The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	957797	966512	5138817	integrase	Enterobacteria_phage(66.67%)	9	949337:949354	964879:964896
949337:949354	attL	GCGTGGCGCTGAGCGCCA	NA	NA	NA	NA
WP_033651028.1|957797_958901_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.8	4.1e-61
WP_025160081.1|958904_960164_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	2.8e-98
WP_033649938.1|960593_961784_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_033649939.1|962519_962783_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_033649940.1|962779_963025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071998180.1|963030_963576_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	55.4	7.7e-21
WP_085286334.1|963572_963836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085286335.1|963832_964168_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_033647429.1|964178_966512_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.0	3.6e-261
964879:964896	attR	GCGTGGCGCTGAGCGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	1726093	1801437	5138817	integrase,head,portal,plate,capsid,tail,protease,terminase,lysis	Erwinia_phage(37.78%)	84	1715746:1715765	1774904:1774923
1715746:1715765	attL	CAGGCGTTCGACAGCCTGAT	NA	NA	NA	NA
WP_033642514.1|1726093_1726606_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_108680381.1|1727021_1728503_+	phospholipase	NA	NA	NA	NA	NA
WP_108680382.1|1728499_1729273_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_076740545.1|1729586_1730672_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.1	5.3e-114
WP_159085271.1|1730790_1731396_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	34.4	4.1e-23
WP_060432780.1|1731764_1732274_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.0	2.7e-44
WP_049279101.1|1732284_1732464_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_043148063.1|1732475_1732778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103101113.1|1732842_1733136_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_103101114.1|1733135_1733447_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_103101115.1|1733446_1733671_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	55.6	1.1e-13
WP_103101116.1|1733793_1734111_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	48.2	3.9e-17
WP_103101117.1|1734129_1734402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103101118.1|1734431_1736657_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	57.6	1.0e-236
WP_103101119.1|1736695_1736920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146035837.1|1736967_1737165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085272.1|1737319_1738306_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_103101121.1|1738256_1738769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071605322.1|1739220_1739475_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_103101269.1|1739474_1739816_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_103101122.1|1739861_1740896_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	4.5e-163
WP_103101123.1|1740895_1742668_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.0	2.0e-291
WP_103101124.1|1742810_1743626_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	1.6e-70
WP_103101125.1|1743668_1744880_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.5	7.9e-159
WP_033649039.1|1744882_1745542_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_033639340.1|1745635_1746124_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_015379118.1|1746123_1746327_+	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_031231709.1|1746331_1746541_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_103101126.1|1746524_1747037_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	65.9	5.7e-58
WP_086556869.1|1747033_1747462_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	4.2e-14
WP_103101127.1|1747557_1748031_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.8	9.9e-49
WP_103101128.1|1748017_1748464_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.1	1.2e-40
WP_103101129.1|1748536_1749166_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	71.5	1.9e-76
WP_103101130.1|1749313_1749664_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	3.2e-36
WP_103101131.1|1749668_1750577_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.2	1.3e-108
WP_103101132.1|1750569_1751103_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	3.7e-76
WP_103101133.1|1751109_1753629_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.3e-61
WP_060431372.1|1753630_1754155_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.8	3.7e-36
WP_048321696.1|1754323_1754542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103101134.1|1755269_1756439_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.2	1.1e-181
WP_023447563.1|1756453_1756963_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_103101135.1|1757017_1757299_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	2.4e-26
WP_026142543.1|1757331_1757454_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	75.0	3.0e-10
WP_103101136.1|1757446_1760296_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	46.7	2.0e-99
WP_103101137.1|1760295_1760781_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	64.9	2.5e-47
WP_055312616.1|1760777_1761926_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	4.1e-125
WP_072265518.1|1762025_1762244_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.2	3.2e-26
WP_004938680.1|1762537_1764226_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_033642521.1|1764519_1764909_+	membrane protein	NA	NA	NA	NA	NA
WP_004938676.1|1764948_1765212_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_072627974.1|1765442_1765757_+	YbjC family protein	NA	NA	NA	NA	NA
WP_033642523.1|1765813_1766716_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	37.0	9.4e-40
WP_072627973.1|1766852_1767332_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_033642524.1|1767738_1768848_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_089191441.1|1768968_1770102_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	5.5e-29
WP_042784087.1|1770126_1771089_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_042784088.1|1771085_1771931_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_047024958.1|1772092_1772572_+	YbjO family protein	NA	NA	NA	NA	NA
WP_108680383.1|1772640_1773768_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	3.5e-28
WP_004928423.1|1774036_1774288_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_015377297.1|1774389_1775124_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1774904:1774923	attR	ATCAGGCTGTCGAACGCCTG	NA	NA	NA	NA
WP_033650651.1|1775322_1775991_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_025159684.1|1775990_1776707_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004928409.1|1776716_1777448_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089192582.1|1777480_1778209_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	1.8e-28
WP_033642535.1|1778473_1779016_-	lipoprotein	NA	NA	NA	NA	NA
WP_004928400.1|1779175_1779499_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	43.3	2.9e-15
WP_108680384.1|1779552_1781118_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_047024954.1|1781305_1782142_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.2	7.7e-12
WP_004928393.1|1782142_1783153_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_108680385.1|1783311_1784751_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033642539.1|1784901_1785249_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_108680386.1|1785278_1786295_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_042784096.1|1786370_1788092_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_108680387.1|1788290_1789292_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_033650659.1|1789347_1790997_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_033642544.1|1791178_1792075_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_033650660.1|1792262_1793921_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_089191452.1|1793935_1794889_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_033642548.1|1795083_1796199_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_108680388.1|1796198_1798145_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.3	4.7e-36
WP_004928349.1|1798232_1798454_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_004928347.1|1798809_1799130_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_004928343.1|1799157_1801437_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	8.7e-167
>prophage 3
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	2198335	2225377	5138817	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_108680581.1|2198335_2199754_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|2199900_2200110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|2200889_2201282_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_089191602.1|2201286_2201886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033652110.1|2201941_2202181_-	YebV family protein	NA	NA	NA	NA	NA
WP_033644260.1|2202316_2203249_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_108682293.1|2203268_2205611_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|2205762_2206530_-	molecular chaperone	NA	NA	NA	NA	NA
WP_108680583.1|2206550_2207093_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_033642839.1|2207086_2207590_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_046686938.1|2207592_2208129_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033652487.1|2208402_2208939_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_108680585.1|2209204_2210641_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_108682297.1|2210743_2213374_-	PqiB family protein	NA	NA	NA	NA	NA
WP_108682295.1|2213342_2214590_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033642843.1|2214845_2215343_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|2215439_2216150_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2216169_2218218_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033642846.1|2218286_2219132_-	DMT family transporter	NA	NA	NA	NA	NA
WP_072627727.1|2219128_2220436_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_072627726.1|2220428_2221226_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_047026224.1|2221213_2221999_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	8.8e-10
WP_033652483.1|2221995_2223036_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042784331.1|2223038_2224130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|2224498_2225377_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	3409939	3448080	5138817	head,integrase,portal,plate,tail,capsid,protease,terminase,holin	Salmonella_phage(30.95%)	53	3408414:3408428	3448291:3448305
3408414:3408428	attL	TACATTCACGATTAC	NA	NA	NA	NA
WP_108681489.1|3409939_3412327_-	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	33.0	5.1e-08
WP_153860755.1|3412435_3412609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108681491.1|3412645_3412909_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_159085281.1|3412922_3413975_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_108681495.1|3414011_3414413_-	hypothetical protein	NA	A0A0M4RTP2	Salmonella_phage	46.6	6.5e-09
WP_108681497.1|3414416_3415700_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	65.4	2.4e-28
WP_108681499.1|3415701_3416280_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	75.0	4.0e-84
WP_108681501.1|3416289_3417354_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	63.6	1.1e-132
WP_046687472.1|3417346_3417760_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	70.1	2.9e-52
WP_108681503.1|3417756_3418293_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	45.6	5.1e-33
WP_108681505.1|3418292_3419369_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	68.9	1.6e-142
WP_108681506.1|3419365_3420658_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	58.6	9.4e-142
WP_108681508.1|3420694_3422563_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	58.9	2.1e-195
WP_108681510.1|3422647_3422971_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	63.2	1.7e-28
WP_063990574.1|3422967_3423324_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	87.3	1.8e-55
WP_108682329.1|3423323_3424820_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	70.1	7.7e-188
WP_108681512.1|3424803_3425007_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	74.5	3.7e-13
WP_108681514.1|3425013_3425574_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	62.9	3.6e-66
WP_072055839.1|3425570_3426095_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	80.7	1.2e-71
WP_108681516.1|3426069_3426426_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	50.4	6.8e-26
WP_063990577.1|3426461_3426779_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	63.2	1.5e-32
WP_108681518.1|3426863_3428102_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	72.1	7.3e-168
WP_108681520.1|3428111_3428711_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.0	4.4e-86
WP_046687484.1|3428703_3429930_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	79.9	4.8e-196
WP_108681522.1|3430078_3431809_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.3	4.4e-195
WP_046687487.1|3431808_3432246_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	1.6e-32
WP_046687488.1|3432364_3432721_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	76.5	3.3e-49
WP_159085282.1|3432849_3433224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108681526.1|3433259_3433700_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	67.8	4.6e-48
WP_108682331.1|3433686_3434004_-|holin	holin	holin	F1C5D1	Cronobacter_phage	76.5	4.4e-37
WP_108681528.1|3434078_3435107_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	62.7	1.5e-121
WP_108681530.1|3435399_3436071_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.1	3.2e-45
WP_108681533.1|3436067_3436646_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.3	1.3e-39
WP_108681534.1|3436629_3437616_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.0	7.2e-110
WP_108681536.1|3437612_3439142_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	66.0	2.4e-197
WP_033653818.1|3439327_3439627_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	45.3	1.9e-13
WP_101453954.1|3439661_3440195_-	DNA-binding protein	NA	S5FXP0	Shigella_phage	54.2	8.3e-44
WP_108681538.1|3440253_3440484_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	55.1	7.0e-16
WP_033653816.1|3440588_3441254_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	54.2	1.4e-61
WP_108681540.1|3441657_3441906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159085283.1|3442003_3442273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046687498.1|3442461_3442824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108681542.1|3442866_3443688_+	DUF2303 family protein	NA	A0A0A8IL76	Aurantimonas_phage	29.4	6.4e-19
WP_108681544.1|3443760_3444594_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	59.1	3.6e-86
WP_108681546.1|3444590_3444809_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.3	1.7e-08
WP_108681548.1|3444827_3445010_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_159085284.1|3445006_3445210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108681550.1|3445209_3445563_+	hypothetical protein	NA	R9W086	Serratia_phage	69.5	1.2e-14
WP_159085285.1|3445552_3445891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108681554.1|3445891_3446098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108681556.1|3446135_3446699_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	64.8	2.5e-67
WP_072271584.1|3446723_3446915_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	68.3	7.3e-19
WP_108681558.1|3446895_3448080_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	67.9	6.5e-166
3448291:3448305	attR	TACATTCACGATTAC	NA	NA	NA	NA
>prophage 5
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	3513286	3533916	5138817	tail,holin	Klebsiella_phage(27.78%)	23	NA	NA
WP_108681597.1|3513286_3515308_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	42.5	2.3e-30
WP_108681599.1|3515304_3516465_-|tail	tail fiber domain-containing protein	tail	K7P7B1	Enterobacteria_phage	57.9	1.1e-43
WP_089192041.1|3516515_3520103_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	66.0	0.0e+00
WP_099784199.1|3520156_3520771_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	55.8	4.3e-52
WP_143557036.1|3520825_3521164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108681601.1|3521200_3521905_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	74.9	1.4e-107
WP_103086416.1|3521914_3522664_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.9	1.0e-95
WP_072627296.1|3522676_3523015_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.9	4.9e-34
WP_072627295.1|3523014_3525306_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.8e-16
WP_004935830.1|3525298_3525520_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_025160180.1|3525537_3525903_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	6.5e-24
WP_033652513.1|3526029_3526485_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.5e-57
WP_033652512.1|3526525_3526918_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.0	4.7e-20
WP_042785078.1|3526914_3527304_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	3.7e-25
WP_042785079.1|3527361_3527802_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	3.4e-43
WP_033652509.1|3527788_3528109_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	1.1e-40
WP_108681603.1|3528899_3529262_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	6.0e-38
WP_108681605.1|3529504_3530182_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	30.1	3.8e-09
WP_004935874.1|3530600_3530930_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_108681607.1|3531057_3531525_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033651920.1|3531633_3532212_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033651921.1|3532205_3532622_-	glyoxalase	NA	NA	NA	NA	NA
WP_033651922.1|3532779_3533916_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.8	4.0e-104
>prophage 6
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	3807333	3814427	5138817		Salmonella_phage(33.33%)	10	NA	NA
WP_004941660.1|3807333_3807687_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.2e-19
WP_033644019.1|3807887_3808118_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_033644020.1|3808131_3808671_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_025159568.1|3808684_3809386_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3809658_3810174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3810207_3810456_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_046687617.1|3810503_3811793_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3811869_3812496_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3812751_3813789_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_033644022.1|3813788_3814427_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
>prophage 7
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	4235107	4244914	5138817	tRNA,integrase	Morganella_phage(33.33%)	10	4239889:4239904	4243648:4243663
WP_108682349.1|4235107_4237243_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	59.8	1.0e-201
WP_108681903.1|4237893_4238118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085288.1|4238114_4238309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159085289.1|4238292_4238511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108681907.1|4239166_4240018_-	antA/AntB antirepressor family protein	NA	A0A1U9AJ93	Stx1_converting_phage	44.4	5.4e-21
4239889:4239904	attL	TTTCACGGCCGCCGAT	NA	NA	NA	NA
WP_108681909.1|4240032_4240455_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.6	3.6e-26
WP_108681911.1|4240454_4240652_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	41.5	1.6e-05
WP_108681913.1|4240869_4241646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108681915.1|4241796_4243011_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.6	1.4e-142
WP_004931697.1|4243396_4244914_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.7	7.7e-87
4243648:4243663	attR	TTTCACGGCCGCCGAT	NA	NA	NA	NA
>prophage 8
NZ_CP028947	Serratia marcescens strain AR_0130 chromosome, complete genome	5138817	4787902	4796830	5138817		environmental_Halophage(16.67%)	7	NA	NA
WP_108682127.1|4787902_4789981_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_033645260.1|4790021_4791239_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	1.6e-26
WP_033645386.1|4791371_4791947_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_108682129.1|4792019_4793543_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.5e-77
WP_025304522.1|4793694_4794420_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_033651731.1|4794419_4796105_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	1.5e-224
WP_033636286.1|4796260_4796830_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
