e-18
>prophage 268
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3559805	3560702	5140918		Lactobacillus_phage(100.0%)	1	NA	NA
WP_033649787.1|3559805_3560702_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.6	9.7e-05
>prophage 269
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3567629	3568364	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_033649792.1|3567629_3568364_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	43.2	8.7e-52
>prophage 270
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3582514	3583399	5140918		Salmonella_phage(100.0%)	1	NA	NA
WP_063864730.1|3582514_3583399_+	carbapenem-hydrolyzing class A beta-lactamase SME-4	NA	A0A1B0VBP7	Salmonella_phage	46.6	3.8e-62
>prophage 271
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3590781	3596281	5140918		Enterobacteria_phage(75.0%)	8	NA	NA
WP_048321880.1|3590781_3593115_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.5	5.1e-263
WP_016928971.1|3593125_3593461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033635645.1|3593457_3593721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046897664.1|3593717_3594263_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	1.9e-27
WP_033635644.1|3594268_3594514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321879.1|3594510_3594774_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	53.8	5.5e-17
WP_033638561.1|3595304_3596030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033635642.1|3596026_3596281_+	transcriptional regulator	NA	Q858U4	Yersinia_virus	53.1	1.8e-12
>prophage 272
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3600929	3603211	5140918	integrase	Escherichia_phage(50.0%)	2	3592827:3592839	3605365:3605377
3592827:3592839	attL	AGGCGCTGGCGCT	NA	NA	NA	NA
WP_033635640.1|3600929_3602123_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.4	2.2e-100
WP_016929804.1|3602728_3603211_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	3.2e-26
3605365:3605377	attR	AGCGCCAGCGCCT	NA	NA	NA	NA
>prophage 273
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3608174	3612857	5140918		Equid_alphaherpesvirus(33.33%)	5	NA	NA
WP_033635636.1|3608174_3608858_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.9	2.5e-53
WP_004929114.1|3609204_3609588_+	autonomous glycyl radical cofactor GrcA	NA	C3V1I5	Escherichia_virus	70.2	6.1e-33
WP_048321877.1|3609771_3610734_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_043147837.1|3610726_3611482_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_025303951.1|3611534_3612857_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	4.7e-40
>prophage 274
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3619634	3626493	5140918		Streptococcus_phage(33.33%)	8	NA	NA
WP_033648940.1|3619634_3621434_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	3.2e-23
WP_033635624.1|3621466_3622444_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004929158.1|3622680_3623361_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.3	9.6e-21
WP_004929162.1|3623357_3624266_+	GTPase Era	NA	NA	NA	NA	NA
WP_004929165.1|3624272_3625004_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_025303943.1|3625075_3625807_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004929169.1|3625806_3626187_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_033648939.1|3626232_3626493_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.8e-18
>prophage 275
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3633445	3645870	5140918	tRNA	Pandoravirus(20.0%)	7	NA	NA
WP_033648933.1|3633445_3633952_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	7.7e-07
WP_004941352.1|3633952_3635413_-	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	38.8	4.8e-09
WP_048322116.1|3635690_3639581_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-127
WP_033635614.1|3640468_3641905_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	2.6e-15
WP_050438972.1|3641908_3642781_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_033635613.1|3642777_3644118_+	two-component system response regulator GlrR	NA	NA	NA	NA	NA
WP_025303930.1|3644247_3645870_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	4.1e-94
>prophage 276
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3650404	3651433	5140918		Bacillus_virus(100.0%)	1	NA	NA
WP_033648930.1|3650404_3651433_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	7.5e-25
>prophage 277
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3659451	3660705	5140918		Aeromonas_phage(100.0%)	1	NA	NA
WP_004941389.1|3659451_3660705_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.6	1.0e-100
>prophage 278
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3667559	3675705	5140918		Faustovirus(16.67%)	10	NA	NA
WP_016929764.1|3667559_3668774_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	33.1	2.5e-35
WP_033635600.1|3668798_3669185_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	81.5	2.2e-54
WP_004941410.1|3669239_3669563_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	1.2e-21
WP_033648919.1|3669625_3670147_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_033648918.1|3670179_3672030_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.1	1.8e-101
WP_004941417.1|3672032_3672368_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_006327336.1|3672400_3672601_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_086556948.1|3672916_3674197_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.1	1.7e-34
WP_033648917.1|3674286_3675117_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_004941424.1|3675279_3675705_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	37.3	3.5e-13
>prophage 279
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3692834	3695845	5140918		Gordonia_phage(50.0%)	2	NA	NA
WP_031299944.1|3692834_3694211_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.4	6.5e-32
WP_033635581.1|3694381_3695845_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	8.8e-88
>prophage 280
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3699130	3700912	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_033648861.1|3699130_3700912_-	response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.7	3.5e-14
>prophage 281
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3712672	3713644	5140918		Tetraselmis_virus(100.0%)	1	NA	NA
WP_016926691.1|3712672_3713644_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	35.2	4.2e-38
>prophage 282
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3721447	3726421	5140918	tRNA	Bacillus_phage(66.67%)	6	NA	NA
WP_033654556.1|3721447_3722800_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	80.8	3.3e-174
WP_033648841.1|3722980_3723319_-	YegP family protein	NA	NA	NA	NA	NA
WP_033648840.1|3723658_3723922_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033648839.1|3723925_3724315_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033635542.1|3724322_3725039_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	7.5e-32
WP_033635541.1|3725038_3726421_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.9	1.1e-28
>prophage 283
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3740844	3744717	5140918		Shigella_phage(50.0%)	2	NA	NA
WP_033635531.1|3740844_3741198_-	putative DNA-binding transcriptional regulator	NA	A0A0C4UR24	Shigella_phage	38.1	9.1e-07
WP_048321868.1|3741390_3744717_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	1.7e-17
>prophage 284
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3754670	3755483	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_019452422.1|3754670_3755483_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	4.0e-13
>prophage 285
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3759599	3765581	5140918		Moraxella_phage(100.0%)	1	NA	NA
WP_033648822.1|3759599_3765581_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	32.1	4.8e-31
>prophage 286
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3770664	3777558	5140918		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_033648819.1|3770664_3771303_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	1.1e-26
WP_025303843.1|3771302_3772340_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_004941642.1|3772595_3773222_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033635515.1|3773298_3774588_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	3.5e-64
WP_033648818.1|3774696_3775347_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_033635514.1|3775383_3775632_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033635512.1|3775663_3776179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025159568.1|3776451_3777153_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_033648817.1|3777204_3777558_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	5.5e-20
>prophage 287
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3792347	3793061	5140918		Synechococcus_phage(100.0%)	1	NA	NA
WP_033648811.1|3792347_3793061_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	4.1e-38
>prophage 288
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3812646	3818390	5140918	holin	Cyanophage(20.0%)	6	NA	NA
WP_033649859.1|3812646_3813597_-	transaldolase	NA	A0A127KNC6	Cyanophage	34.1	5.1e-12
WP_033635482.1|3813854_3814448_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.7	1.4e-23
WP_033635481.1|3814852_3815794_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033649858.1|3815880_3817380_-	chitinase	NA	U5KBK0	Clostera_anastomosis_granulovirus	28.3	3.3e-21
WP_004936551.1|3817672_3817999_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	39.7	6.6e-12
WP_033635478.1|3817988_3818390_+	M15 family metallopeptidase	NA	A0A1P8DTR0	Salmonella_phage	60.0	7.1e-40
>prophage 289
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3831750	3853994	5140918		Bacillus_phage(20.0%)	23	NA	NA
WP_033649849.1|3831750_3832632_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	M4ZRP4	Bacillus_phage	29.0	1.6e-12
WP_004936504.1|3832836_3833262_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_016926776.1|3833304_3833703_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	47.3	7.1e-24
WP_033649848.1|3833881_3834346_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_033649847.1|3834502_3835090_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_033649846.1|3835272_3836172_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	33.6	1.3e-25
WP_033635463.1|3836372_3837395_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019453852.1|3837395_3838235_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_033635461.1|3838234_3839110_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_033635460.1|3839099_3840188_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	41.2	2.7e-33
WP_048322112.1|3840269_3841151_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.2e-54
WP_033635459.1|3841408_3842089_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041036181.1|3842095_3843421_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.0	5.1e-18
WP_004936467.1|3843496_3844006_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_043147794.1|3844055_3845783_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	7.9e-19
WP_033635455.1|3845829_3846087_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_033635454.1|3846485_3847454_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.1	1.1e-73
WP_033635453.1|3847639_3848398_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_033649840.1|3848619_3849636_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_048321861.1|3849715_3851737_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.6	2.1e-140
WP_004936441.1|3851736_3851952_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_048321860.1|3851978_3852977_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_033649836.1|3853073_3853994_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.8	3.3e-08
>prophage 290
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3866752	3867559	5140918		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_033649861.1|3866752_3867559_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	3.1e-10
>prophage 291
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3894177	3894912	5140918		Clostridioides_phage(100.0%)	1	NA	NA
WP_033635419.1|3894177_3894912_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.0e-12
>prophage 292
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3900112	3901772	5140918		Escherichia_phage(50.0%)	3	NA	NA
WP_048321854.1|3900112_3900637_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	53.8	1.4e-27
WP_099782600.1|3900703_3900778_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_033648105.1|3901334_3901772_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	31.8	4.6e-08
>prophage 293
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3919005	3923178	5140918		Streptococcus_phage(33.33%)	4	NA	NA
WP_108658204.1|3919005_3919806_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	32.4	9.0e-10
WP_048321849.1|3919991_3921101_+	lactonase family protein	NA	NA	NA	NA	NA
WP_048321848.1|3921398_3922325_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	67.8	1.7e-108
WP_048321847.1|3922545_3923178_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	26.7	8.4e-11
>prophage 294
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3938849	3939935	5140918		Pandoravirus(100.0%)	1	NA	NA
WP_033635387.1|3938849_3939935_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	6.3e-91
>prophage 295
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3951164	3952598	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_048321843.1|3951164_3952598_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	7.5e-15
>prophage 296
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3960827	3961457	5140918		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_048321838.1|3960827_3961457_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.1	4.6e-17
>prophage 297
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3965221	3965896	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033648064.1|3965221_3965896_+	transcriptional regulator TctD	NA	W8CYM9	Bacillus_phage	34.4	1.0e-30
>prophage 298
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3969162	3970284	5140918		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_039564969.1|3969162_3970284_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.5	4.3e-18
>prophage 299
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3977059	3978577	5140918		Mollivirus(100.0%)	1	NA	NA
WP_033653751.1|3977059_3978577_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.4	1.2e-90
>prophage 300
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3981860	3982634	5140918		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004936098.1|3981860_3982634_+	histidine ABC transporter ATP-binding protein HisP	NA	F2Y165	Organic_Lake_phycodnavirus	25.1	3.8e-05
>prophage 301
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3986168	3987188	5140918		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004936083.1|3986168_3987188_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.8	2.0e-22
>prophage 302
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	3997682	4000896	5140918		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_033648049.1|3997682_3998339_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	25.9	3.3e-10
WP_071998128.1|3998418_4000269_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_025303666.1|4000296_4000896_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	33.8	3.8e-05
>prophage 303
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4032420	4033857	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_048321828.1|4032420_4033857_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.3	1.4e-98
>prophage 304
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4038134	4058756	5140918		Pseudomonas_phage(25.0%)	17	NA	NA
WP_033635302.1|4038134_4038395_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	63.5	3.8e-18
WP_019453694.1|4038398_4039529_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	5.6e-175
WP_033635301.1|4039596_4041885_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.7	7.1e-286
WP_004935909.1|4042323_4043049_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004935906.1|4043261_4045904_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.4e-104
WP_043147736.1|4046067_4048935_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	6.5e-34
WP_004935900.1|4048996_4049647_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_048321826.1|4049639_4052342_-	phosphotransferase RcsD	NA	A0A1V0SGX0	Hokovirus	25.3	1.2e-16
WP_033648025.1|4052362_4053517_-	MFS transporter	NA	NA	NA	NA	NA
WP_089185413.1|4053571_4053979_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_133306283.1|4054151_4054403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033635297.1|4054675_4055806_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.8e-104
WP_043147735.1|4055957_4056374_+	glyoxalase	NA	NA	NA	NA	NA
WP_043147734.1|4056367_4056946_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043147733.1|4057053_4057521_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033635291.1|4057647_4057977_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_004935803.1|4058513_4058756_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	81.0	4.4e-29
>prophage 305
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4063121	4066193	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_048321822.1|4063121_4066193_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	27.6	1.1e-07
>prophage 306
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4074776	4082909	5140918		Vibrio_phage(50.0%)	7	NA	NA
WP_025303563.1|4074776_4075784_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.1	9.1e-84
WP_004935776.1|4075868_4076153_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_033635283.1|4076315_4078073_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	1.7e-98
WP_048321821.1|4078391_4079105_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_025303559.1|4079146_4080343_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.4	8.1e-23
WP_004935763.1|4080937_4081282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321820.1|4081298_4082909_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	2.8e-18
>prophage 307
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4088931	4093842	5140918		Clostridioides_phage(50.0%)	5	NA	NA
WP_033635277.1|4088931_4089507_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	4.3e-14
WP_043147725.1|4089917_4090628_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_033648007.1|4090705_4091680_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_033635274.1|4091998_4092307_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_048321817.1|4092369_4093842_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.8	1.7e-38
>prophage 308
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4099157	4101632	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_039565080.1|4099157_4101632_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	32.2	1.8e-88
>prophage 309
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4107536	4108376	5140918		Catovirus(100.0%)	1	NA	NA
WP_033635262.1|4107536_4108376_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.0	2.2e-22
>prophage 310
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4115197	4121765	5140918		Indivirus(33.33%)	5	NA	NA
WP_033647994.1|4115197_4115986_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.6	7.2e-12
WP_048321812.1|4116019_4116973_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048321811.1|4117028_4119017_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.7	9.4e-08
WP_033648150.1|4119261_4120257_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039565101.1|4120253_4121765_-	sugar ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	24.3	3.8e-09
>prophage 311
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4129636	4130383	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_004935623.1|4129636_4130383_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.6	5.2e-44
>prophage 312
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4138678	4140169	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033655112.1|4138678_4140169_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	2.6e-18
>prophage 313
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4167414	4169154	5140918		Catovirus(100.0%)	1	NA	NA
WP_072071901.1|4167414_4169154_-	fatty acyl-AMP ligase	NA	A0A1V0SBX8	Catovirus	25.5	1.3e-16
>prophage 314
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4173401	4174697	5140918		Burkholderia_virus(100.0%)	1	NA	NA
WP_048321788.1|4173401_4174697_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.2	1.9e-62
>prophage 315
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4182342	4185250	5140918		Staphylococcus_phage(50.0%)	4	NA	NA
WP_033647952.1|4182342_4183059_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	2.5e-11
WP_048321785.1|4183089_4183512_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043147688.1|4183598_4184546_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_033654946.1|4184563_4185250_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	37.5	3.9e-22
>prophage 316
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4201276	4204112	5140918		Mycobacterium_phage(50.0%)	3	NA	NA
WP_048321779.1|4201276_4202107_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.1	8.4e-11
WP_048321777.1|4202174_4203227_-	porin	NA	NA	NA	NA	NA
WP_048321775.1|4203281_4204112_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N6W8I1	Bacillus_phage	26.5	1.9e-15
>prophage 317
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4208393	4210863	5140918		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_048321770.1|4208393_4209161_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	5.8e-14
WP_033654929.1|4209262_4210138_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_033647935.1|4210134_4210863_+	hypothetical protein	NA	A0A1I9KF49	Aeromonas_phage	26.9	7.6e-08
>prophage 318
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4214747	4217837	5140918		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_048321764.1|4214747_4217837_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	65.1	0.0e+00
>prophage 319
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4247929	4248754	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033647906.1|4247929_4248754_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	5.3e-58
>prophage 320
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4252117	4252858	5140918		Cedratvirus(100.0%)	1	NA	NA
WP_033647902.1|4252117_4252858_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.5	3.3e-14
>prophage 321
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4291563	4304238	5140918		Salmonella_phage(50.0%)	2	NA	NA
WP_101428034.1|4291563_4293582_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	63.2	1.4e-131
WP_048321754.1|4294221_4304238_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.1	3.3e-125
>prophage 322
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4322535	4323594	5140918		Synechococcus_phage(100.0%)	1	NA	NA
WP_033647859.1|4322535_4323594_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	C7BUZ5	Synechococcus_phage	40.5	1.7e-08
>prophage 323
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4332450	4333371	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_033647852.1|4332450_4333371_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	44.4	1.1e-64
>prophage 324
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4339719	4339932	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_004935122.1|4339719_4339932_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	77.1	9.9e-25
>prophage 325
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4349272	4352913	5140918		Bacillus_virus(50.0%)	2	NA	NA
WP_025303346.1|4349272_4349971_+	MgtC family protein	NA	G3MA03	Bacillus_virus	37.7	1.2e-13
WP_033653591.1|4350213_4352913_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	24.1	5.7e-40
>prophage 326
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4356080	4358212	5140918		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_048321745.1|4356080_4356407_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	3.2e-22
WP_048321743.1|4356476_4357760_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.8	3.0e-164
WP_048321742.1|4357780_4358212_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.1	2.1e-45
>prophage 327
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4362804	4363239	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_033635060.1|4362804_4363239_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	4.2e-38
>prophage 328
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4368673	4369960	5140918		Cronobacter_phage(100.0%)	1	NA	NA
WP_043147625.1|4368673_4369960_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	5.6e-155
>prophage 329
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4379441	4388670	5140918		Erysipelothrix_phage(25.0%)	6	NA	NA
WP_033647818.1|4379441_4380779_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-105
WP_033635042.1|4380927_4381770_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_033647817.1|4381791_4382259_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_033647816.1|4382450_4384379_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	37.8	2.6e-18
WP_033647815.1|4384520_4385966_-	serine/threonine protein kinase	NA	A0A1X9WHY5	Cercopithecine_herpesvirus	28.6	2.3e-08
WP_048321736.1|4386015_4388670_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.0	3.8e-81
>prophage 330
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4417527	4419867	5140918		Ralstonia_phage(100.0%)	1	NA	NA
WP_033647800.1|4417527_4419867_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.3	8.1e-51
>prophage 331
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4431172	4436987	5140918		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_039565488.1|4431172_4432843_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.0	2.1e-13
WP_033647792.1|4432919_4434536_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.0	1.1e-14
WP_004934868.1|4434573_4435446_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_033635003.1|4435445_4436495_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	2.7e-06
WP_004934862.1|4436597_4436987_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.7e-06
>prophage 332
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4450323	4451268	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033653638.1|4450323_4451268_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	37.7	7.6e-16
>prophage 333
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4480213	4480966	5140918		Planktothrix_phage(100.0%)	1	NA	NA
WP_039565546.1|4480213_4480966_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.9	1.7e-34
>prophage 334
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4491578	4526457	5140918	capsid,portal,plate,terminase,tail,integrase,head	Escherichia_phage(25.71%)	43	4492385:4492406	4525337:4525358
WP_015378226.1|4491578_4492367_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.3	9.2e-92
4492385:4492406	attL	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
WP_048321723.1|4492511_4493495_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	64.8	4.1e-121
WP_072071899.1|4493582_4493882_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
WP_048321722.1|4494007_4494283_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.5e-33
WP_037421654.1|4494474_4494975_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	72.3	2.2e-67
WP_033652239.1|4495038_4495296_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048321721.1|4495288_4495588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021504068.1|4495590_4495806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321719.1|4495808_4496090_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	56.8	7.7e-25
WP_048321718.1|4496086_4498375_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.5	1.5e-267
WP_048321717.1|4498464_4499193_+	hypothetical protein	NA	Q37850	Escherichia_phage	57.0	9.8e-72
WP_048321716.1|4499378_4501028_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048321715.1|4501024_4502167_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048321714.1|4502478_4503510_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.3	6.3e-165
WP_048321713.1|4503506_4505279_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	81.3	3.8e-287
WP_048321712.1|4505439_4506285_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	66.7	9.6e-103
WP_080441019.1|4506355_4507555_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	75.9	9.3e-152
WP_048321711.1|4507557_4508301_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.9e-71
WP_021504058.1|4508394_4508901_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	71.4	1.5e-63
WP_048321710.1|4508900_4509104_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	1.1e-20
WP_033652228.1|4509106_4509316_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	39.1	9.8e-09
WP_048321708.1|4509299_4509809_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.7	1.5e-63
WP_048321707.1|4509805_4510243_+	hypothetical protein	NA	O80310	Escherichia_phage	42.4	1.2e-13
WP_048321706.1|4510332_4510800_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	4.5e-62
WP_048321705.1|4510792_4511239_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.6	2.9e-50
WP_053063701.1|4511314_4511752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147435411.1|4511741_4512272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321701.1|4512428_4513070_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.6	2.9e-67
WP_048321700.1|4513066_4513417_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	8.9e-39
WP_048321699.1|4513421_4514330_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	64.9	1.5e-101
WP_048321698.1|4514322_4514856_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	6.3e-76
WP_080441018.1|4514862_4516959_+	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	7.0e-62
WP_048321697.1|4516960_4517485_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.3	6.2e-36
WP_048321696.1|4517653_4517872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321695.1|4518608_4519778_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	81.4	6.2e-185
WP_048321694.1|4519794_4520313_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	1.0e-75
WP_048321692.1|4520370_4520673_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.3	1.9e-29
WP_071796738.1|4520705_4520825_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	4.5e-11
WP_048321691.1|4520817_4523265_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	64.9	1.7e-256
WP_033644295.1|4523277_4523763_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	3.5e-49
WP_048321690.1|4523759_4524929_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.7	3.0e-163
WP_033643461.1|4525008_4525227_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.8e-21
WP_039565556.1|4525554_4526457_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.8	5.7e-37
4525337:4525358	attR	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
>prophage 335
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4534927	4536438	5140918		Planktothrix_phage(100.0%)	2	NA	NA
WP_048321687.1|4534927_4535770_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	3.5e-12
WP_033634942.1|4535766_4536438_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.2	4.4e-26
>prophage 336
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4564697	4566242	5140918		Escherichia_phage(100.0%)	1	NA	NA
WP_033634924.1|4564697_4566242_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	45.2	2.7e-18
>prophage 337
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4580804	4583649	5140918		Moumouvirus(50.0%)	2	NA	NA
WP_043147591.1|4580804_4581779_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	37.9	4.2e-54
WP_033647702.1|4582434_4583649_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.6e-26
>prophage 338
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4589162	4591702	5140918		Enterobacteria_phage(50.0%)	4	NA	NA
WP_033634904.1|4589162_4590245_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	6.1e-110
WP_033634903.1|4590487_4590712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004934567.1|4590835_4591027_-	YebW family protein	NA	NA	NA	NA	NA
WP_048321675.1|4591255_4591702_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	43.6	8.3e-05
>prophage 339
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4597195	4597498	5140918		Enterobacterial_phage(100.0%)	1	NA	NA
WP_004927682.1|4597195_4597498_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	35.7	3.5e-07
>prophage 340
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4601778	4601988	5140918		Morganella_phage(100.0%)	1	NA	NA
WP_002221949.1|4601778_4601988_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
>prophage 341
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4608536	4610081	5140918		Moraxella_phage(100.0%)	1	NA	NA
WP_033634886.1|4608536_4610081_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.6	4.7e-39
>prophage 342
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4614338	4615712	5140918		Pandoravirus(100.0%)	1	NA	NA
WP_043147905.1|4614338_4615712_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.3	3.1e-42
>prophage 343
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4619009	4624352	5140918		Morganella_phage(33.33%)	7	NA	NA
WP_004927572.1|4619009_4619219_+	cold shock-like protein CspC	NA	A0A1W6JNX5	Morganella_phage	75.8	2.7e-22
WP_033634877.1|4619366_4620749_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.4	1.0e-53
WP_033647671.1|4620837_4621161_+	YebG family protein	NA	NA	NA	NA	NA
WP_004927562.1|4621200_4621509_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_043147583.1|4621579_4621939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004927555.1|4621995_4622559_-	lipoprotein	NA	NA	NA	NA	NA
WP_033647669.1|4622711_4624352_-	phosphotransferase	NA	A0A2P0VMP1	Tetraselmis_virus	24.7	2.5e-22
>prophage 344
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4630894	4632625	5140918	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_033647654.1|4630894_4632625_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.3	2.7e-88
>prophage 345
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4640906	4652172	5140918	tRNA	Bacillus_virus(33.33%)	13	NA	NA
WP_086581081.1|4640906_4641722_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	69.3	3.2e-47
WP_033648128.1|4641775_4642354_-	hydrolase	NA	NA	NA	NA	NA
WP_033632845.1|4642608_4642800_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_033647641.1|4642874_4644659_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	1.1e-07
WP_004932373.1|4644658_4645105_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_033647638.1|4645124_4645868_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_033634853.1|4645925_4646447_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	26.5	1.4e-08
WP_033634852.1|4646559_4647174_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_025303125.1|4647193_4648198_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.1	1.2e-08
WP_033647637.1|4648264_4649050_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_033647636.1|4649046_4649805_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	32.2	4.5e-19
WP_039567087.1|4649883_4650828_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_033634847.1|4650849_4652172_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.0	1.5e-14
>prophage 346
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4657261	4666595	5140918	tRNA	Cyanophage(33.33%)	9	NA	NA
WP_033634844.1|4657261_4658737_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	8.1e-81
WP_033647633.1|4658891_4659533_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_033634840.1|4660084_4660453_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_033634839.1|4660439_4660769_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_033634838.1|4660831_4661176_-	RidA family protein	NA	NA	NA	NA	NA
WP_033647629.1|4661309_4663226_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.9	5.7e-87
WP_033647628.1|4663305_4664007_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_033638506.1|4664107_4664698_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_033634834.1|4664906_4666595_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	1.0e-34
>prophage 347
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4682349	4684181	5140918		Salmonella_phage(50.0%)	2	NA	NA
WP_033647617.1|4682349_4683543_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	1.0e-25
WP_033634819.1|4683620_4684181_-	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	45.3	5.8e-40
>prophage 348
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4687639	4688908	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033634813.1|4687639_4688908_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	2.6e-11
>prophage 349
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4695359	4697501	5140918		Artogeia_rapae_granulovirus(50.0%)	2	NA	NA
WP_048321664.1|4695359_4696637_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.7	1.2e-24
WP_048321663.1|4696868_4697501_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.5	5.4e-18
>prophage 350
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4703520	4717762	5140918		Bacillus_phage(33.33%)	14	NA	NA
WP_048321660.1|4703520_4705446_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.1	1.9e-37
WP_033647604.1|4705442_4705739_+	YnjH family protein	NA	NA	NA	NA	NA
WP_033647603.1|4705760_4706162_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_033647602.1|4706206_4707013_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004932190.1|4707114_4707687_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.6	1.4e-17
WP_016927485.1|4708829_4709678_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.5	4.6e-12
WP_043147567.1|4709746_4710211_-	YchJ family protein	NA	NA	NA	NA	NA
WP_033634795.1|4710329_4711232_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_043147565.1|4711335_4712349_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_033647598.1|4712561_4713479_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.4	2.0e-58
WP_033634791.1|4713519_4714863_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	9.6e-81
WP_033634790.1|4714872_4715883_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_004932170.1|4716069_4716477_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_033634789.1|4717177_4717762_+	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	53.2	3.1e-52
>prophage 351
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4727789	4732674	5140918		Planktothrix_phage(33.33%)	6	NA	NA
WP_033647596.1|4727789_4728806_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-15
WP_025303071.1|4728802_4729804_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.0	8.1e-08
WP_004932139.1|4729877_4730201_-	YciU family protein	NA	NA	NA	NA	NA
WP_025159793.1|4730257_4731718_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_025159792.1|4731960_4732137_+	YciY family protein	NA	NA	NA	NA	NA
WP_004932132.1|4732182_4732674_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.9	4.8e-22
>prophage 352
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4737274	4738780	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_048321657.1|4737274_4738780_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	9.6e-13
>prophage 353
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4749706	4751410	5140918		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_033647585.1|4749706_4751410_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.6	2.0e-14
>prophage 354
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4756223	4759185	5140918		Acinetobacter_phage(100.0%)	3	NA	NA
WP_079656981.1|4756223_4757585_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.1e-39
WP_033647579.1|4757588_4758587_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	3.7e-53
WP_033647578.1|4758603_4759185_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.5	2.5e-30
>prophage 355
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4766927	4771302	5140918	protease	Bodo_saltans_virus(50.0%)	3	NA	NA
WP_033634750.1|4766927_4767974_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.0e-21
WP_033634749.1|4768025_4768277_-	YciN family protein	NA	NA	NA	NA	NA
WP_033647571.1|4768704_4771302_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	2.0e-90
>prophage 356
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4775773	4776367	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_019452695.1|4775773_4776367_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	6.2e-40
>prophage 357
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4782823	4787708	5140918		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_033647561.1|4782823_4784323_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	4.3e-13
WP_048321651.1|4784333_4785398_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_048321650.1|4785390_4786914_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_048321649.1|4786910_4787708_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	41.3	2.2e-08
>prophage 358
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4793146	4810470	5140918		Escherichia_phage(33.33%)	5	NA	NA
WP_048321646.1|4793146_4795579_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A193GZ98	Escherichia_phage	50.9	3.9e-08
WP_039565898.1|4795583_4796483_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_033647546.1|4796632_4797298_+	fructose-6-phosphate aldolase	NA	M4QS02	Synechococcus_phage	32.7	2.4e-24
WP_048321645.1|4797566_4799288_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_053063698.1|4799355_4810470_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.3	1.6e-40
>prophage 359
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4817410	4818721	5140918		Burkholderia_virus(100.0%)	1	NA	NA
WP_048321643.1|4817410_4818721_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.1	1.0e-63
>prophage 360
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4825004	4826174	5140918		Stx2-converting_phage(100.0%)	1	NA	NA
WP_048321639.1|4825004_4826174_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	62.5	1.3e-129
>prophage 361
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4829845	4831652	5140918		Planktothrix_phage(100.0%)	2	NA	NA
WP_033648455.1|4829845_4830658_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	28.3	2.1e-14
WP_004930587.1|4830659_4831652_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	29.1	1.2e-06
>prophage 362
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4854478	4855417	5140918	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_033648438.1|4854478_4855417_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	91.8	1.9e-136
>prophage 363
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4861010	4862003	5140918		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_016927571.1|4861010_4862003_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	1.9e-65
>prophage 364
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4867855	4871743	5140918		Catovirus(100.0%)	1	NA	NA
WP_072071896.1|4867855_4871743_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.0	7.6e-54
>prophage 365
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4876015	4877320	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033648428.1|4876015_4877320_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.7	1.1e-17
>prophage 366
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4888914	4889439	5140918		Streptococcus_phage(100.0%)	1	NA	NA
WP_048321621.1|4888914_4889439_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	2.9e-25
>prophage 367
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4909868	4911345	5140918		Staphylococcus_phage(100.0%)	2	NA	NA
WP_047567334.1|4909868_4910582_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	2.1e-10
WP_033648404.1|4910574_4911345_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	1.1e-17
>prophage 368
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4919493	4920396	5140918		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_033648397.1|4919493_4920396_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	34.1	3.2e-32
>prophage 369
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4938409	4940140	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_048321601.1|4938409_4940140_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.6	9.0e-39
>prophage 370
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4953116	4954559	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_033648375.1|4953116_4954559_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	3.0e-11
>prophage 371
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4960096	4961533	5140918		Pandoravirus(100.0%)	1	NA	NA
WP_101426945.1|4960096_4961533_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.5	7.0e-29
>prophage 372
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4974467	4975598	5140918		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_048321592.1|4974467_4975598_+	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	31.5	3.7e-41
>prophage 373
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4983527	4985066	5140918		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033648349.1|4983527_4985066_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.0	3.3e-37
>prophage 374
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	4991659	5000170	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_048321586.1|4991659_5000170_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.3	2.7e-72
>prophage 375
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5017387	5018254	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_048321575.1|5017387_5018254_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	1.2e-07
>prophage 376
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5029577	5038044	5140918		Bacillus_virus(33.33%)	7	NA	NA
WP_033634542.1|5029577_5031458_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.5	4.7e-17
WP_033648315.1|5031754_5032720_+	pyrophosphatase	NA	NA	NA	NA	NA
WP_033648314.1|5032723_5033152_+	universal stress protein	NA	NA	NA	NA	NA
WP_043147464.1|5033169_5034453_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.1	7.7e-120
WP_048321571.1|5034439_5034862_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048321570.1|5034934_5036155_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_072010260.1|5036661_5038044_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.3e-28
>prophage 377
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5045960	5048276	5140918		Megavirus(100.0%)	1	NA	NA
WP_048321564.1|5045960_5048276_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2P1EIE5	Megavirus	29.7	3.5e-06
>prophage 378
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5053680	5054508	5140918		Mycobacterium_phage(100.0%)	1	NA	NA
WP_048321561.1|5053680_5054508_-	alpha/beta fold hydrolase	NA	A0A0A7RWQ4	Mycobacterium_phage	33.1	1.3e-11
>prophage 379
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5059384	5061478	5140918		Bacillus_phage(100.0%)	1	NA	NA
WP_048321559.1|5059384_5061478_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	2.1e-10
>prophage 380
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5067411	5068428	5140918		Tupanvirus(100.0%)	1	NA	NA
WP_033634519.1|5067411_5068428_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	5.6e-25
>prophage 381
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5086452	5087889	5140918		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_048321540.1|5086452_5087889_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.2e-07
>prophage 382
NZ_CP028949	Serratia marcescens strain AR_0121 chromosome, complete genome	5140918	5114846	5116271	5140918		Pandoravirus(100.0%)	1	NA	NA
WP_043147442.1|5114846_5116271_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.1	9.6e-47
