The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	518277	585240	2883830	integrase,protease,transposase,tRNA	Streptococcus_phage(15.38%)	54	513830:513849	592089:592108
513830:513849	attL	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
WP_002286726.1|518277_519399_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002295160.1|519638_521066_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_002286711.1|521079_522198_+	aminotransferase	NA	NA	NA	NA	NA
WP_002286708.1|522257_523550_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002326790.1|523699_524260_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286704.1|524388_524766_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_002304230.1|524698_526771_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_002289773.1|526981_527929_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
WP_002289775.1|528174_528639_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	8.8e-18
WP_002289776.1|528700_529744_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_002291188.1|530120_531086_-	TDT family transporter	NA	NA	NA	NA	NA
WP_002297022.1|531319_532165_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002291183.1|532355_533543_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002295166.1|533548_533905_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
WP_002291179.1|533906_534245_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_002304234.1|534639_535674_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
WP_002287674.1|535666_536353_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287678.1|536376_537225_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287679.1|537421_538195_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287681.1|538207_539494_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287683.1|539490_540726_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
WP_002287684.1|540712_541183_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002287686.1|541187_542579_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002297218.1|542694_543990_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287705.1|544195_545338_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
WP_002287709.1|545376_546111_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287723.1|546342_546618_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048946547.1|546715_548713_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	24.4	5.5e-24
WP_002301912.1|548788_549124_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048946548.1|549502_549865_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_048946549.1|549910_550237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298390.1|551079_552903_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002298389.1|552916_554326_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	3.2e-42
WP_002298387.1|554343_555180_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002317770.1|555244_556027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094850654.1|556430_557556_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	2.3e-75
WP_002297848.1|558908_559109_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002297850.1|559184_559382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297851.1|559678_561226_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	S4VPC4	Pandoravirus	25.7	4.6e-10
WP_002297853.1|561309_562113_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297855.1|562115_562898_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297856.1|562894_563674_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297857.1|563645_564437_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-21
WP_002297858.1|564497_565427_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297859.1|565621_566305_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002340328.1|566465_567509_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002340332.1|569448_570627_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|570847_571756_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002321318.1|571884_572484_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002321317.1|572483_573059_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_002344971.1|573083_576755_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_002340336.1|576818_580451_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_002321314.1|580566_583089_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_002321313.1|583206_585240_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
592089:592108	attR	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
>prophage 2
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	727719	736191	2883830		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|727719_728364_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|728378_728708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|728721_729660_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|729695_730520_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|730512_730860_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|730928_731801_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|731909_733031_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|733084_733687_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|734001_736191_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 3
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	789200	888965	2883830	head,capsid,integrase,tail,holin,plate,protease,transposase,portal,terminase,tRNA	Enterococcus_phage(11.63%)	116	838471:838489	874439:874457
WP_002286621.1|789200_791999_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|792047_793574_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|793588_794236_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|794419_794749_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|794925_795654_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|795669_796683_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|796682_797960_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_074400891.1|798022_800725_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|800876_801194_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|801223_801544_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002371581.1|801651_803112_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|803179_803401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|803431_803614_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|803613_804027_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|804149_805331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|805401_805566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|805861_807001_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|807299_807935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|808047_808683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|808716_809178_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|809307_809739_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|809756_810077_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|810375_811152_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|811166_811370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|811385_811724_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|811710_811890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|811932_812403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|812489_813188_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|813365_813707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|813699_814371_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_058825536.1|814376_815069_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|815065_815815_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|815826_816096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|816101_816266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|816258_816558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|816557_816860_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|816899_817265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303019.1|817754_817895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002369144.1|817891_818074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|818086_818281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|818313_818526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304431.1|818650_818854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|818850_819123_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|819123_819309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|819295_819643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|819602_820079_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|820224_820953_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|821000_821279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|821280_821667_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|821663_822044_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|822155_822608_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|822604_824332_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002304437.1|824395_825583_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	65.5	1.3e-142
WP_002303035.1|825554_826124_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|826136_827501_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|827502_827784_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|827761_828088_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|828077_828416_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|828405_828771_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|828777_829404_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|829403_829868_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|830062_832372_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|832383_833088_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|833084_835844_+	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002332773.1|835856_836765_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303523.1|836764_837382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|837385_837835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|837834_838329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|838342_838774_+	hypothetical protein	NA	NA	NA	NA	NA
838471:838489	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|838775_838913_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|838949_839243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|839239_839464_+|holin	holin	holin	NA	NA	NA	NA
WP_002303477.1|839460_840480_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|841256_841556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|841561_841792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|842041_842242_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|842558_843746_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|844020_845253_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|845507_846077_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|846254_846695_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|846852_847617_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|847648_848572_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|848647_849787_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|849779_850580_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|850579_851407_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286451.1|851411_852119_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|852218_853085_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|853098_853671_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|853692_854721_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|854818_855670_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|855703_857737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042957143.1|857780_859061_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|859270_860077_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|860088_861309_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|861298_862885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289076.1|862923_865062_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|865429_866413_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002289073.1|866790_868182_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|868197_869238_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|869256_870342_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|870374_871337_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002292877.1|871329_872757_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|872758_873829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|873815_875237_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
874439:874457	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002289359.1|875249_876257_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|876268_877273_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|877269_878418_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|878390_879068_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|879057_880200_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|880212_881190_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|881189_882098_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|882098_882851_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|882855_883803_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_060809400.1|883976_885272_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_000222572.1|885760_886714_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|887786_888965_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1162062	1171605	2883830		unidentified_phage(16.67%)	9	NA	NA
WP_002348948.1|1162062_1163451_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
WP_002297115.1|1164019_1164397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1164652_1165381_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1165380_1165635_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1165636_1166308_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1166308_1168531_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1168515_1169955_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002378443.1|1169986_1171030_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1171026_1171605_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1447410	1490095	2883830	protease,transposase	Streptococcus_phage(23.08%)	52	NA	NA
WP_002287525.1|1447410_1448559_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1448575_1448980_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002291299.1|1449283_1449457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295138.1|1450096_1450570_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1450578_1450806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1451441_1451813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1452068_1452311_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1452342_1453245_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1453257_1453446_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1453459_1454023_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1454060_1454954_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1455031_1455970_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1456003_1456354_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1456386_1457289_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1457281_1458139_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1458472_1459282_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1459321_1459819_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1460463_1460787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1460950_1461205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1461274_1461520_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1461595_1461961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1462021_1462585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1463236_1464532_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1464770_1466072_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1466175_1466376_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1466771_1466921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1467127_1467841_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1467833_1468919_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1468935_1469379_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1469412_1469766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1469877_1470279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1470315_1470825_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1470846_1471704_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1471721_1472555_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1472568_1473366_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1473398_1473683_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1473679_1474681_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1474682_1475585_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1475748_1476597_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1477242_1477449_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1477650_1478652_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1478656_1480570_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1480737_1481244_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1481403_1481844_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1481869_1483027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1483029_1483386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1483683_1484658_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1484853_1485693_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1485877_1486765_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1487358_1488054_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1488037_1488436_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1488844_1490095_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 6
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1497945	1544784	2883830	integrase,transposase	Streptococcus_phage(44.44%)	44	1493135:1493150	1502856:1502871
1493135:1493150	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_000997695.1|1497945_1499124_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1499279_1500233_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1500289_1501417_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1501634_1502777_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1502781_1502967_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1502856:1502871	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1503320_1503566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1503559_1503961_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010729345.1|1504147_1505956_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729344.1|1505978_1507745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1507757_1508552_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729700.1|1508561_1509938_-	MFS transporter	NA	NA	NA	NA	NA
WP_010729341.1|1510057_1510705_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1510788_1512216_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1512289_1513369_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1513371_1515003_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025481115.1|1515312_1515978_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729336.1|1516696_1516867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1516990_1518310_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729334.1|1518818_1519271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729333.1|1519277_1519826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1520079_1521399_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729332.1|1521554_1521887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033630243.1|1521900_1522131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010710550.1|1522352_1522895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729330.1|1522915_1524007_-	CHAP domain-containing protein	NA	A0A0B5A7F4	Streptococcus_phage	29.9	4.6e-25
WP_010729329.1|1524014_1526225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729328.1|1526240_1528769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729327.1|1528820_1529231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312989.1|1529243_1529462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729326.1|1529458_1530451_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_010729325.1|1530529_1531441_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010729324.1|1531459_1531804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729321.1|1532460_1532961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729320.1|1532961_1533507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729319.1|1533503_1534760_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729318.1|1535120_1535432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050566171.1|1535454_1536765_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	36.8	1.3e-61
WP_010729316.1|1537378_1537831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729315.1|1537832_1538198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729314.1|1538296_1542580_-	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_010729313.1|1542726_1542966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312949.1|1543055_1543328_-	hypothetical protein	NA	A0A1W6JN36	Lactococcus_phage	57.4	1.6e-19
WP_010710562.1|1543410_1543662_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	58.5	1.1e-06
WP_002303350.1|1543824_1544784_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1648979	1771182	2883830	tRNA,protease,integrase,transposase	Streptococcus_phage(35.14%)	110	1661540:1661557	1685026:1685043
WP_000222572.1|1648979_1649933_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326695.1|1649929_1650511_-	DUF443 family protein	NA	NA	NA	NA	NA
WP_002321528.1|1650697_1651348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289698.1|1651890_1652826_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002289697.1|1652859_1653858_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289695.1|1653854_1654739_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002296517.1|1654873_1655605_-	aspartate racemase	NA	NA	NA	NA	NA
WP_002294441.1|1655608_1656874_-	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296519.1|1657136_1659953_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002302999.1|1659962_1661957_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
1661540:1661557	attL	CATTTCTTTCTAATAATG	NA	NA	NA	NA
WP_002296521.1|1662215_1663718_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002292113.1|1663719_1664457_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_010729704.1|1664627_1665821_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	63.8	3.9e-142
WP_002341493.1|1665899_1666106_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
WP_010729705.1|1666098_1667241_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_008788621.1|1667752_1668388_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001814923.1|1668863_1668980_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|1668995_1670915_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_000336323.1|1671033_1671201_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1671260_1671614_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_022278534.1|1672117_1672537_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025481129.1|1672562_1672769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296523.1|1672996_1673170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158003447.1|1673145_1673811_+	sugar diacid utilization regulator	NA	NA	NA	NA	NA
WP_002289374.1|1673892_1675059_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002292134.1|1675209_1677039_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002296525.1|1677089_1677653_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002289532.1|1677746_1678790_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002300943.1|1680204_1680432_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002289535.1|1680915_1681506_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002289536.1|1681695_1682409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1682588_1683884_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289537.1|1684045_1685056_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
1685026:1685043	attR	CATTTCTTTCTAATAATG	NA	NA	NA	NA
WP_002294466.1|1685092_1685575_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1685724_1686093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296526.1|1686557_1687010_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|1687133_1687985_-	sugar transporter	NA	NA	NA	NA	NA
WP_002288522.1|1687997_1688783_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288521.1|1689134_1690076_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288520.1|1690079_1691003_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002288514.1|1694180_1694354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1694624_1695920_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288513.1|1696114_1696462_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|1696488_1698795_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1698807_1699119_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1699115_1699409_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1699430_1700606_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1700628_1701102_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|1701246_1705605_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002294137.1|1705816_1707526_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1707593_1708862_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1709022_1709823_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1709819_1710632_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1711040_1712291_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002323245.1|1712622_1713795_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002293875.1|1713941_1714499_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1714501_1715224_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1715359_1716241_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1716339_1717122_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1717480_1717960_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1718176_1719268_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002288432.1|1720391_1722083_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1722502_1723450_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1723564_1724584_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1724674_1725904_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1726364_1727066_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301319.1|1727674_1728691_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1728687_1729152_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1729158_1729701_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1729684_1730509_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1730597_1731578_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1731601_1733086_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1733097_1734087_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1734334_1734502_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_010729586.1|1734563_1736375_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1736371_1736737_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1736899_1737295_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1737312_1738275_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1738274_1738487_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_106913973.1|1738507_1739206_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1739225_1739768_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1739899_1740904_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1740900_1741890_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1741886_1742693_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1742858_1743815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1743891_1744410_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1744497_1744647_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1744874_1745321_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002305724.1|1745515_1747411_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1747735_1748710_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1749275_1749842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1750097_1751429_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1751394_1751745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1752256_1752601_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1752866_1753826_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1754015_1754612_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1754735_1756535_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1756812_1757025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1757486_1757636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1757888_1758848_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1759060_1759969_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1760017_1760404_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|1760711_1762058_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1762169_1763519_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1763635_1764889_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1764959_1765445_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002305727.1|1765467_1766226_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1766241_1767420_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1767649_1769770_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297185.1|1769886_1771182_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 8
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1776885	1848023	2883830	integrase,transposase	Streptococcus_phage(57.89%)	71	1796727:1796744	1855464:1855481
WP_002297218.1|1776885_1778181_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302293.1|1778499_1778802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1779945_1780260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1780376_1781555_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1781891_1782131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1782492_1782753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1782937_1783435_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1783564_1784275_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1784287_1785952_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1786156_1786819_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1786828_1787644_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1787905_1788349_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1788482_1788821_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1788808_1789186_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1789409_1790603_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1790768_1791191_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1791585_1791780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1791776_1792271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1792432_1793605_-	class C sortase	NA	NA	NA	NA	NA
WP_002288981.1|1793810_1794626_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1794775_1795222_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1795218_1796223_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1796262_1796592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1796717_1799045_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
1796727:1796744	attL	TTCACCTGCTTTTTTCTT	NA	NA	NA	NA
WP_002288970.1|1799887_1800181_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1800583_1801762_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1801865_1802180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1802286_1802502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1802801_1803044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1803030_1803459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|1803610_1805158_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1805259_1805613_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1805602_1805797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|1805927_1807090_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002289210.1|1807654_1808029_-	VOC family protein	NA	NA	NA	NA	NA
WP_002296814.1|1808051_1809452_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289214.1|1809455_1809866_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289215.1|1809883_1810375_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289216.1|1810384_1811176_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289217.1|1811168_1811942_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289218.1|1812097_1814632_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002289219.1|1814713_1815586_-	ROK family protein	NA	NA	NA	NA	NA
WP_002289220.1|1815621_1816089_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289221.1|1816098_1817568_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296810.1|1817638_1819057_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002296809.1|1819178_1820159_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956705.1|1820438_1821601_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1821693_1822203_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302055.1|1822541_1823495_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1823447_1823684_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002305709.1|1824103_1825225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1825552_1826962_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1826958_1827687_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|1827814_1828726_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|1828742_1829750_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002305708.1|1829746_1831876_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002296840.1|1832176_1833364_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298631.1|1834408_1836235_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002288938.1|1838468_1838858_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002305705.1|1838907_1839804_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1839806_1841654_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1841750_1842251_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002298822.1|1842263_1842485_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002297187.1|1842489_1842609_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1842623_1843808_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1844063_1844318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1844342_1845485_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002349191.1|1845544_1846897_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286928.1|1846967_1847312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286926.1|1847321_1847696_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1847708_1848023_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
1855464:1855481	attR	TTCACCTGCTTTTTTCTT	NA	NA	NA	NA
>prophage 9
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1855574	1947900	2883830	head,capsid,holin,tail,integrase,plate,protease,transposase,portal,terminase,tRNA	Enterococcus_phage(24.07%)	105	1852487:1852527	1894422:1894462
1852487:1852527	attL	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_020944989.1|1855574_1856591_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_002302122.1|1856601_1856799_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_002332427.1|1856814_1857057_-|holin	holin	holin	D2J075	Enterococcus_phage	63.3	1.2e-21
WP_002332428.1|1857091_1857229_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002332429.1|1857230_1857677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|1857673_1857823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729422.1|1857839_1859900_-|plate	BppU family phage baseplate upper protein	plate	A0A249XZH9	Enterococcus_phage	44.9	1.7e-65
WP_002290629.1|1859917_1860742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332431.1|1860745_1861795_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	1.9e-31
WP_002350711.1|1861791_1862664_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_002350712.1|1862664_1866513_-	tape measure protein	NA	A0A0M5M3L4	Enterococcus_phage	76.0	0.0e+00
WP_002290636.1|1866512_1866704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002329391.1|1866727_1867039_-	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
WP_002332434.1|1867163_1867724_-|tail	phi13 family phage major tail protein	tail	V5UQL2	Enterococcus_phage	46.2	3.4e-40
WP_002329393.1|1867739_1868111_-	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
WP_002350714.1|1868107_1868503_-	hypothetical protein	NA	C0LZZ2	Enterococcus_phage	44.5	4.3e-21
WP_002342516.1|1868499_1868835_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	44.1	2.2e-18
WP_002350715.1|1868838_1869165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002350716.1|1869179_1870373_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	55.4	1.5e-114
WP_002350717.1|1870369_1871047_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	51.0	4.9e-49
WP_002350718.1|1871081_1872302_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	38.5	1.2e-61
WP_010729418.1|1873856_1874618_-	GIY-YIG nuclease family protein	NA	A0A220BXN1	Staphylococcus_phage	45.9	7.9e-40
WP_010729417.1|1874710_1874869_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	65.9	5.3e-07
WP_002290653.1|1875335_1875857_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	34.2	1.1e-16
WP_002350721.1|1875958_1876123_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	69.8	3.6e-14
WP_016922443.1|1876279_1876597_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	39.8	2.0e-13
WP_016922444.1|1876597_1877143_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016922446.1|1877554_1877719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|1878338_1878752_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_012197617.1|1879238_1879526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197619.1|1879522_1879726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944994.1|1879655_1879925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197625.1|1879921_1880452_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	37.2	1.8e-11
WP_012197627.1|1880444_1880759_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	72.7	4.6e-34
WP_074394665.1|1880758_1881064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|1881060_1881222_-	antitoxin	NA	NA	NA	NA	NA
WP_002350665.1|1881218_1881536_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
WP_012197635.1|1881782_1884095_-	phage/plasmid primase P4 family domain-containing protein	NA	R4IBW2	Listeria_phage	55.9	1.3e-250
WP_012197636.1|1884109_1884610_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.9	1.1e-34
WP_002350668.1|1884611_1885085_-	transcriptional regulator	NA	A8ATW6	Listeria_phage	43.9	7.7e-09
WP_002350669.1|1885075_1886425_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	53.4	4.1e-132
WP_012197638.1|1886399_1887086_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	52.7	1.1e-61
WP_025480431.1|1887204_1887522_-	DUF5406 family protein	NA	F0PIH7	Enterococcus_phage	57.1	1.6e-26
WP_044384563.1|1887527_1887959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350673.1|1888215_1888392_-	hypothetical protein	NA	D7RWL9	Brochothrix_phage	60.7	1.3e-09
WP_002329420.1|1888408_1888888_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_002350675.1|1888820_1889138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|1889305_1889764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342492.1|1889865_1890036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1890066_1890315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1890327_1890513_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002315392.1|1890816_1891191_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002350678.1|1891195_1891624_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012197642.1|1891673_1892327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350679.1|1892462_1893029_+	hypothetical protein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_012197643.1|1893144_1894281_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	8.4e-54
WP_002286913.1|1894412_1894760_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
1894422:1894462	attR	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_002293717.1|1894895_1895657_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1895646_1896168_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1896337_1897129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1897253_1897505_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1897516_1897792_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1898044_1898599_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1898677_1899199_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1899202_1899781_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1899892_1901311_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1901331_1901670_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1901629_1902133_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1902263_1902968_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|1902964_1904701_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002305697.1|1904803_1907275_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.2	3.1e-45
WP_002289807.1|1907599_1908490_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002305696.1|1908686_1909169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1909376_1909742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322761.1|1909945_1910263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287105.1|1910992_1911967_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002297404.1|1912376_1913627_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305694.1|1913912_1914170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1914401_1914815_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_086953915.1|1915093_1916433_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_042959742.1|1916502_1917078_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
WP_094932120.1|1917158_1918320_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
WP_002294835.1|1918694_1919264_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002323057.1|1919337_1920627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305691.1|1920884_1921829_+	MoxR family ATPase	NA	A0A1C9EGB9	Acidianus_two-tailed_virus	26.4	7.6e-08
WP_002323055.1|1921842_1922916_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002305688.1|1922905_1925077_+	transglutaminase	NA	NA	NA	NA	NA
WP_059355943.1|1925188_1927345_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
WP_002349136.1|1927487_1929674_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
WP_002289040.1|1929673_1929883_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1929895_1930336_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002349135.1|1930409_1930883_-	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
WP_002297185.1|1931109_1932405_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288779.1|1932714_1934181_-	amino acid permease	NA	NA	NA	NA	NA
WP_002305684.1|1934491_1936576_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
WP_002288776.1|1937099_1937459_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002323072.1|1937488_1937830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305683.1|1937826_1938501_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002305681.1|1939295_1940594_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002305679.1|1940633_1941824_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1941844_1942372_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1942418_1945208_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1945354_1945555_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1946006_1946327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1946604_1947900_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1981966	2047655	2883830	holin,transposase,tRNA	Bacillus_phage(28.57%)	58	NA	NA
WP_002348661.1|1981966_1984042_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002305598.1|1984043_1984961_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002348660.1|1985346_1986165_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002288753.1|1986307_1987207_-	GTPase Era	NA	NA	NA	NA	NA
WP_010782558.1|1987221_1987623_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002291700.1|1987600_1988077_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002348658.1|1988105_1990298_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002291698.1|1990321_1991293_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002291696.1|1991997_1993377_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_074398935.1|1993658_1994999_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	1.9e-65
WP_002296623.1|1995155_1996451_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002291695.1|1996585_1997032_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	1.6e-19
WP_002287321.1|1997058_1997235_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287322.1|1997396_1997825_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002348657.1|1997916_1998777_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002291691.1|1998870_1999164_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002313517.1|1999236_2000964_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	62.9	2.4e-209
WP_002291688.1|2001176_2002103_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.3e-89
WP_010782557.1|2002247_2003681_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002305593.1|2003680_2005084_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002294948.1|2005313_2006216_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010782556.1|2006256_2008143_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002348652.1|2009426_2011211_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	7.1e-47
WP_002314690.1|2011210_2012962_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.4	1.6e-56
WP_002291670.1|2013103_2013328_-	YneF family protein	NA	NA	NA	NA	NA
WP_002348650.1|2013578_2015165_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002348649.1|2015230_2017006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002308625.1|2017216_2018119_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	1.5e-21
WP_025480886.1|2018397_2020743_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000997695.1|2020983_2022162_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002348961.1|2022251_2022518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305582.1|2022510_2022834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059355912.1|2022845_2024102_-	lipase	NA	NA	NA	NA	NA
WP_010782554.1|2024098_2024494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348958.1|2024536_2024788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348957.1|2024787_2025183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002291653.1|2025537_2026539_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002313499.1|2026748_2027852_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002348956.1|2027914_2028517_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002308608.1|2028519_2028960_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002308607.1|2029084_2030023_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.5e-75
WP_002296128.1|2030037_2031063_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|2031106_2031937_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|2031951_2032890_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|2033056_2033407_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|2033406_2033724_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002303617.1|2034023_2035592_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002299434.1|2035691_2036459_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_074398943.1|2036455_2037496_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002297218.1|2037617_2038913_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289490.1|2039231_2039909_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002289489.1|2039921_2040680_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
WP_002303220.1|2040695_2041502_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.0e-13
WP_002294978.1|2041516_2042401_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|2042400_2043321_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|2043435_2044293_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002300487.1|2044629_2046078_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002297218.1|2046359_2047655_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 11
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	2524698	2646058	2883830	tail,holin,capsid,integrase,plate,protease,transposase,portal,terminase,tRNA	Enterococcus_phage(22.86%)	108	2581149:2581164	2641958:2641973
WP_002301399.1|2524698_2525658_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002285985.1|2525808_2528511_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002285982.1|2528523_2529813_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002285981.1|2529962_2531009_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2531010_2533164_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002285977.1|2533636_2535082_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2535084_2536809_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002285975.1|2536801_2537416_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2537760_2539218_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2539258_2540179_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2540190_2541138_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2541616_2542336_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2542384_2544031_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2544209_2544800_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2544891_2546397_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2546480_2547833_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2547832_2548351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2548366_2548693_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2548705_2550685_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2550705_2551020_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2551187_2551481_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2551558_2552671_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2552823_2553048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2553057_2553237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2553430_2553601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2554024_2555044_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2555190_2558262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|2559912_2561085_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002303189.1|2561500_2562262_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002344993.1|2562361_2564083_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.3e-37
WP_002304835.1|2564097_2565882_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.1e-46
WP_002285917.1|2566262_2567816_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2568163_2570578_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2571004_2573023_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2573392_2574049_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2574048_2575005_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2575004_2575571_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_049052232.1|2576006_2576237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002337498.1|2576242_2576542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|2576577_2576949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|2576950_2577352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|2577365_2577773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|2578695_2579858_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286484.1|2580797_2581823_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
2581149:2581164	attL	ATCTGTCAGCGTAGGA	NA	NA	NA	NA
WP_002286683.1|2581819_2582044_-|holin	holin	holin	NA	NA	NA	NA
WP_002318262.1|2582040_2582334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974452.1|2582371_2582509_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002347165.1|2582510_2582942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|2582955_2583450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298034.1|2583449_2583899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303306.1|2583902_2584523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946725.1|2584522_2585431_-|plate	phage baseplate upper protein	plate	A0A1P8BKW9	Lactococcus_phage	24.3	1.1e-08
WP_049050347.1|2585443_2588206_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.5	1.1e-139
WP_002349898.1|2588202_2588943_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002349899.1|2588932_2591722_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	38.9	5.4e-70
WP_002303297.1|2591963_2592305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|2592304_2592913_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002317765.1|2592913_2593291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946577.1|2593292_2593688_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2593680_2594052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2594051_2594393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2594404_2594620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2594642_2595533_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002349163.1|2595547_2596249_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002298058.1|2596297_2596615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298060.1|2596616_2597495_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002298062.1|2597586_2599116_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.7e-28
WP_048946578.1|2599127_2600543_-	DEAD/DEAH box helicase family protein	NA	C9E2I7	Enterococcus_phage	79.4	1.4e-218
WP_048946579.1|2600535_2601369_-|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	67.9	4.7e-78
WP_048946580.1|2601527_2601758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060763461.1|2602504_2602972_-	hypothetical protein	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002341971.1|2603046_2603487_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
WP_048946598.1|2603516_2603810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946597.1|2603840_2604035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646791.1|2604140_2604593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318210.1|2604618_2605080_-	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	67.1	1.1e-60
WP_002299339.1|2605280_2606132_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_048946585.1|2606146_2606947_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.9	3.0e-58
WP_002301573.1|2606989_2607880_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	1.4e-136
WP_033646797.1|2607881_2608823_-	endonuclease	NA	D2IZK1	Enterococcus_phage	79.2	1.0e-145
WP_002303273.1|2609055_2609391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330811.1|2609716_2609905_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002299325.1|2609982_2610207_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002299323.1|2610203_2610359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297389.1|2610498_2610711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297388.1|2610713_2610926_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002297387.1|2611200_2611611_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	51.4	2.8e-31
WP_002297386.1|2611623_2612076_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_048946584.1|2612166_2613447_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	50.5	2.8e-61
WP_033647077.1|2613518_2614640_+|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	38.5	4.0e-64
WP_049058602.1|2614721_2616494_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.7e-54
WP_002285883.1|2616496_2618209_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002303070.1|2618323_2618992_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2619058_2619847_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2619929_2621402_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2621531_2622725_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002296055.1|2631034_2632531_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2632641_2633646_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2633646_2634534_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2634750_2636862_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2636951_2637497_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2637496_2638942_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2639061_2639532_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2639577_2640003_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2640069_2640339_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287405.1|2640349_2641945_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2641959_2645481_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
2641958:2641973	attR	TCCTACGCTGACAGAT	NA	NA	NA	NA
WP_002287401.1|2645497_2646058_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	2753151	2770047	2883830		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2753151_2753466_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2753478_2753853_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2753862_2754198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2754280_2755621_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2755698_2756373_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002297357.1|2756365_2756530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2756605_2757040_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2757040_2757748_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2757737_2758028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2758286_2759471_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002297352.1|2759485_2759605_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2760350_2762261_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2762364_2762589_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2762601_2763105_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2763164_2763554_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2763540_2765988_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2765992_2768116_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2768112_2769117_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2769135_2770047_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	2691	55756	217014	integrase,transposase	Bacillus_phage(28.57%)	46	3942:3958	12723:12739
WP_002300314.1|2691_3861_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
3942:3958	attL	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290383.1|4333_4888_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002290382.1|5060_5534_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002342357.1|5545_6082_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290380.1|6121_6493_+	glyoxalase	NA	NA	NA	NA	NA
WP_002290379.1|6776_8048_+	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002338088.1|8292_9318_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002350067.1|9611_10721_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002350071.1|11715_12540_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002329911.1|12571_13882_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
12723:12739	attR	AAAATATTAATAAAAAT	NA	NA	NA	NA
WP_002290371.1|14029_15289_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002290370.1|15298_16171_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290368.1|16182_17013_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290367.1|17052_19236_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002342361.1|19296_20517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002335326.1|20513_21974_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002290357.1|23478_23688_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002290356.1|23680_23830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290352.1|24932_26018_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290351.1|26351_26585_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002329899.1|26581_26989_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002287870.1|28125_28644_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002305874.1|29010_29259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108676098.1|29761_30923_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002300328.1|31421_31898_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|31910_33413_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|33426_34116_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|34276_35095_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289255.1|35324_35555_+	resolvase	NA	NA	NA	NA	NA
WP_002301718.1|36140_36596_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_086953894.1|36838_38264_+|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002297218.1|38440_39736_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002302077.1|39956_40919_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|40920_42360_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002293868.1|42544_44491_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002292418.1|44754_45627_+	ROK family protein	NA	NA	NA	NA	NA
WP_010729776.1|47484_47955_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
WP_000824191.1|47999_48167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|48200_48500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|48540_49158_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|49482_49878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|49957_52309_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|52433_53123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|53136_53589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|53823_54965_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_001015311.1|55075_55756_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 2
NZ_CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	69251	110507	217014	protease,transposase	Streptococcus_phage(45.45%)	34	NA	NA
WP_059355947.1|69251_70874_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.3	1.4e-121
WP_002301195.1|71159_72536_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|72535_73192_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|73201_74479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|74728_75890_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010729386.1|75920_76370_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|76525_77068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331383.1|78061_78742_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002292680.1|78989_79847_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292678.1|80408_80738_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002314366.1|80814_81087_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002297422.1|81086_81350_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002336205.1|82494_83670_-	MFS transporter	NA	NA	NA	NA	NA
WP_002314387.1|83672_85922_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002287525.1|86971_88120_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|88136_88541_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323400.1|89847_90783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|91341_91659_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323399.1|91659_91914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|92272_92677_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|92693_93842_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002348857.1|94548_94743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326172.1|96094_97135_+	replication protein RepA	NA	NA	NA	NA	NA
WP_002323647.1|97958_98291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295674.1|98909_99251_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002297404.1|99487_100738_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295673.1|101147_101387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295672.1|101453_101663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002336710.1|101722_102394_+	class A sortase	NA	NA	NA	NA	NA
WP_010729784.1|102446_104423_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_010729785.1|104435_105191_+	class C sortase	NA	NA	NA	NA	NA
WP_002350398.1|105187_106012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025481135.1|106300_108412_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002350400.1|108449_110507_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	146867	194217	217014	transposase	Streptococcus_phage(33.33%)	46	NA	NA
WP_010861579.1|146867_147548_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_010729797.1|147601_148312_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729798.1|148295_149030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301686.1|149246_150260_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301685.1|150270_150681_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301684.1|150680_151148_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301683.1|151165_151912_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301682.1|151911_152721_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_080114943.1|154683_155085_-	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_010729801.1|155311_156490_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_074394709.1|156537_157275_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_002299198.1|157432_158362_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_002299197.1|158434_159046_-	VanZ family protein	NA	NA	NA	NA	NA
WP_010729802.1|159261_160170_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311511.1|161628_162471_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002298377.1|162795_163212_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298375.1|163208_163679_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010729805.1|163692_164466_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298371.1|164479_165292_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002322451.1|165345_166311_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729806.1|166446_169170_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_010729807.1|169182_169815_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|170019_170247_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_014748823.1|170315_170582_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|170571_170841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|171019_172321_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|172549_174097_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|174198_174552_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|174541_174736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|174814_176107_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002336724.1|176869_177838_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288615.1|177848_178664_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_010729750.1|178731_179442_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288620.1|179477_180719_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|180776_181964_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|182498_183899_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|183931_184099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|184964_185825_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162846309.1|186257_187178_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_016922376.1|187226_187832_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.3e-56
WP_002339142.1|187851_189072_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002336713.1|189129_189810_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002331328.1|190305_190527_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|190542_191385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729753.1|191447_193250_+	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_010729754.1|193308_194217_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	0	2672	49542		Enterococcus_phage(100.0%)	4	NA	NA
WP_002326767.1|50_401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073490843.1|397_568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001196543.1|1471_1747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|1718_2672_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
>prophage 2
NZ_CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	6825	14859	49542	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_001015311.1|6825_7506_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002323245.1|8126_9299_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|9450_10146_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|10123_11278_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|11492_12461_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|12453_13485_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|13490_14099_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001015311.1|14178_14859_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 3
NZ_CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	20235	47988	49542	transposase	Streptococcus_phage(68.42%)	29	NA	NA
WP_001062587.1|20235_20853_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	2.9e-16
WP_002331392.1|22483_23131_-	type A-7 chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	54.4	9.0e-69
WP_002331393.1|23260_24199_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000635249.1|26040_26280_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
WP_106913981.1|26328_26397_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002323245.1|26434_27607_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001038795.1|27868_28606_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
WP_086953915.1|29106_30445_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_032458614.1|30599_31454_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.9	2.3e-152
WP_001835296.1|31545_31761_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_002326825.1|31778_32051_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_002332783.1|32052_32916_+	toxin zeta	NA	NA	NA	NA	NA
WP_001067799.1|33693_34374_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_000205227.1|34762_34987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000233000.1|35001_35871_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000662263.1|35851_36586_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|36618_37527_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_001015311.1|38092_38773_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002349227.1|38981_39194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|39355_39874_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|39880_40393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|40496_41792_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002288897.1|42185_42809_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_001015311.1|42904_43585_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000599739.1|43782_44388_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|44403_44976_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_002326781.1|45227_45485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326780.1|45610_46426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|46815_47988_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
