The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	561512	570168	5140937	integrase	Enterobacteria_phage(66.67%)	9	562695:562709	568555:568569
WP_048321301.1|561512_563846_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
562695:562709	attL	CTGGAACAGTGCGGC	NA	NA	NA	NA
WP_048321300.1|563857_564193_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_048321299.1|564189_564453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321298.1|564449_564995_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
WP_048321297.1|564981_565197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321296.1|565193_565457_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_033649938.1|566192_567383_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_086556832.1|567801_569061_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
568555:568569	attR	GCCGCACTGTTCCAG	NA	NA	NA	NA
WP_033637217.1|569064_570168_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
>prophage 2
NZ_CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	2145049	2186426	5140937	plate,tail,terminase,tRNA,portal,capsid,head,lysis,integrase	Erwinia_phage(46.15%)	50	2144907:2144957	2180196:2180246
2144907:2144957	attL	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_049279097.1|2145049_2146084_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
WP_048321973.1|2146087_2146672_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
WP_048321972.1|2146781_2147003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379133.1|2147033_2147543_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
WP_048322123.1|2147553_2147733_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_031221632.1|2147744_2148047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321971.1|2148110_2148353_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048321970.1|2148352_2148664_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_048321969.1|2148663_2148882_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.9	5.6e-15
WP_072071910.1|2148887_2149469_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	58.4	1.7e-58
WP_048321968.1|2149591_2149873_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_048321967.1|2149869_2152086_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.3	3.1e-238
WP_072071909.1|2152124_2152337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071908.1|2152497_2154294_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_072071907.1|2154290_2155373_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_072071906.1|2155757_2156012_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.6e-16
WP_033633573.1|2156011_2156353_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_048321966.1|2156397_2157432_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
WP_033632041.1|2157431_2159204_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	5.2e-292
WP_048321965.1|2159346_2160162_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.5	7.1e-71
WP_048321964.1|2160204_2161389_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	4.5e-159
WP_033649039.1|2161391_2162051_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_033639340.1|2162144_2162633_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_048321963.1|2162632_2162836_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	1.8e-20
WP_031231709.1|2162840_2163050_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_048321962.1|2163033_2163546_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	6.7e-59
WP_048321961.1|2163542_2163971_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.0	4.6e-13
WP_048321960.1|2164066_2164543_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	1.1e-50
WP_048321959.1|2164529_2164979_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	61.1	7.2e-41
WP_072071905.1|2165061_2166891_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	24.7	3.7e-11
WP_048321958.1|2166972_2167602_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.3	1.1e-76
WP_108658200.1|2167617_2167884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321956.1|2167880_2168231_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
WP_048321955.1|2168235_2169144_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.9	2.4e-107
WP_048321954.1|2169136_2169670_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	1.6e-76
WP_108658201.1|2169676_2172337_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.8e-61
WP_072071904.1|2172342_2172762_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	2.6e-16
WP_048321952.1|2173037_2174207_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
WP_023447563.1|2174222_2174732_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_048321951.1|2174786_2175068_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	9.1e-26
WP_023456045.1|2175100_2175223_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_048321950.1|2175215_2178044_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.1	2.8e-106
WP_015379102.1|2178043_2178529_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_048321949.1|2178525_2179686_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.4	7.4e-138
WP_033644586.1|2179769_2180000_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
WP_033649053.1|2180423_2180912_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
2180196:2180246	attR	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_033636080.1|2180987_2182829_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_025304325.1|2182986_2184735_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_001144069.1|2184871_2185087_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_033649054.1|2185412_2186426_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
>prophage 3
NZ_CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	3591439	3626327	5140937	plate,tail,terminase,portal,capsid,head,integrase	Escherichia_phage(25.71%)	43	3592246:3592267	3625207:3625228
WP_015378226.1|3591439_3592228_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.3	9.2e-92
3592246:3592267	attL	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
WP_048321723.1|3592372_3593356_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	64.8	4.1e-121
WP_072071899.1|3593443_3593743_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
WP_048321722.1|3593868_3594144_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.5e-33
WP_037421654.1|3594335_3594836_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	72.3	2.2e-67
WP_033652239.1|3594899_3595157_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048321721.1|3595149_3595449_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_021504068.1|3595451_3595667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321719.1|3595669_3595951_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	56.8	7.7e-25
WP_048321718.1|3595947_3598236_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.5	1.5e-267
WP_048321717.1|3598325_3599054_+	hypothetical protein	NA	Q37850	Escherichia_phage	57.0	9.8e-72
WP_048321716.1|3599239_3600889_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_108675270.1|3600885_3602028_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_048321714.1|3602339_3603371_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.3	6.3e-165
WP_048321713.1|3603367_3605140_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	81.3	3.8e-287
WP_048321712.1|3605300_3606146_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	66.7	9.6e-103
WP_080441019.1|3606216_3607416_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	75.9	9.3e-152
WP_048321711.1|3607418_3608162_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.9e-71
WP_021504058.1|3608255_3608762_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	71.4	1.5e-63
WP_048321710.1|3608761_3608965_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	1.1e-20
WP_033652228.1|3608967_3609177_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	39.1	9.8e-09
WP_048321708.1|3609160_3609670_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.7	1.5e-63
WP_048321707.1|3609666_3610104_+	hypothetical protein	NA	O80310	Escherichia_phage	42.4	1.2e-13
WP_048321706.1|3610193_3610661_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	4.5e-62
WP_048321705.1|3610653_3611100_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.6	2.9e-50
WP_053063701.1|3611175_3611613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147435411.1|3611602_3612133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321701.1|3612289_3612931_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.6	2.9e-67
WP_048321700.1|3612927_3613278_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	8.9e-39
WP_048321699.1|3613282_3614191_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	64.9	1.5e-101
WP_048321698.1|3614183_3614717_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	6.3e-76
WP_080441018.1|3614723_3616820_+	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	7.0e-62
WP_048321697.1|3616821_3617346_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.3	6.2e-36
WP_048321696.1|3617514_3617733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321695.1|3618478_3619648_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	81.4	6.2e-185
WP_048321694.1|3619664_3620183_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	1.0e-75
WP_048321692.1|3620240_3620543_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.3	1.9e-29
WP_071796738.1|3620575_3620695_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	4.5e-11
WP_048321691.1|3620687_3623135_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	64.9	1.7e-256
WP_033644295.1|3623147_3623633_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	3.5e-49
WP_048321690.1|3623629_3624799_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.7	3.0e-163
WP_033643461.1|3624878_3625097_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.8e-21
WP_039565556.1|3625424_3626327_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.8	5.7e-37
3625207:3625228	attR	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	4423360	4478433	5140937	tRNA,protease,coat	Tupanvirus(22.22%)	50	NA	NA
WP_033646315.1|4423360_4425748_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.8e-05
WP_004931416.1|4425762_4426746_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_151498502.1|4426992_4427088_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931417.1|4427157_4427514_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004931418.1|4427557_4427755_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048233542.1|4427853_4428405_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_025159696.1|4428408_4430337_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_033646316.1|4430552_4431176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646317.1|4431415_4432465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646318.1|4432849_4433539_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_033646319.1|4433575_4434709_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638320.1|4434859_4436143_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039566431.1|4436400_4437738_-	cytochrome c	NA	NA	NA	NA	NA
WP_004931432.1|4437750_4439532_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_033638317.1|4439534_4440260_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004931439.1|4440567_4441233_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_033638315.1|4441342_4441642_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_033638313.1|4441773_4442718_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638312.1|4442714_4443605_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	2.5e-08
WP_033638311.1|4443604_4444465_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_048321510.1|4444464_4445319_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_033646323.1|4445558_4446428_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033638308.1|4446463_4447024_-	membrane protein	NA	NA	NA	NA	NA
WP_033646324.1|4447209_4448490_+|protease	protease	protease	NA	NA	NA	NA
WP_033638306.1|4448553_4449219_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_048321509.1|4449642_4450191_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_086579715.1|4450366_4451764_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_048321508.1|4451827_4452637_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_048321507.1|4452646_4453750_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_048321506.1|4453905_4454625_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_048321505.1|4454800_4455811_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033646328.1|4455807_4456944_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_033646329.1|4456945_4457809_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048321504.1|4457811_4458615_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048321503.1|4458661_4459453_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_033646331.1|4459684_4461079_+	MFS transporter	NA	NA	NA	NA	NA
WP_048321502.1|4461179_4461887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638291.1|4462124_4463003_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_033638289.1|4463312_4465361_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638287.1|4465380_4466091_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638286.1|4466187_4466685_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_048322071.1|4466940_4468188_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_048322070.1|4468156_4470787_+	PqiB family protein	NA	NA	NA	NA	NA
WP_048321501.1|4470889_4472326_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033638282.1|4472600_4473140_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071883799.1|4473142_4473646_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033646335.1|4473645_4474200_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_048321500.1|4474224_4474989_+	molecular chaperone	NA	NA	NA	NA	NA
WP_048322069.1|4475134_4477477_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_048321499.1|4477497_4478433_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
